ID: 1098442668

View in Genome Browser
Species Human (GRCh38)
Location 12:70534784-70534806
Sequence CTCATTCATCTCCCCAAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098442662_1098442668 29 Left 1098442662 12:70534732-70534754 CCTATGGGCTGAAACTACAAGAG 0: 1
1: 0
2: 0
3: 15
4: 420
Right 1098442668 12:70534784-70534806 CTCATTCATCTCCCCAAGCTCGG 0: 1
1: 0
2: 2
3: 12
4: 199
1098442667_1098442668 1 Left 1098442667 12:70534760-70534782 CCAGCGAAAGTGGGGTTCACAGA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1098442668 12:70534784-70534806 CTCATTCATCTCCCCAAGCTCGG 0: 1
1: 0
2: 2
3: 12
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098442668 Original CRISPR CTCATTCATCTCCCCAAGCT CGG Intronic
901464662 1:9413520-9413542 CTCATTCACCCCCACAAGCAAGG - Intergenic
902949373 1:19869862-19869884 CTCATTCTGCTACCCAGGCTGGG - Intergenic
905087198 1:35391323-35391345 CTCATTGTTCTCCCCCACCTGGG + Intronic
906448230 1:45922124-45922146 CTCCCTCCTCTCCCCAAGCCTGG + Intronic
906468212 1:46103954-46103976 CTCACTCTTTTGCCCAAGCTGGG + Intronic
908167441 1:61472291-61472313 CTCATTCCTCTCCTCAAACGGGG - Intergenic
908509664 1:64841402-64841424 CTCCTGTTTCTCCCCAAGCTGGG + Intronic
908776785 1:67648359-67648381 CTGCCTCAGCTCCCCAAGCTGGG - Intergenic
911125259 1:94335394-94335416 CTCATTCTTCTCCACTTGCTGGG + Intergenic
912840734 1:113036957-113036979 TTCATTCATCTCCTATAGCTTGG + Intergenic
915727483 1:158028100-158028122 CTCATTCCTGCCCCCAGGCTTGG + Intronic
918328338 1:183431872-183431894 CTCACTCTTTTCCCCAAGCAAGG - Intergenic
921756442 1:218862282-218862304 CTCATTCCTCTCACCAAACAAGG + Intergenic
922818129 1:228465620-228465642 GTCATTTATCTGCCCTAGCTGGG + Intergenic
923043230 1:230334561-230334583 CTGATTCTTCTCCTCAACCTTGG + Intronic
923507669 1:234620246-234620268 CTAACTCGTCTCCCCAAACTAGG + Intergenic
924762598 1:247002668-247002690 CTGCTTCAGCTTCCCAAGCTGGG - Intronic
1067697848 10:48548522-48548544 CTAATTCATCTCACCAAACATGG + Intronic
1069010037 10:63362508-63362530 CTCACTCTTTTGCCCAAGCTGGG + Intronic
1069055893 10:63844407-63844429 CTCTTTCTTCTTCCCCAGCTTGG + Intergenic
1070283741 10:75069174-75069196 CTAATTGATTTCCCCAATCTTGG + Intergenic
1070314456 10:75296595-75296617 CTCATTCATCTCCACCAGGCTGG - Intergenic
1071196891 10:83171744-83171766 TTTATTCTTCTCCCCAAGCAAGG + Intergenic
1071515592 10:86294638-86294660 CACAAGCATGTCCCCAAGCTGGG - Intronic
1072558781 10:96548982-96549004 CTTATTCATCTCTCCAAGATGGG + Intronic
1077263954 11:1639790-1639812 TTCCTTCTTTTCCCCAAGCTGGG + Intergenic
1078016271 11:7617632-7617654 CTGATTCCTCTTCCCAGGCTGGG + Intronic
1078404318 11:11056134-11056156 CTCATTCAGGTCCTCATGCTAGG + Intergenic
1081867230 11:46366588-46366610 CTCATTCATGCCCACAAGCCCGG - Exonic
1082796796 11:57383683-57383705 CTCATTCATTGGCCCAAGCCAGG + Intergenic
1083016635 11:59460894-59460916 CTCATTCTGCTGCCCAGGCTGGG - Intergenic
1083540849 11:63510683-63510705 CCCATTCATCTTCCCAAGCTGGG - Intronic
1085519282 11:77128658-77128680 CACATCCATCTTCCCAGGCTCGG - Intronic
1085619453 11:78026736-78026758 CTCATTCCACTGCCCAAGCTGGG - Intronic
1089391371 11:118104285-118104307 CTCAGACATTTCCCCAGGCTGGG + Intronic
1089667933 11:120032194-120032216 TTCATCCAGCTCCCCAGGCTGGG - Intergenic
1089722185 11:120436290-120436312 GTCATTCATTTCTCCAAGGTGGG + Intronic
1090250781 11:125250209-125250231 CAAATTTATCACCCCAAGCTGGG - Intronic
1090464080 11:126917968-126917990 GTGACTCATCTCTCCAAGCTGGG + Intronic
1095443743 12:42264414-42264436 CACCTTCACCTCCCAAAGCTAGG + Intronic
1096165214 12:49416841-49416863 CTCATTCTTCTCCCCATGAAGGG - Intronic
1096635751 12:52958013-52958035 CTCAGTCATCTTCCCATGCTGGG - Intergenic
1098442668 12:70534784-70534806 CTCATTCATCTCCCCAAGCTCGG + Intronic
1099600538 12:84730928-84730950 CTCATTCATCACCCTAAGGGAGG - Intergenic
1101023521 12:100577747-100577769 CTGAATCATCTCCCCAATTTAGG - Intronic
1101858795 12:108465634-108465656 GTGATTCATCTTCCCAAGCTAGG - Intergenic
1102203917 12:111077246-111077268 CTCTTTCAACTCCCCAAGCAGGG - Intronic
1104624196 12:130338727-130338749 CTCCTGCATCTCCCAAACCTGGG - Intronic
1105417663 13:20227351-20227373 CTCATTTTTCTCAGCAAGCTCGG - Intronic
1107596988 13:41973406-41973428 CACAGCCATTTCCCCAAGCTCGG - Intergenic
1109535354 13:63710547-63710569 CTCATTCTTCTCATCAAGCAAGG - Intergenic
1110274000 13:73622225-73622247 TTCATTCATCAACCCAAGGTTGG - Intergenic
1110790123 13:79578554-79578576 CACATACATCTTCCCAAGCCAGG - Intergenic
1115072410 14:29340437-29340459 CTCATACAAGTCCCCAAGCTTGG - Intergenic
1116584141 14:46680439-46680461 CTCACTCTTCTCCCCAAGGCTGG - Intergenic
1123003872 14:105312112-105312134 CGCATTCATCTCCTCAGCCTGGG - Exonic
1126153937 15:45547724-45547746 TTCAGTCATCTTCCCCAGCTAGG + Intergenic
1127148201 15:56047619-56047641 CTCATTCCTCTCTCCCAGCTCGG - Intergenic
1127295243 15:57603440-57603462 TTTTTTCATCTTCCCAAGCTGGG + Intronic
1128144359 15:65324347-65324369 CTCTGTCATCTACCCAAGCCTGG + Intergenic
1128781624 15:70362336-70362358 CTTATTCATCTGCCCAACTTTGG - Intergenic
1128803401 15:70512694-70512716 GTCATTCATATCCCAAACCTTGG + Intergenic
1129058848 15:72844206-72844228 CACCTCCATCTCCTCAAGCTGGG + Intergenic
1130778736 15:87012242-87012264 CTCATTATTCAGCCCAAGCTAGG + Intronic
1130960494 15:88655666-88655688 CTTATTCTTCTCTCCAAGCTGGG + Exonic
1131716079 15:95112314-95112336 CTCTCTCATCTCCCCCAGATGGG + Intergenic
1133387528 16:5381997-5382019 CATCTTCATCTCCCCAAACTGGG + Intergenic
1134666106 16:16019864-16019886 CTGTGTCATCTCCCCCAGCTCGG + Intronic
1137386757 16:48049170-48049192 TTCATCCATCTCCAAAAGCTAGG - Intergenic
1137799207 16:51247214-51247236 CACAGTCCTCTGCCCAAGCTGGG - Intergenic
1138322620 16:56129453-56129475 CTTTTTCATCTTCCCCAGCTGGG - Intergenic
1140811536 16:78583590-78583612 CCCATTCATCTTCCCAAGCTGGG + Intronic
1141245290 16:82301616-82301638 CTCCTGCATCCCCACAAGCTAGG - Intergenic
1141678697 16:85531384-85531406 CTCATCCGTCTACCCAAGCAAGG - Intergenic
1143919397 17:10318892-10318914 GTCAATCTGCTCCCCAAGCTCGG + Exonic
1143937394 17:10501212-10501234 GTCAATCTGCTCCCCAAGCTCGG + Exonic
1143939807 17:10528792-10528814 GTCAATCTGCTCCCCAAGCTCGG + Exonic
1143951744 17:10638145-10638167 GTCAATCTGCTCCCCAAGCTCGG + Exonic
1144453644 17:15401428-15401450 CTCATTCCTCTCACCAAACAGGG - Intergenic
1145901075 17:28490898-28490920 CTCATTTTTCTCACCAAGCTTGG - Exonic
1146022152 17:29289025-29289047 CTCCCTCAGCTCCCCCAGCTGGG - Intronic
1147369379 17:39981065-39981087 CTCTTTCATCTCCACATCCTGGG - Exonic
1148113695 17:45162263-45162285 CCCAACCTTCTCCCCAAGCTGGG - Intronic
1148851363 17:50557038-50557060 CTCTTCCACCTCCCCAGGCTGGG - Intergenic
1150580877 17:66472882-66472904 CTCATTCACCTCCACAAATTAGG - Intronic
1152267946 17:79307055-79307077 CTCATTCTTCTCCCCAGGGATGG - Intronic
1152775565 17:82199534-82199556 CTCATTCTTCTCTCCAAACCTGG - Intronic
1153888857 18:9493930-9493952 CTCATTTTTCTCCCCAAGGCAGG + Intronic
1155006332 18:21732819-21732841 CTCATTCCTCTCCTCAAACAAGG - Intronic
1158899995 18:61953625-61953647 CTCATTCTTCTTCACAACCTGGG - Intergenic
1159687800 18:71445005-71445027 CTCATTCTTTCACCCAAGCTGGG + Intergenic
1160123294 18:76148868-76148890 CTCTTTCTACTCCCCAGGCTTGG - Intergenic
1161975865 19:7607563-7607585 CTGCATCCTCTCCCCAAGCTGGG + Intronic
1162609744 19:11739650-11739672 GTCAAACATATCCCCAAGCTGGG + Intergenic
1162947729 19:14053956-14053978 CTCATTCATCTCCTCTGCCTGGG + Exonic
1163230504 19:15998602-15998624 CAGATCCATCTCCTCAAGCTTGG + Intergenic
1165452046 19:35889489-35889511 CTCATTCCTCACCCCCAGGTGGG - Intronic
928772729 2:34721000-34721022 CAAATCCATCTACCCAAGCTGGG + Intergenic
929812916 2:45206749-45206771 CTAATCCATCTGCCCAACCTAGG + Intergenic
930465555 2:51744351-51744373 CTCTTTAATCTCCCTAATCTAGG + Intergenic
932216136 2:69967172-69967194 CTGATTCATCTCTCCAAGTGAGG - Intergenic
933206756 2:79515083-79515105 CTCCTTCAACTCCCCATGGTAGG + Intronic
933476095 2:82792615-82792637 CTCATTCATTACCACAAGCATGG - Intergenic
934892532 2:98083262-98083284 CTCATTCACCCTCCCAATCTTGG + Intergenic
935329115 2:101963334-101963356 CTCATCCATCTCCCCAGTCCTGG + Intergenic
935473254 2:103485244-103485266 CTCATTCCTCTCATCAAGCAAGG + Intergenic
936041605 2:109154307-109154329 CCCAATCACCTACCCAAGCTGGG - Intronic
936862844 2:117038123-117038145 CTCATTCTGCTACCTAAGCTGGG - Intergenic
937062555 2:118991374-118991396 CACCTTCGTCTCCCAAAGCTTGG + Intronic
937259044 2:120573791-120573813 GTTATTCTTCTCCCCAAGATGGG + Intergenic
941283470 2:163581132-163581154 GTCCTTCATCTCCCGAAGTTGGG + Intergenic
942775182 2:179572631-179572653 CCCTTCCATCTACCCAAGCTGGG - Intronic
943034419 2:182723905-182723927 CTCATTCCTCTCATCAAGCAAGG - Intronic
943138579 2:183948781-183948803 CTCATTTCTCTCCCCACTCTTGG + Intergenic
945795531 2:214358249-214358271 CCCTTGCATCTACCCAAGCTTGG + Intronic
947219227 2:227777275-227777297 TTCATCCATCTCCAAAAGCTAGG + Intergenic
947526372 2:230878916-230878938 CTCATTGCTTTCTCCAAGCTTGG + Exonic
947591853 2:231390346-231390368 TTCAGTCATGTCCCCAACCTAGG - Intergenic
1168925214 20:1573802-1573824 CTCACTCATCTTCCCAGGGTGGG - Intronic
1168929092 20:1606830-1606852 CTCACTCATCTTCCCAGGGTGGG - Intronic
1170956419 20:20984218-20984240 CTCTTTCACCTCCTGAAGCTGGG - Intergenic
1172090495 20:32428440-32428462 ATCATTCATCCTCCCAGGCTAGG - Intronic
1173691147 20:44962090-44962112 CTGATTCACTTCCCCAGGCTGGG - Intergenic
1174193785 20:48758464-48758486 GTCTTTCACCCCCCCAAGCTCGG - Intronic
1174992768 20:55530594-55530616 CTGATACATCTCCCCCAGCCAGG + Intergenic
1176222393 20:63975827-63975849 CTCTTTCCTCTCCCCAGGCCGGG - Exonic
1178964465 21:37103108-37103130 CTCTTTCCTCTCCCCACCCTTGG - Intronic
1180249085 21:46567637-46567659 CTCATTCATCTCCGGCACCTGGG - Exonic
1180700491 22:17778893-17778915 CTCATTCATATCCTCAAACACGG + Intergenic
1181886646 22:26027049-26027071 CTCAGTTTTCTCCCCATGCTCGG - Exonic
949254360 3:2027920-2027942 CTGATTCATCTTCTCATGCTGGG - Intergenic
949920941 3:9000037-9000059 AGCCTCCATCTCCCCAAGCTTGG - Intronic
950117602 3:10461623-10461645 CTCATTCATCTCTGCAGGGTGGG - Intronic
950504977 3:13388978-13389000 CCCCGACATCTCCCCAAGCTGGG - Intronic
950801725 3:15557256-15557278 CCCATTCATCTCCTCAACCCTGG + Intergenic
952424566 3:33162364-33162386 CACATTGATTTCCCGAAGCTGGG + Intronic
953979802 3:47407925-47407947 CTCATTCTTGTCCTCAATCTTGG - Exonic
955059030 3:55481313-55481335 CTCCGTCCTCTCCCCAACCTGGG + Intronic
955342669 3:58137418-58137440 CTCAGGCTTCTGCCCAAGCTGGG - Intronic
955853706 3:63249849-63249871 GTCATTCATCCCCCAAAGCAAGG - Intronic
955963922 3:64368711-64368733 CTCATTCACCCCACCCAGCTGGG - Intronic
956392967 3:68794120-68794142 CTCATGTATCTACCAAAGCTTGG - Intronic
961421505 3:126808781-126808803 CTCATTCCTCTCACCAAACGAGG - Intronic
961782125 3:129326480-129326502 CCCCGACATCTCCCCAAGCTGGG - Intergenic
961934426 3:130568491-130568513 CCCACTGATCTCCTCAAGCTGGG - Exonic
962944303 3:140153470-140153492 CTCACTCTTCTCCACCAGCTAGG + Intronic
964182130 3:153901932-153901954 GTCATTCTACTCCCCAAGATTGG + Intergenic
965113208 3:164452976-164452998 TTCTTTCATCTCCTCCAGCTGGG + Intergenic
967014674 3:185471097-185471119 CTCATTCATCTCATCAAACAAGG - Intronic
967777304 3:193397745-193397767 CTCATTCATTTCCCCATTATGGG + Intergenic
968845062 4:3036372-3036394 CTCATTCATACCCTCAAGGTGGG - Intronic
973867775 4:55131156-55131178 CTCAATCATTTCCCCAAGGTAGG - Intergenic
975779942 4:77827884-77827906 CTAATTCATCTCCACAAACGGGG - Intergenic
977816097 4:101416044-101416066 CTCATTCTGCCCACCAAGCTTGG + Intronic
982138116 4:152292125-152292147 CTCATGCATCTCCCTAAGCAGGG - Intergenic
982705514 4:158704822-158704844 CCACTTCATCTCCCCACGCTAGG - Intronic
983835608 4:172379753-172379775 TTTATTCATTTCCCCAAGCCTGG - Intronic
986957927 5:13177884-13177906 CTCATTCTGCTCCCCAAAATAGG - Intergenic
987609867 5:20189376-20189398 ATCATGCATTTCCCCTAGCTTGG + Intronic
988004874 5:25396565-25396587 CTCATTCCTCTCATCAAGCAAGG + Intergenic
991999551 5:72422266-72422288 CTCATTCATCTCATCAAACATGG - Intergenic
994480020 5:100322778-100322800 CTCTCTCATCTCCCCCAGATGGG + Intergenic
996066039 5:119080380-119080402 CTCAGTCAACTCCCCTACCTTGG + Intronic
996984645 5:129544856-129544878 CTCATCCATCACCCCAGGTTAGG + Intronic
998250508 5:140549029-140549051 CTCCTTCAGCTCCTCCAGCTTGG - Exonic
1001138613 5:169123991-169124013 CTCATTCCTCTCATCAAGCAAGG + Intronic
1001193958 5:169654920-169654942 CTCACTCCCCTCCCCAAGCTGGG + Intronic
1002070976 5:176678835-176678857 CTTGCTGATCTCCCCAAGCTGGG + Intergenic
1002671182 5:180868832-180868854 CTCACTCACCTCCCCAGGATTGG + Intergenic
1005022197 6:21429035-21429057 CATATTTATCTCTCCAAGCTTGG - Intergenic
1007244967 6:40454590-40454612 CTCATTTTTCTCCCCTACCTAGG + Intronic
1007983659 6:46185589-46185611 TTCATTCATAGCACCAAGCTTGG + Intergenic
1007995289 6:46301420-46301442 GACATTCTACTCCCCAAGCTGGG + Intronic
1008496279 6:52137350-52137372 CTTATTCATTTCCCCATGCCTGG - Intergenic
1010117606 6:72333311-72333333 AACATTCATCTCCCCATGCATGG + Intronic
1014320287 6:119919776-119919798 ATCATTCATATCCCAAATCTCGG - Intergenic
1014351942 6:120356664-120356686 CTCATTTCGTTCCCCAAGCTGGG - Intergenic
1016588131 6:145712759-145712781 CTCATTCATCTCATCAAACAAGG + Intronic
1017125324 6:151059239-151059261 CTCACTCTTTTCCCCAGGCTGGG + Intronic
1017407296 6:154134223-154134245 ATAATTCATCTCCCAAAGCCTGG - Intronic
1018628129 6:165800168-165800190 CTCATGCAATTCCCCAAGCAAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020429872 7:8107853-8107875 CAAATTCATAACCCCAAGCTTGG - Intergenic
1022418584 7:30199072-30199094 GTCATTGTTCTCCCCAACCTGGG + Intergenic
1024702309 7:51917728-51917750 CACATTTTTCTCCCCAAACTTGG + Intergenic
1025636702 7:63326712-63326734 CTCAAACTTTTCCCCAAGCTTGG - Intergenic
1025645994 7:63421390-63421412 CTCAAACTTTTCCCCAAGCTTGG + Intergenic
1029696556 7:102217510-102217532 CTCTTTCATCTCCCCGACATGGG - Intronic
1030305497 7:108014524-108014546 ATTATTCATCTCCCCAAAGTGGG + Intergenic
1032455837 7:132072772-132072794 CTCATTTATTTCCCAGAGCTGGG + Intergenic
1032857166 7:135844623-135844645 TAAATTCGTCTCCCCAAGCTGGG + Intergenic
1035378404 7:158422825-158422847 CTCAATAATCTTCCCGAGCTCGG + Intronic
1035675415 8:1452411-1452433 CTCATTCTCCTTCCCCAGCTGGG - Intergenic
1035975071 8:4301118-4301140 CTCATTCCTCTCCTCAAACACGG - Intronic
1037102504 8:15064732-15064754 CTCACTGATCCCCCCAAACTAGG - Intronic
1037107637 8:15128930-15128952 CTCACCCACCTCCCCAAACTTGG + Intronic
1037341005 8:17844945-17844967 CTCATTCATCCATCCGAGCTGGG + Intergenic
1039932161 8:42003083-42003105 CCCATTCATCTCCACCAGCCGGG + Intronic
1040828535 8:51650689-51650711 CTAATTTATCTCCACAAACTTGG - Intronic
1040886451 8:52268684-52268706 CTCTTTTATGTCCCCTAGCTTGG - Intronic
1042117626 8:65449434-65449456 CTCATTAATCCCCCCAAGTGGGG - Intergenic
1044015289 8:87043240-87043262 TTCATTTTTCTCCCCAATCTAGG + Intronic
1049400337 8:142423886-142423908 CTCATTTATCTGCACATGCTTGG + Intergenic
1051196101 9:14564398-14564420 CTCTTTCATCTCCCTGAGCCTGG + Intergenic
1051437928 9:17052867-17052889 CTCATTCTTCCCCAGAAGCTTGG + Intergenic
1052408131 9:28088490-28088512 CTCATCCCTCTCCCCTACCTTGG + Intronic
1059735041 9:117092214-117092236 GTCTTTCTTCTCCCAAAGCTGGG + Intronic
1060879081 9:127105088-127105110 CCCATTCATCTTCCACAGCTAGG + Intronic
1190457660 X:50641640-50641662 CTCATTCTTGTCGCCAAGCCTGG + Intronic
1193555883 X:82952915-82952937 ATCAATCATCTCCCCAAACAAGG - Intergenic
1195960717 X:110383352-110383374 CCCTTTCCTCTCTCCAAGCTTGG - Intronic
1198668560 X:139052541-139052563 CTCATTCATCTCATCAAACAAGG - Intronic
1202047836 Y:20752276-20752298 CTCATTCTGCTGCCCAGGCTAGG - Intergenic