ID: 1098446789

View in Genome Browser
Species Human (GRCh38)
Location 12:70574272-70574294
Sequence AGGATGCTAATGCAACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098446789_1098446792 9 Left 1098446789 12:70574272-70574294 CCTGCAAGTTGCATTAGCATCCT 0: 1
1: 0
2: 1
3: 2
4: 110
Right 1098446792 12:70574304-70574326 TGTGTTTACTGATTAGTGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098446789 Original CRISPR AGGATGCTAATGCAACTTGC AGG (reversed) Intronic
906499873 1:46333819-46333841 AGCAGGCTAATGCAAATTGAGGG - Intergenic
911165303 1:94719497-94719519 TGGATGCTATTGCCCCTTGCAGG + Intergenic
914357416 1:146898848-146898870 TGGAGGCTGACGCAACTTGCCGG - Intergenic
916498607 1:165367531-165367553 AGGAGGGTAATGGGACTTGCAGG - Intergenic
920816930 1:209343421-209343443 TGTATGCTATTGGAACTTGCTGG - Intergenic
1064772909 10:18742654-18742676 AGGATGCTAAAGCAATTTCATGG + Intergenic
1068067777 10:52153574-52153596 ATGATGGAAATGCCACTTGCAGG + Intronic
1068542756 10:58313598-58313620 AGGATGATTATGCATCTGGCAGG - Intergenic
1073873373 10:107891926-107891948 AGGAAGCTAATGCAAAATGTAGG - Intergenic
1076414471 10:130275706-130275728 AGGATGAAAATGGATCTTGCGGG + Intergenic
1077892669 11:6430765-6430787 AGGACTCTGATTCAACTTGCTGG - Intergenic
1079399287 11:20092879-20092901 AGGCTGACAATGCACCTTGCCGG - Intronic
1085615395 11:77994280-77994302 AGGATGCTAATGTAACGCGATGG + Intronic
1086382065 11:86265044-86265066 AGAATGCTACTGCAACTTTTAGG - Intronic
1086547887 11:88019448-88019470 AGAAGGCTATTGCAAGTTGCAGG - Intergenic
1086876200 11:92098374-92098396 AGGGTGATAAGGCAACTTGAAGG + Intergenic
1087728279 11:101748884-101748906 AAGATGCAAATGCAACCTCCTGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1093410353 12:18858004-18858026 AGGATGCTACTGCAACAGTCAGG - Intergenic
1098446789 12:70574272-70574294 AGGATGCTAATGCAACTTGCAGG - Intronic
1099210755 12:79785035-79785057 AAGATACTAATGCAACCTGAAGG + Intronic
1099468606 12:83018641-83018663 AGAATGCTAATAAAATTTGCGGG + Intronic
1099477791 12:83128715-83128737 GGGATGCTGATGCAACTCCCTGG + Intronic
1100085126 12:90901323-90901345 CAGCTTCTAATGCAACTTGCTGG + Intergenic
1103996237 12:124831975-124831997 AGGATCCTAAGGCAACGTGAGGG + Intronic
1112784153 13:102933482-102933504 AGGATGCTGATGCATCCTCCAGG - Intergenic
1113650610 13:112031775-112031797 AGGAAACCAATGCAAGTTGCAGG - Intergenic
1118415482 14:65531106-65531128 AGAATGCTAATGTAAATTGGTGG + Intronic
1119184874 14:72632974-72632996 AGGAGGCTAATGCAGCTACCAGG + Intronic
1121806304 14:96827450-96827472 AGGGTGCTAATGAAGCTTACAGG - Intronic
1132223556 15:100123505-100123527 AGGATGAGATTGCAACTTGTTGG - Intronic
1139976772 16:70818446-70818468 TGGAGGCTGACGCAACTTGCCGG + Exonic
1142307730 16:89294959-89294981 AGAATGCTACAGGAACTTGCTGG - Intronic
1146635742 17:34503070-34503092 AGGATTCTAATGCACCATTCTGG + Intergenic
1150661734 17:67086725-67086747 AAGATGATAATGCAAATTGGGGG + Intronic
1157866109 18:51186166-51186188 AAGATGCTAGTGCTACTTCCAGG + Intronic
1168287730 19:55342769-55342791 AGGATGGTAAAGCCACTTTCCGG - Exonic
929071463 2:38035757-38035779 AAGATGCTCCTGCATCTTGCTGG - Intronic
931202534 2:60112722-60112744 AGGATGCTATTGCTACTGCCGGG - Intergenic
935700741 2:105809750-105809772 AAGATGCTAAGGGAACTTGGAGG + Intronic
936032232 2:109081639-109081661 AGGATGCTCTTGCCCCTTGCAGG - Intergenic
939005511 2:136782037-136782059 AGGAAGCTAATACAAAATGCTGG + Intronic
942766332 2:179461568-179461590 AGGATGCTAATAAAACTTCCTGG + Intronic
947990107 2:234480235-234480257 AGGATGCTGATTCCAATTGCAGG - Intergenic
1169885851 20:10396723-10396745 AGGGTGGTATTTCAACTTGCTGG + Intergenic
1171226303 20:23444478-23444500 ACGATGCTATTGCTCCTTGCTGG + Intronic
1171492199 20:25528472-25528494 AGGAAGCTTCTGCAACTTTCTGG + Intronic
1173004670 20:39130731-39130753 AGGAGGCTATGGCCACTTGCGGG - Intergenic
949974511 3:9443708-9443730 AGGATGCTATTGTAATTTCCAGG - Intronic
953179196 3:40580835-40580857 AGGATGACAATCCCACTTGCAGG + Intergenic
954215950 3:49124592-49124614 AGGCTGCACATGCAACCTGCTGG - Exonic
956746659 3:72316185-72316207 AGGATTCTGATGCAATTGGCTGG - Intergenic
959309605 3:104717272-104717294 AGGAAGCTACTGCAGCATGCAGG - Intergenic
960005324 3:112775596-112775618 AAGATGATGATGCAACTTGATGG + Intronic
960363240 3:116739756-116739778 ATGATGCTAATGTAACCTGATGG - Intronic
961319299 3:126061809-126061831 GGGATGCAACTGCAAATTGCTGG + Intronic
961861992 3:129924652-129924674 ATGATGCTAATGCTGCTGGCTGG - Intergenic
962680339 3:137792799-137792821 AGGATGTTAATGCAACCATCAGG - Intergenic
965142755 3:164861111-164861133 AGGATGCTAAAGCAGCTCTCTGG - Intergenic
966683756 3:182671276-182671298 AGGATGTTAGTGCAGCTTGGGGG - Intergenic
969294806 4:6263544-6263566 AGGATGCAAAAGCAACTTTGAGG - Intergenic
971580202 4:28328231-28328253 ATGATGCAAATGCAATTAGCAGG + Intergenic
972767146 4:42161706-42161728 AGGATGGAAATGGATCTTGCTGG - Intergenic
975925968 4:79453957-79453979 AAGATGCTTTTGCACCTTGCAGG - Intergenic
976844699 4:89474350-89474372 AGGCTGCTCTTGCAACTTCCTGG + Intergenic
977587316 4:98788007-98788029 AGGGTCATAATGCAACTTACTGG + Intergenic
977946191 4:102917161-102917183 AGGCTGCTGATGCAAGTTCCAGG - Intronic
983133422 4:164050583-164050605 GGGATGCTAATGCTGCCTGCTGG - Intronic
984440782 4:179767097-179767119 TGGATGCTGATGCAACTTGCTGG - Intergenic
985983633 5:3492475-3492497 ATGATGACAATGCCACTTGCTGG - Intergenic
986144977 5:5069484-5069506 AGGATTCAAAAGCAAATTGCAGG + Intergenic
988992124 5:36681637-36681659 AGGATGCAGAAGAAACTTGCAGG - Intronic
989255617 5:39363134-39363156 AGGGAGCTAAAGCAACTTGGAGG + Intronic
991732004 5:69598670-69598692 GTGATGCTAATGCTACTTACTGG - Intergenic
991808438 5:70453814-70453836 GTGATGCTAATGCTACTTACTGG - Intergenic
991862947 5:71029187-71029209 GTGATGCTAATGCTACTTACTGG + Intergenic
993294672 5:86121056-86121078 AAGAGGCTAATACAACATGCAGG - Intergenic
994929064 5:106156427-106156449 AGGGAGCAAATGCAACTTCCTGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1004820125 6:19358849-19358871 AGAATGCTAGTGCAACTGACAGG - Intergenic
1005148169 6:22716476-22716498 GGGATGATAGTGCAACTTGTGGG + Intergenic
1012140919 6:95625591-95625613 AGTATGCTAATGCCACTTCTTGG - Intergenic
1018735041 6:166681562-166681584 AGAATCCTGGTGCAACTTGCAGG - Intronic
1022924234 7:35043985-35044007 GGAATGGTAATGCCACTTGCTGG - Intergenic
1024607207 7:51031749-51031771 AGCCTGATAATGCCACTTGCAGG + Intronic
1027719820 7:81726030-81726052 AGCATGTTAATGTAAATTGCCGG + Intronic
1029907876 7:104110177-104110199 AGGATGCTAAGGCCAATTACCGG + Intergenic
1030585520 7:111413984-111414006 GGGATGCTAGTGGAACTGGCTGG - Intronic
1031714848 7:125096332-125096354 AGGATGCTAATCCATCATGAGGG + Intergenic
1032535668 7:132661491-132661513 ATGATGGCAATGCACCTTGCAGG + Exonic
1033983355 7:147193340-147193362 AGGCTGCTAATGAAACCTTCTGG + Intronic
1034070567 7:148180772-148180794 TGGATGCTAATGCACCATGCTGG - Intronic
1037860380 8:22400831-22400853 AGGCTGCTAATGAAACTGTCAGG - Intronic
1040881413 8:52208999-52209021 AGAAAGCTAATGATACTTGCTGG - Intronic
1045332768 8:101170003-101170025 AGGATGAAAAAGCAACTTGGAGG + Intergenic
1045859204 8:106796638-106796660 ACAATGCTAATGCTACTGGCTGG - Intergenic
1048128750 8:131668135-131668157 AGGATGGTAATGGAAGTGGCAGG - Intergenic
1052441510 9:28502075-28502097 AGGTTGATAATGCACATTGCAGG + Intronic
1053563836 9:39226077-39226099 AGAATGCTTATGGAACTTACAGG - Intronic
1053829623 9:42063978-42064000 AGAATGCTTATGGAACTTACAGG - Intronic
1054133312 9:61392993-61393015 AGAATGCTTATGGAACTTACAGG + Intergenic
1054600936 9:67123476-67123498 AGAATGCTTATGGAACTTACAGG + Intergenic
1056569673 9:87804243-87804265 ATTATGCAAATGCAGCTTGCAGG + Intergenic
1061649488 9:132035586-132035608 AGGATGCAAATGCATCTTAGAGG + Intronic
1186669701 X:11757148-11757170 GGGAAGCAAATGCAACTTTCTGG + Intergenic
1186969021 X:14819848-14819870 AGGATGCTACTGCAACAATCCGG - Intergenic
1187583955 X:20639373-20639395 AGGTTACTAACGGAACTTGCTGG + Intergenic
1188024317 X:25193034-25193056 AGGATGCTAATGGAAACTGTGGG + Intergenic
1189905195 X:45751864-45751886 AGGATGCTAAGGGACCTTCCTGG + Intergenic
1192374508 X:70545514-70545536 AGGATGATAATGCCATTTTCTGG + Intronic
1194943211 X:100037705-100037727 AGAATTCTAATGCAACTAGTTGG - Intergenic
1194949538 X:100108769-100108791 AGGATACTAATAAAATTTGCAGG + Intergenic
1195158577 X:102148593-102148615 AGAATGAAAATGCAACTTACAGG + Intergenic
1198317611 X:135484817-135484839 AGGAGACTACTGCCACTTGCTGG - Intergenic