ID: 1098431461

View in Genome Browser
Species Human (GRCh38)
Location 12:70424306-70424328
Sequence GATAATCTTGAAACCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098431460_1098431461 28 Left 1098431460 12:70424255-70424277 CCAAGAAAGCTTTGTTTAGCACT 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1098431461 12:70424306-70424328 GATAATCTTGAAACCAATGCTGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098431461 Original CRISPR GATAATCTTGAAACCAATGC TGG Intronic
906053787 1:42898416-42898438 TTAAATCTTGAAACAAATGCTGG - Intergenic
906512258 1:46416907-46416929 GATAATCAAGAAACCAAGGCCGG - Intergenic
909370749 1:74880648-74880670 CATCATCTTGATACCAAAGCTGG + Intergenic
909782617 1:79565327-79565349 TATAATCATTAAACCCATGCGGG + Intergenic
909944232 1:81645457-81645479 AATAATTTAGAAAGCAATGCTGG - Intronic
909981206 1:82103721-82103743 CTAAATCTTGAAACAAATGCTGG - Intergenic
912208431 1:107533252-107533274 TATAATTTCTAAACCAATGCTGG + Intergenic
915997812 1:160582056-160582078 GGTATTGATGAAACCAATGCAGG + Intergenic
920999692 1:211031402-211031424 GATCATCCTGATACCAAAGCCGG + Intronic
923037826 1:230297360-230297382 CATAATCCTGATACCAAAGCCGG - Intergenic
923649781 1:235863699-235863721 AATAATCATGAAATCAAAGCTGG + Intronic
923808470 1:237286959-237286981 CAGAATCTTGAAACAAATCCTGG - Intronic
1062950395 10:1495888-1495910 GATAATGTTGATACTAATGAAGG - Intronic
1064921870 10:20528195-20528217 CATTATCTTGAAACCAAAGACGG - Intergenic
1065019393 10:21491762-21491784 GATAATAGGAAAACCAATGCTGG - Intergenic
1065186643 10:23175057-23175079 GTTAGTCTTGAAACCAAATCGGG - Intergenic
1066467197 10:35663120-35663142 AATAATATTGCAACCAATGCAGG + Intergenic
1068582138 10:58753567-58753589 GATTATCTAGAAACTGATGCTGG - Intronic
1070514706 10:77193822-77193844 GAGAATCTAGACACAAATGCTGG + Intronic
1071094724 10:81959997-81960019 GAAAATCTAGAAACAAATTCAGG - Intronic
1071381910 10:85074496-85074518 CATAATCCTGATACCAAAGCTGG - Intergenic
1071622728 10:87137203-87137225 GATAATTATGAAAAAAATGCTGG + Intronic
1072581358 10:96742539-96742561 GAAAATTGTGAACCCAATGCTGG + Intergenic
1073165637 10:101447216-101447238 GTTATTCTTGAAACCTATCCAGG + Intronic
1075884654 10:125888165-125888187 GATAATGTTGAAACAAATTCTGG - Intronic
1082949503 11:58796662-58796684 GATGATTTTGAAACCACTGCAGG + Intergenic
1085965298 11:81515800-81515822 GTTAAGCATGAAACCAATACTGG - Intergenic
1086016258 11:82171007-82171029 CATCATCTTGATACCAAAGCCGG + Intergenic
1086242882 11:84717254-84717276 GGTAATCTTGAAATGACTGCAGG + Intronic
1086420997 11:86637107-86637129 GTTAGTCTTGAAACCAATTGGGG - Intronic
1087009771 11:93502088-93502110 GATAATCTGGCAGGCAATGCAGG + Intronic
1090337007 11:125976328-125976350 GCTAACCTTGAAGGCAATGCAGG + Intronic
1091395075 12:149420-149442 GATAATCTTGGCAGCAAAGCAGG + Intronic
1093228023 12:16508957-16508979 AAGAATCTTCAAACCACTGCTGG - Intronic
1094712619 12:32979808-32979830 GATAACCTTGAAACCCTTGGAGG - Intergenic
1097074168 12:56380283-56380305 GCTCATCTTGAAACTAAAGCGGG - Intergenic
1098431461 12:70424306-70424328 GATAATCTTGAAACCAATGCTGG + Intronic
1098506927 12:71263808-71263830 CATCATCTTGATACCAAAGCCGG + Intronic
1099839400 12:87946845-87946867 CATCATCCTGATACCAATGCTGG + Intergenic
1100970500 12:100064791-100064813 CAAAATCTTGAAACAAATCCTGG + Intronic
1102283784 12:111638637-111638659 GATGGCCTTGAAACAAATGCAGG - Intergenic
1104313747 12:127678148-127678170 GATCATATTGAAACGATTGCTGG + Intergenic
1104782443 12:131430472-131430494 AATCATCCTGAAAACAATGCTGG - Intergenic
1107062982 13:36180977-36180999 GATAATTTTAAAACAATTGCTGG - Intronic
1107374592 13:39788355-39788377 GATCATCTTGTAACCAGTGCAGG + Intronic
1108980189 13:56501261-56501283 GCTAGACTTGAAACTAATGCAGG - Intergenic
1110811813 13:79819537-79819559 CATCATCTTGATACCAAAGCCGG - Intergenic
1111903660 13:94230424-94230446 CATAATCTTAACACCAATGGTGG - Intronic
1113637980 13:111934997-111935019 GTAAATCTTGAAACAAATCCTGG - Intergenic
1114141261 14:19913652-19913674 GATCATCCTGATACCAAAGCCGG + Intergenic
1116637590 14:47416994-47417016 GGTAATCTTGAAGAGAATGCTGG + Intronic
1118001028 14:61523860-61523882 GATTATTTTGAAACAAATCCAGG - Intronic
1202873359 14_GL000225v1_random:185734-185756 GAAAATGTTGAAACAAATTCTGG + Intergenic
1126841137 15:52718466-52718488 GGAAATCTTGAAATCAATCCCGG + Intergenic
1127194643 15:56570383-56570405 TAAAATCTTGAAACAAATCCTGG + Intergenic
1128227889 15:66015025-66015047 GATAAGCTTGAAAGCAATCATGG - Intronic
1133254259 16:4507021-4507043 GACAGTCTGGAACCCAATGCGGG - Intronic
1134184397 16:12072650-12072672 CATCATCTTGATACCAAAGCCGG - Intronic
1136192026 16:28622515-28622537 GAAAATCTTGTTACCAAAGCAGG + Intronic
1137361096 16:47816117-47816139 GAAAATCTTGGAATCAGTGCTGG + Intergenic
1137600257 16:49751692-49751714 AATGATCTTCAAACCCATGCTGG + Intronic
1138371271 16:56528637-56528659 GATCTTTTTGAAACCAGTGCAGG - Intergenic
1140641883 16:76984343-76984365 GATAATCTTTATACCAACCCTGG - Intergenic
1146774203 17:35597485-35597507 AATAATCTTGAAACCAAGAATGG - Intronic
1156602768 18:38629907-38629929 GTTAATCTTCAAACCATTGTTGG + Intergenic
1156981131 18:43289574-43289596 CATCATCTTGATACCAAAGCCGG + Intergenic
1164497297 19:28778247-28778269 GAGAAAGTTGAAACCAATGCAGG + Intergenic
926108700 2:10168575-10168597 AATAATCTTGATACCAACTCTGG + Intronic
926805229 2:16704165-16704187 TACAGTCTTGAAACCAAAGCTGG + Intergenic
927367674 2:22318057-22318079 GATAATATTGAAACAAAATCAGG - Intergenic
931192050 2:60011641-60011663 GATAATCTTGAAGCAGAAGCAGG - Intergenic
931524986 2:63143577-63143599 GTAAATCTTGAAACAAATTCTGG - Intronic
935753892 2:106262271-106262293 GAGAGGCTTGTAACCAATGCAGG + Intergenic
937069070 2:119048794-119048816 CAAAATCTTGAAACAAATCCTGG - Intergenic
938681415 2:133694764-133694786 AATAATCTTGATACCAAAACAGG + Intergenic
940604838 2:155908518-155908540 GAGAATCTTGATGCTAATGCAGG - Intergenic
941481059 2:166013762-166013784 GAGAATCATGAAAACAATGAAGG + Exonic
944211392 2:197210232-197210254 GACTGTCTTGAATCCAATGCTGG + Intronic
947771104 2:232671035-232671057 GATAATGTTTAAACCATTGTAGG + Intronic
948497090 2:238357798-238357820 TATAAAATTGAAACCAATGGAGG - Intronic
948931642 2:241136034-241136056 GATATTCTAGAAAACAAAGCAGG + Exonic
1171514280 20:25716136-25716158 GATCATCCTGATACCAAAGCCGG - Intergenic
1177484142 21:21733921-21733943 AATTATCTTGAGACAAATGCAGG - Intergenic
1179601803 21:42483526-42483548 AAAAATCTTGAAAAAAATGCAGG - Intronic
1180284732 22:10733785-10733807 GATAATGTTGAAACAAATTCTGG - Intergenic
951072325 3:18345686-18345708 GATAGTGTGGAAACCAATGGAGG - Intronic
955951502 3:64247051-64247073 GAAAATCCTGAAACCAAAACAGG + Intronic
958527759 3:95285427-95285449 CATCATCTTGATACCAAAGCCGG - Intergenic
958766960 3:98380433-98380455 CATAATCCTGATACCAAAGCCGG - Intergenic
959663906 3:108900643-108900665 TATAATCTTTATACCAATGACGG + Intergenic
960516710 3:118609817-118609839 CTAAATCTTGAAACAAATGCTGG + Intergenic
961573498 3:127816974-127816996 GAAAATCCTGAAAACCATGCAGG + Intronic
962401666 3:135065836-135065858 CTAAATCTTGAAACAAATGCTGG - Intronic
963237037 3:142965640-142965662 GATAAACTTGAATCCAGGGCAGG + Intronic
965015217 3:163148959-163148981 GATCATCCTGATACCAAAGCCGG - Intergenic
965922082 3:173929254-173929276 GAAAAACTTGTAACCATTGCAGG + Intronic
970021986 4:11579859-11579881 CATCATCTTGATACCAAAGCCGG - Intergenic
970910325 4:21267831-21267853 CATCATCTTGATACCAAAGCCGG - Intronic
973139450 4:46748107-46748129 AAAAATCTTGGAACCAATACTGG + Intronic
974238317 4:59210112-59210134 CATCATCCTGAAACCAAAGCTGG + Intergenic
974770126 4:66401632-66401654 CATCATCCTGATACCAATGCCGG - Intergenic
974795909 4:66749270-66749292 TATAATCTTGAAACAACAGCAGG + Intergenic
975034146 4:69660044-69660066 GTAAATCTTGAAACAAATCCTGG + Intergenic
976341047 4:83944871-83944893 GATAATATTTAAAACAATGTTGG - Intergenic
976396584 4:84562280-84562302 GATAATTATGTACCCAATGCCGG + Intergenic
976489322 4:85650136-85650158 GATAATTCTCAAATCAATGCTGG - Intronic
976656382 4:87492851-87492873 GATAATCTGGAAACTACAGCAGG - Intronic
977791476 4:101109158-101109180 GATAAACTTGAAATTAATTCTGG - Intronic
981400807 4:144312130-144312152 GTTAATCTTGAAACAAATCCTGG - Intergenic
986209879 5:5661875-5661897 GATCATCAGGAAACCAATTCTGG - Intergenic
989027474 5:37084280-37084302 GTAAATCTTGAAACAAATCCAGG + Intergenic
992755945 5:79905948-79905970 GATCATCCTGATACCAAAGCCGG + Intergenic
994802961 5:104402590-104402612 GATTATTTTGAAACCATTGATGG - Intergenic
995569875 5:113468664-113468686 CATCATCTTGATACCAAAGCCGG - Intronic
997888631 5:137655275-137655297 GATAGTATTCAAACCAATGGGGG + Intronic
999415491 5:151391884-151391906 CATCATCTTGATACCAAAGCCGG - Intergenic
999883854 5:155898214-155898236 GATGACTTTGGAACCAATGCAGG + Intronic
1000799533 5:165707220-165707242 GATAATCTTTAAAGTAATGGAGG - Intergenic
1003077874 6:2999012-2999034 GAAAGTCTTGAAACCAGAGCCGG - Intronic
1008286169 6:49653894-49653916 GTTAATTTTAAAACCAAAGCTGG - Intergenic
1011853542 6:91660502-91660524 AATATTCCAGAAACCAATGCTGG + Intergenic
1012229579 6:96745262-96745284 GATTATGGAGAAACCAATGCTGG - Intergenic
1015980341 6:138832100-138832122 AATAAACTTGAAACCAAAGGAGG - Intronic
1017214764 6:151897824-151897846 CCAAATCTTGAAACAAATGCTGG - Intronic
1020800438 7:12726095-12726117 GAAAATCTTGGAACCAATGTGGG - Intergenic
1021047280 7:15939313-15939335 GATAATCTTGAAGAAGATGCAGG - Intergenic
1024970723 7:55067266-55067288 AATAGTCTTGAAAGCATTGCAGG - Intronic
1028561086 7:92177250-92177272 TATAACCTTGAAACCAAAACTGG - Intronic
1028729284 7:94126782-94126804 GAAAATTTTGAAAACAATGTAGG - Intergenic
1034705328 7:153137990-153138012 CATAATCTTGAAACAAATACTGG - Intergenic
1035151395 7:156875817-156875839 GTAAATCTTGAAACAAATCCTGG + Intronic
1036370468 8:8158353-8158375 CATCATCTTGATACCAAAGCCGG + Intergenic
1036598351 8:10235818-10235840 TATAACCTTGATACCAATTCTGG + Intronic
1036880424 8:12507278-12507300 CATCATCTTGATACCAAAGCCGG - Intergenic
1037554528 8:20009368-20009390 GATAATCTTTATACCAATTCTGG + Intergenic
1042141426 8:65682872-65682894 GCTGATCTTGAAACCAATGACGG - Intronic
1042605686 8:70543617-70543639 GATATTCTTGATTCAAATGCTGG - Intergenic
1043874858 8:85474529-85474551 GATAAACTTGAAAACATTTCAGG - Intronic
1044046014 8:87433229-87433251 GAGAATATTGAAACTAATGTAGG - Intronic
1045185864 8:99837428-99837450 AAAAATCTTCAAACCCATGCAGG - Intronic
1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG + Intronic
1046369405 8:113281813-113281835 GTAAATCTTGAAACAAATCCTGG - Intronic
1049458407 8:142707332-142707354 TATAATTCTGAAAACAATGCTGG - Intergenic
1052563048 9:30110387-30110409 CATCATCTTGATACCAAAGCCGG + Intergenic
1054836700 9:69682551-69682573 GATCATCCTGATACCAAAGCTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1056521248 9:87403616-87403638 GATAATCTGGAAAAGTATGCTGG + Intergenic
1058418802 9:104816055-104816077 GATAATCCTGCTCCCAATGCAGG + Intronic
1203731099 Un_GL000216v2:90804-90826 GAAAATGTTGAAACAAATTCTGG - Intergenic
1186647497 X:11522894-11522916 CATCATCCTGAAACCAAAGCCGG + Intronic
1188546802 X:31316635-31316657 TATAATCATGAAAACAATTCAGG - Intronic
1191173938 X:57480271-57480293 CATCATCTTGATACCAAAGCCGG + Intronic
1191763312 X:64667450-64667472 GATCATCCTGATACCAAAGCCGG - Intergenic
1192933652 X:75835746-75835768 GATCATCCTGATACCAAAGCTGG - Intergenic
1193965450 X:87979840-87979862 GAAAATCTTCAAAACACTGCTGG + Intergenic
1195875234 X:109534158-109534180 GATAATATAGAAACCAATGATGG - Intergenic
1196014794 X:110927278-110927300 GAAAATAATGAAACCAAAGCTGG + Intergenic
1196112220 X:111958792-111958814 GAGAATCTTGAAATCAGTGAGGG + Intronic
1197612370 X:128653698-128653720 GATAATCTTCAGATCAATGAGGG + Intergenic
1197917947 X:131556339-131556361 GATCATCCTGATACCAAAGCCGG + Intergenic
1198513729 X:137382200-137382222 GAGAATCTTGAAAGCAATGAGGG + Intergenic
1201334431 Y:12864861-12864883 GATCATCTTGAGGCCAGTGCAGG + Intergenic