ID: 1098435984

View in Genome Browser
Species Human (GRCh38)
Location 12:70468512-70468534
Sequence AGCCCCTGGAGGTAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098435984_1098435990 -5 Left 1098435984 12:70468512-70468534 CCTCTCCCTTACCTCCAGGGGCT No data
Right 1098435990 12:70468530-70468552 GGGCTGAGACGCATGGACCAAGG No data
1098435984_1098435993 10 Left 1098435984 12:70468512-70468534 CCTCTCCCTTACCTCCAGGGGCT No data
Right 1098435993 12:70468545-70468567 GACCAAGGGTCCGGCATAGCTGG No data
1098435984_1098435991 -4 Left 1098435984 12:70468512-70468534 CCTCTCCCTTACCTCCAGGGGCT No data
Right 1098435991 12:70468531-70468553 GGCTGAGACGCATGGACCAAGGG No data
1098435984_1098435992 1 Left 1098435984 12:70468512-70468534 CCTCTCCCTTACCTCCAGGGGCT No data
Right 1098435992 12:70468536-70468558 AGACGCATGGACCAAGGGTCCGG No data
1098435984_1098435995 14 Left 1098435984 12:70468512-70468534 CCTCTCCCTTACCTCCAGGGGCT No data
Right 1098435995 12:70468549-70468571 AAGGGTCCGGCATAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098435984 Original CRISPR AGCCCCTGGAGGTAAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr