ID: 1098450506

View in Genome Browser
Species Human (GRCh38)
Location 12:70613215-70613237
Sequence ACCATGACCTTTTAGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098450506_1098450511 3 Left 1098450506 12:70613215-70613237 CCCATGACCTAAAAGGTCATGGT 0: 1
1: 1
2: 0
3: 6
4: 172
Right 1098450511 12:70613241-70613263 TACCCCGGCCCCTCATTACCTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098450506 Original CRISPR ACCATGACCTTTTAGGTCAT GGG (reversed) Intronic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
902643475 1:17781544-17781566 ACCAGGAACTTCTAAGTCATTGG + Intronic
904057681 1:27682764-27682786 AACATAACCTGTTAGGTCAGGGG - Intergenic
906654192 1:47535807-47535829 ACCATGAGCTCTGAGGTCAGAGG + Intergenic
907911861 1:58834086-58834108 ACCAGGAGCTGTTAGGTCTTTGG + Intergenic
908098079 1:60761501-60761523 AACATGACCTTTTAGCTAATAGG + Intergenic
909106654 1:71418533-71418555 ACCATAGCCTTTTAGCTCCTTGG + Intronic
909548836 1:76876351-76876373 ACCATGGCCATTTTGTTCATGGG + Intronic
911610176 1:99951658-99951680 AGCATGGCCTTACAGGTCATAGG - Intergenic
912067135 1:105757799-105757821 ACCATGACCACTTTGCTCATAGG - Intergenic
912605083 1:110981784-110981806 ACCAGTACCTTTCAGATCATAGG - Intergenic
912761076 1:112368078-112368100 ATCATGACCTTCCAGGCCATTGG - Intergenic
912934600 1:113992260-113992282 AACATGTTTTTTTAGGTCATGGG - Intergenic
917764652 1:178202858-178202880 ACCATGACCACTTTGTTCATGGG - Intronic
918974891 1:191471141-191471163 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
920324288 1:205149973-205149995 TCCATTACCTTTTAGCTCAATGG + Intronic
922327498 1:224542372-224542394 ATCATTCCATTTTAGGTCATAGG - Intronic
922913554 1:229237358-229237380 ACTGTGAGCTTTTAGGTAATAGG - Intergenic
1066519177 10:36196618-36196640 AACATAACCTGTTAGGTCAGAGG - Intergenic
1068561192 10:58515753-58515775 ACTAGGACCTTTTAGGTTTTGGG + Intronic
1070017092 10:72544042-72544064 AACATAACCGTTTAGGTCAGGGG - Intronic
1070365841 10:75736255-75736277 CCCATTACCTCTTAGGTCAGTGG + Intronic
1070567720 10:77616302-77616324 ACAATAACCTCCTAGGTCATTGG - Intronic
1072009423 10:91290627-91290649 AACCTGAGTTTTTAGGTCATGGG + Intergenic
1072335269 10:94392285-94392307 AACATAACCGTTTAGGTCAGGGG - Intergenic
1073532782 10:104247486-104247508 ACCATGAACTTTAAGGTCGAGGG - Intronic
1078038796 11:7837649-7837671 ACGATGAAGCTTTAGGTCATAGG + Intergenic
1079441039 11:20515237-20515259 TCCCTGACCTTTTGGTTCATTGG + Intergenic
1081757997 11:45558235-45558257 AACATAACCTTCTAGGTCACTGG - Intergenic
1085081784 11:73640979-73641001 ATCATGAGCTTTTAGTTCAAGGG - Intergenic
1086804040 11:91217268-91217290 TCCATGGCCTTTTAGGACCTGGG - Intergenic
1087034425 11:93741714-93741736 ACCGTGACCGTTTAGGTGAGTGG + Exonic
1088191537 11:107233673-107233695 ACCATGGCCTCTTTGTTCATGGG + Intergenic
1090826950 11:130394286-130394308 AGCATGTGCTTTTAGGTCAGAGG - Intergenic
1097953346 12:65457375-65457397 ACCAGGACCTGTCAGGTGATTGG - Intronic
1098450506 12:70613215-70613237 ACCATGACCTTTTAGGTCATGGG - Intronic
1099401093 12:82204544-82204566 ACCATGACCACTTTGTTCATGGG + Intergenic
1099490562 12:83283429-83283451 ACCATGGCCATTTTGTTCATGGG + Intergenic
1099551152 12:84044588-84044610 ACCATCACCTTGTATGCCATTGG - Intergenic
1099710488 12:86218100-86218122 TTCTTTACCTTTTAGGTCATTGG + Intronic
1101534494 12:105604932-105604954 ACCATGACCACTTTGTTCATGGG + Intergenic
1105613230 13:21987376-21987398 GCCATCACCTTTTAAGTAATGGG + Intergenic
1107024338 13:35784521-35784543 AGCATGAGCTATTAGGCCATAGG - Intronic
1108484720 13:50912067-50912089 ACTGTGACCTTTTAAGGCATTGG + Intronic
1108904391 13:55450781-55450803 ACCATGACCTCTTTGTTCTTGGG - Intergenic
1109261879 13:60154748-60154770 AGCATAACCTTTTACTTCATGGG - Intronic
1110790364 13:79581123-79581145 AACATGTTCTTTTAGCTCATTGG + Intergenic
1111269005 13:85855062-85855084 ATCATGACTTTTTAGTTAATTGG + Intergenic
1111773231 13:92625618-92625640 ACGAAGACCTTTTAGGACTTGGG + Intronic
1113180136 13:107615508-107615530 ACCATCATCTTATAGGCCATAGG - Intronic
1116017057 14:39420147-39420169 ACCATAACTTTTCATGTCATTGG - Intronic
1117090274 14:52243466-52243488 ACCATCACATTTTGGGTCAGGGG + Intergenic
1117183184 14:53213396-53213418 ATCTTTCCCTTTTAGGTCATTGG + Intergenic
1123587397 15:21772493-21772515 ACCCTGACCTTTTAGGGCTGTGG + Intergenic
1123624035 15:22215058-22215080 ACCCTGACCTTTTAGGGCTGTGG + Intergenic
1125981164 15:44002709-44002731 AACATAACCTATTAGGTCAGGGG + Intronic
1126189887 15:45868281-45868303 ACCAGGACCTTATACATCATAGG - Intergenic
1131456920 15:92588818-92588840 GCCATTATATTTTAGGTCATTGG - Intergenic
1134904757 16:17970858-17970880 TCCATGACCCTTTGTGTCATGGG + Intergenic
1140793945 16:78417877-78417899 ACCATGACTTTTCAGGTTTTAGG + Intronic
1143441352 17:6976758-6976780 ACCCTGACCTTTTATGTTATAGG - Intronic
1143870112 17:9952023-9952045 TCCATGGCCTTTTAGGTGGTTGG - Intronic
1145746095 17:27320958-27320980 AACATAACCTATTAGGTCAGGGG + Intergenic
1145953262 17:28836718-28836740 AACATAACCTATTAGGTCAGGGG + Intronic
1146753457 17:35404092-35404114 AACATAACCGATTAGGTCATGGG + Intergenic
1148255081 17:46123773-46123795 ACCTTGCACTTTTAGGTTATTGG - Intronic
1151219914 17:72604741-72604763 GCCATGTCCTCTGAGGTCATCGG - Intergenic
1153980443 18:10304367-10304389 ACAAGGTCCTTTAAGGTCATAGG + Intergenic
1154071355 18:11155005-11155027 CCCATGCTCTTTTAGGTCCTGGG - Intergenic
1155433480 18:25786726-25786748 AGCATGACCTATTTGGTGATGGG + Intergenic
1155925197 18:31648444-31648466 ACCTTGACCTTCTAGGTACTTGG - Intronic
1156830843 18:41489126-41489148 ACCATCACCTTTGAGATCAGTGG + Intergenic
1164096981 19:22020532-22020554 ACCATGACCACTTTGTTCATGGG + Intergenic
1165814948 19:38636186-38636208 TTCCTGACCTTTTAGGTCACAGG + Intronic
1165815123 19:38637138-38637160 TTCCTGACCTTTTAGGTCTTGGG + Intergenic
1165951125 19:39474388-39474410 ACCATTACCTGATAGGCCATGGG - Exonic
1166497420 19:43314155-43314177 AACATAACCTGTTAGGTCAGGGG - Intergenic
1168539218 19:57196586-57196608 ACTATGACCATTTTGTTCATGGG + Intronic
926045538 2:9707025-9707047 ACCATGACCTTTAATGTCTCTGG - Intergenic
932870587 2:75394264-75394286 ACCATGGCCACTTTGGTCATGGG + Intergenic
933519980 2:83359460-83359482 ACCATCACATTTGAGTTCATTGG + Intergenic
933823085 2:86132528-86132550 AACATGTCCTATTAGATCATTGG - Intronic
939436059 2:142179751-142179773 ATGATGTCCTCTTAGGTCATAGG + Intergenic
940621101 2:156114975-156114997 AGCATCAACTTTTTGGTCATGGG - Intergenic
941860762 2:170277310-170277332 ACCATGACGTTTTAGTTTCTTGG - Intronic
948357380 2:237390072-237390094 TCCGTGTCCTTTGAGGTCATTGG - Intronic
1168793060 20:592903-592925 TCCATGAACTTTTTGGGCATGGG + Intergenic
1170573236 20:17644278-17644300 CCCATGACCTCTTAGGCCTTTGG - Intronic
1173090551 20:39966780-39966802 ACTAAGGCCTATTAGGTCATGGG + Intergenic
1177597536 21:23265436-23265458 TCCATGACCTGTTAGGAAATGGG + Intergenic
1177946811 21:27480596-27480618 ACCATAACCATATAGGTGATAGG + Intergenic
1179289459 21:40006020-40006042 ACCATGGCCTTTGATGTCAGGGG + Intergenic
1182378146 22:29863770-29863792 AGCATGGCCTTTTGGTTCATAGG - Intergenic
949640300 3:6029244-6029266 AACATGCCCTTTTAGCTCAGAGG + Intergenic
949712547 3:6888310-6888332 AGCATTACCATTCAGGTCATAGG - Intronic
951003679 3:17593306-17593328 ACCATGACCACTTTGTTCATGGG - Intronic
952743099 3:36752933-36752955 ACCATGAACTATTTGTTCATTGG - Intergenic
953524606 3:43678447-43678469 AACATAACCTGTTAGGTCAGGGG - Intronic
954958806 3:54546547-54546569 ATCATGACCTTTTGAGTCTTGGG - Intronic
955277054 3:57556618-57556640 AGCGTGACCCTTTAGGGCATTGG - Exonic
956509779 3:69981185-69981207 ACCATGGCCTCTTTGTTCATGGG - Intergenic
957247455 3:77733080-77733102 ACCATGGCCTCTTTGTTCATTGG + Intergenic
958181073 3:90061650-90061672 ACTATCTCCTTTTTGGTCATGGG - Intergenic
959324337 3:104917733-104917755 ACCATGCCCTTACATGTCATGGG + Intergenic
961581840 3:127889663-127889685 TTCATTACCTTGTAGGTCATTGG - Intergenic
963630424 3:147724040-147724062 ACCATGACCATTTTGTTCATGGG - Intergenic
964924480 3:161938797-161938819 AACATAACCTATTAGGTCAGGGG - Intergenic
965224232 3:165967355-165967377 ACCTTGCACTTTTATGTCATGGG - Intergenic
968294821 3:197567931-197567953 ACCATGATCTCTCAGGTCAGGGG - Intronic
970517204 4:16844699-16844721 TCCATGACTTTTTAAGACATTGG + Intronic
974093544 4:57337398-57337420 TCCATGAGATTTTAGCTCATTGG - Intergenic
974124080 4:57674359-57674381 ATCAGGACTTTTCAGGTCATAGG + Intergenic
974760382 4:66266541-66266563 AACATAACCTGTTAGGTCAGGGG - Intergenic
977360805 4:96001608-96001630 ACAATGGACTTTGAGGTCATAGG + Intergenic
978319123 4:107474718-107474740 TCCCTGACCTTTTAGTGCATGGG + Intergenic
984060173 4:174981208-174981230 ACCATGGCCGTTTTGTTCATGGG + Intergenic
1202768686 4_GL000008v2_random:176313-176335 CCCATGGCCTTTGAGGTCCTAGG + Intergenic
986766270 5:10931124-10931146 ACCATGGCCATTTTGTTCATGGG - Intergenic
990839668 5:60062901-60062923 ACCAGGGCCTGTTGGGTCATGGG + Intronic
992359339 5:76020457-76020479 AACCTGACTTTTTAGTTCATAGG + Intergenic
992514714 5:77479735-77479757 ACCATTACCATTCAGGACATAGG + Intronic
992620322 5:78585934-78585956 TCCATGACCTTTTAGGCCACTGG - Intronic
993367358 5:87050144-87050166 ACCATGACCACATAGTTCATGGG + Intergenic
994159886 5:96545711-96545733 ACCATGACCGCTTATTTCATAGG + Intronic
994252050 5:97547303-97547325 AGGATGAGCTGTTAGGTCATAGG - Intergenic
995109846 5:108417101-108417123 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
998970050 5:147581095-147581117 AGCATGACCATTTATGTCCTGGG - Intergenic
999826280 5:155276580-155276602 AATATGACATTTTAGGTCCTTGG - Intergenic
1004462495 6:15851124-15851146 CCCATCACCTTCAAGGTCATCGG + Intergenic
1004824176 6:19402413-19402435 ACCATGGCCATTTTGTTCATGGG + Intergenic
1005461680 6:26075179-26075201 AACATAACCTGTTAGGTCAAAGG - Intergenic
1006556242 6:34869331-34869353 ACCATTACCTTTTAAGTCTCTGG + Intronic
1008791048 6:55234031-55234053 AGAATGACCTTTTAGATAATAGG - Intronic
1010987927 6:82447068-82447090 ACCATAACCGATTAGGTCAGGGG + Intergenic
1014065192 6:117116558-117116580 ACCAGGTCCTGTCAGGTCATGGG + Intergenic
1015475861 6:133658302-133658324 ACCATGGCCTTTTGGTTCACGGG - Intergenic
1016026183 6:139289208-139289230 AACATAACCTATTAGGTCAGGGG - Intronic
1016539380 6:145146896-145146918 ACCATTAACTATTAAGTCATAGG + Intergenic
1016550424 6:145273560-145273582 AACATGACCTTATGGATCATGGG - Intergenic
1017962881 6:159237059-159237081 ACTATGACATTTTCAGTCATAGG + Intronic
1018462599 6:164013104-164013126 ACCATAACCGGTTAGGTCAGGGG + Intergenic
1021252931 7:18354288-18354310 ACTATGACCTTGTAGTTTATGGG + Intronic
1021980842 7:26054026-26054048 ACCATGACCTTTGAAGCCTTGGG + Intergenic
1022224601 7:28349986-28350008 ATCAAGGCCTTTTAAGTCATAGG + Intronic
1023268938 7:38438534-38438556 TCCATAAAATTTTAGGTCATGGG + Intronic
1026119223 7:67522162-67522184 AGCAGGAGCTTTCAGGTCATAGG - Intergenic
1027997532 7:85444425-85444447 ACTATGACTTTTTATCTCATAGG - Intergenic
1028910679 7:96204173-96204195 ATAATCACCTTTTAGGTTATTGG + Intronic
1032920672 7:136542828-136542850 ACCATGCCCTTCTTGGTCAGTGG + Intergenic
1037668711 8:20996359-20996381 ACAATGACCTGTAAAGTCATCGG + Intergenic
1040744005 8:50617831-50617853 ACCATAACCGATTAGGTCAGGGG + Intronic
1041962658 8:63636672-63636694 ACAATGACATTTTAAGTGATAGG - Intergenic
1042675215 8:71313015-71313037 ACCAAGTCCTTGTTGGTCATGGG - Intronic
1042795668 8:72660638-72660660 ACCATGAGCTTTTCTTTCATGGG + Intronic
1043206543 8:77450929-77450951 ACCTAGACTTTTTAGTTCATGGG + Intergenic
1043511936 8:80958381-80958403 ATCATGACTGTTTATGTCATTGG + Intergenic
1044381402 8:91538188-91538210 ACCAGGACCTGTTAGGGGATGGG + Intergenic
1047132323 8:122035402-122035424 CCCATGACGTTTTATGTTATAGG - Intergenic
1048435373 8:134411796-134411818 ACCATGACTATTTTGTTCATTGG + Intergenic
1048767835 8:137863322-137863344 ACCATGACATTTTAATCCATGGG - Intergenic
1050116470 9:2268644-2268666 ACCATGATGTTTAAGTTCATAGG - Intergenic
1054968929 9:71061942-71061964 ACTATGGGCTTTTAGGTCATTGG - Intronic
1185757904 X:2666701-2666723 CACATGACCTTTTATGTAATTGG + Intergenic
1186073015 X:5843401-5843423 GGCATGACTTTTTGGGTCATGGG - Intronic
1188887227 X:35565723-35565745 ACAATGACTTTAGAGGTCATTGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189344513 X:40230691-40230713 ATCATGAACTTTCAGGACATTGG - Intergenic
1192183055 X:68928395-68928417 ACCCGGGCCTTGTAGGTCATTGG - Intergenic
1192556730 X:72096018-72096040 ACCCTGAGCTTTCAGGTCACAGG + Intergenic
1193833062 X:86310924-86310946 ACCATGGCCTCTTTGTTCATTGG - Intronic
1193934994 X:87607863-87607885 ACAATGACATTTAAGGCCATGGG - Intronic
1194022170 X:88704319-88704341 ACCAGGACCTGTTAGGGGATGGG + Intergenic
1194798847 X:98246015-98246037 GACATAATCTTTTAGGTCATAGG + Intergenic
1196594020 X:117522197-117522219 AGCATGATCTTTTAGATTATGGG + Intergenic
1198976644 X:142343053-142343075 GGCATGACCTTTCAGGACATAGG + Intergenic
1199545975 X:149007788-149007810 ACCCTGCCCTTGTTGGTCATGGG + Intergenic
1200406664 Y:2818778-2818800 GATATGACATTTTAGGTCATGGG + Intergenic
1200942760 Y:8803141-8803163 AACATAACCTATTAGGTCAGGGG - Intergenic
1202338451 Y:23834765-23834787 ACCATGCCCTCTTAGCACATTGG + Intergenic
1202532315 Y:25835307-25835329 ACCATGCCCTCTTAGCACATTGG - Intergenic