ID: 1098446574

View in Genome Browser
Species Human (GRCh38)
Location 12:70572020-70572042
Sequence GTGACTATTTAAGGGTATCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098446574_1098446580 20 Left 1098446574 12:70572020-70572042 CCAGGATACCCTTAAATAGTCAC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1098446580 12:70572063-70572085 CTGACTCCCTGGACTTTGTCAGG 0: 1
1: 0
2: 1
3: 19
4: 173
1098446574_1098446579 9 Left 1098446574 12:70572020-70572042 CCAGGATACCCTTAAATAGTCAC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1098446579 12:70572052-70572074 AGTTGCTAACACTGACTCCCTGG 0: 1
1: 1
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098446574 Original CRISPR GTGACTATTTAAGGGTATCC TGG (reversed) Exonic
904749639 1:32733535-32733557 CTGAGTGTTTAAGGGTATCTAGG + Intergenic
905675848 1:39824567-39824589 GAGATTATTTTAGGTTATCCAGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
915541499 1:156569902-156569924 CTGCCTATTAAAGGGTATCCTGG - Intronic
915747625 1:158176928-158176950 GTGTCTATTTCACTGTATCCAGG + Intergenic
1064512032 10:16105459-16105481 ATGACTCTCTAAGTGTATCCCGG - Intergenic
1068895149 10:62190704-62190726 GTGGCTAGTTAATGGTAGCCAGG + Intronic
1070071460 10:73094319-73094341 GTTACTCTCTAAGGGTATCTAGG - Intronic
1072431358 10:95374217-95374239 GAGACTATTTAAATGTATGCTGG + Intronic
1076800033 10:132817283-132817305 GTAAATATTTAAGAGTAACCCGG - Intronic
1082227255 11:49723023-49723045 GTAATTATTTATGGGTACCCAGG - Intergenic
1085191218 11:74624976-74624998 GTGAGATATTAAGGGTATCCAGG + Intronic
1086622166 11:88900075-88900097 GTAATTATTTATGGGTACCCAGG + Intronic
1091608367 12:1978929-1978951 GTAACTATTAATGGGTATCCAGG + Intronic
1093505298 12:19858248-19858270 GTGACTTTTTAAGGCTCTTCAGG - Intergenic
1096567682 12:52494993-52495015 GTGACTATTTTAGGCTTTGCAGG - Intergenic
1098446574 12:70572020-70572042 GTGACTATTTAAGGGTATCCTGG - Exonic
1102757890 12:115358060-115358082 GTCATTATTTAAAGGTCTCCTGG + Intergenic
1102931756 12:116867685-116867707 GTGACCATATAAGGAAATCCTGG + Intronic
1108432208 13:50365734-50365756 GTGACTGTTTAAGTATACCCAGG + Intronic
1114792798 14:25678891-25678913 GTGAATATTTTAGGCTTTCCAGG + Intergenic
1115531953 14:34335826-34335848 GTTACCAGTTAAGGGTGTCCAGG + Intronic
1118010801 14:61608485-61608507 GTGCATATTTGTGGGTATCCAGG + Intronic
1121659131 14:95621597-95621619 GTGACTATTTTAGGCTTTGCAGG + Intergenic
1132308447 15:100836427-100836449 CTGACCAGTTAAGGGGATCCAGG + Intergenic
1137052019 16:35722468-35722490 GTGACTATTTAAAGGAGTTCAGG - Intergenic
1138193846 16:55037798-55037820 GTGAATATATAAAAGTATCCGGG - Intergenic
1148351334 17:46943948-46943970 GTGACTAATGCAGGGTATCTAGG + Intronic
1151504815 17:74520853-74520875 GTGGCTATTTAAGGGCATGACGG + Intergenic
1156774322 18:40769091-40769113 GTAACTATTTTAGGGGACCCTGG - Intergenic
1157577992 18:48756378-48756400 GTGAAAAATTGAGGGTATCCTGG - Intronic
1158882475 18:61794212-61794234 GTGTCTATATCAGGGTAACCGGG - Intergenic
1162206095 19:9057246-9057268 GGGACTATTTAAGTGTTTGCTGG + Intergenic
1163822262 19:19502681-19502703 GTCACTTCTTCAGGGTATCCTGG - Intronic
928253942 2:29705839-29705861 GTTACTCTTTAAGTGTCTCCAGG + Intronic
928527607 2:32158382-32158404 GTGATTATTTAAAGGAACCCAGG + Intergenic
929842957 2:45489810-45489832 GAAACTATTTAAGGGTTACCTGG - Intronic
935591395 2:104848825-104848847 GTGACTAGTAAAGGGAAGCCCGG - Intergenic
940871597 2:158865212-158865234 GAGAATATTAAAGGGTATACAGG + Intergenic
943403369 2:187446754-187446776 GTGATTCTTTAAGAGTATCATGG - Intronic
943536831 2:189162644-189162666 GTGAGTATTTGTGGGTATACTGG + Intronic
945025901 2:205619735-205619757 GTGACTATTTAAGGACATGAGGG - Intronic
1170628202 20:18045571-18045593 GTGACAATTTAAGGGAGTACAGG + Intronic
1177738224 21:25119669-25119691 GTGACTAATCATGGGTCTCCTGG + Intergenic
1178892621 21:36532835-36532857 GTGACTATTTAAAGGGATGGGGG - Intronic
1181720304 22:24769161-24769183 GTGATGATTTAAAGGTATACAGG - Intronic
957539824 3:81552960-81552982 GTGACTTTCTAAGGTTATACAGG + Intronic
959111974 3:102133245-102133267 GTTGGTATTTGAGGGTATCCAGG - Intronic
961699445 3:128730929-128730951 GAGCCTATTTAAGGGGAGCCTGG + Intronic
963794403 3:149617196-149617218 GTCACAATTTGAGGGTCTCCTGG + Intronic
966645972 3:182246646-182246668 GTGAGTATTTAAGTGTCACCGGG + Intergenic
967759348 3:193206020-193206042 GTGATGTTTTAAGGGTAACCAGG + Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
975900299 4:79143500-79143522 GTGACTATTTTAGTGGATCTGGG - Intergenic
977628622 4:99216910-99216932 GTGACCAAGTAAGGGTATTCAGG + Intronic
978023416 4:103842132-103842154 TTGACTATTTATGGGTAAGCAGG - Intergenic
979148433 4:117276456-117276478 GTAACTATTTAGGAGTATCTAGG - Intergenic
980113240 4:128654536-128654558 GTGACTGGTGAAGGGTATCCAGG + Intergenic
980820432 4:138009400-138009422 GTGAGTCTTTAAAGTTATCCAGG + Intergenic
986577030 5:9222901-9222923 GTGACACTTTAAGAATATCCTGG - Intronic
986714166 5:10510763-10510785 GTGACTATCTCTGGGTATCTTGG + Intronic
992917976 5:81479248-81479270 GTGACTAGTTAAATGAATCCGGG - Intronic
992972324 5:82074554-82074576 GTGATTATTTAGTGGTAACCTGG + Intronic
998525652 5:142841054-142841076 CTCACCATTTAAGGATATCCAGG + Intronic
1006469508 6:34219573-34219595 GTGGCTATGTAAGAGTGTCCAGG - Intergenic
1007597344 6:43059686-43059708 GTGAGTCTTTGAGGGTATCCTGG + Exonic
1010284172 6:74055735-74055757 GTGAATATTTAAGGCTTTGCAGG - Intergenic
1012294488 6:97504036-97504058 GCAACTATTTCAGGGTATTCAGG + Intergenic
1012447408 6:99320970-99320992 GTGAATATTTCAGGCTCTCCAGG + Intronic
1013390982 6:109686228-109686250 GTGTCTTTATAAGGGGATCCGGG - Intronic
1014737929 6:125116746-125116768 GTAATTATTTAAGTGTTTCCAGG + Intergenic
1016110198 6:140213496-140213518 ATGACTATTTAACGGTTGCCAGG - Intergenic
1016782970 6:147980110-147980132 GTAAATATTTTAGGTTATCCAGG + Intergenic
1017259894 6:152373646-152373668 TTGACTATTAAAGGATAACCTGG - Intronic
1025920589 7:65908487-65908509 GTAACTACTTAAGGCTAGCCTGG + Intronic
1026430174 7:70338352-70338374 TTAACTATTAAAGGGTATCATGG + Intronic
1034409680 7:150933600-150933622 TTGAGTCTTTAAGGGCATCCTGG - Intergenic
1046857954 8:119056209-119056231 TTGACTTTTTAAGGGTACCCTGG - Intronic
1047802077 8:128320303-128320325 GTAAATATTTAAGGATAGCCAGG - Intergenic
1048658997 8:136575100-136575122 GTGACTCTTTCACTGTATCCTGG - Intergenic
1048794321 8:138135021-138135043 GTAAATATTTAAGGCTTTCCAGG + Intronic
1051157764 9:14169876-14169898 GTGACTATGAAAGCGTATCTAGG - Intronic
1057962335 9:99468896-99468918 GAGATTATTCAAGGTTATCCAGG + Intergenic
1061282755 9:129606966-129606988 GTGAGTCTTTAAGGGTGCCCGGG + Intergenic
1187033958 X:15518221-15518243 GTGACTATTTATGGGCTTACTGG - Intronic
1188211647 X:27432721-27432743 GTGAATATTAATGGTTATCCTGG - Intergenic
1197688057 X:129464942-129464964 ATGACTTTTTAAAGGTGTCCAGG - Intronic