ID: 1098451526

View in Genome Browser
Species Human (GRCh38)
Location 12:70623602-70623624
Sequence TAGTGCACTATGGAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098451526 Original CRISPR TAGTGCACTATGGAGTTGAT GGG (reversed) Intronic
901123310 1:6912220-6912242 TCTTGCACAATGGAGTTCATTGG + Intronic
903467263 1:23560223-23560245 TAGTTCGTTATGGAGTTTATGGG - Intergenic
908640743 1:66220434-66220456 TAATGCAGTATGAAGTTGAGGGG + Intronic
908912061 1:69083303-69083325 TATTGCACCATGGAGAAGATGGG - Intergenic
911360974 1:96875790-96875812 TTCTGCACTATGGAGTCAATAGG + Intergenic
923442636 1:234035984-234036006 CAGGGCACTATAAAGTTGATGGG + Intronic
1073418677 10:103406028-103406050 TAGTGGACATTGGTGTTGATGGG + Exonic
1080195634 11:29605299-29605321 GCTTGCACTATGGAGTGGATCGG + Intergenic
1081225829 11:40521132-40521154 TGGTTCACTATGGAGCTAATGGG + Intronic
1087926916 11:103929433-103929455 GAGGGCACTTTGGAGTTTATTGG - Intronic
1089406511 11:118202109-118202131 CAGTGCACTGAGGAGTTAATGGG + Intronic
1098451526 12:70623602-70623624 TAGTGCACTATGGAGTTGATGGG - Intronic
1100397705 12:94199196-94199218 TATTGCACTATTGAGTGGAATGG + Intronic
1104408842 12:128541510-128541532 TTGTGCACTAAGGAGGTGACTGG - Intronic
1106203613 13:27567108-27567130 GAGTGCATTAGGGAGTTGATAGG + Intronic
1110457438 13:75705270-75705292 TTGTGTACTATGAAGTAGATAGG + Intronic
1114898121 14:27019577-27019599 ATGTGTACTATGGAGCTGATAGG + Intergenic
1115857110 14:37642253-37642275 TAGTGCCCTGTGGTGTTGGTAGG + Intronic
1121523948 14:94605392-94605414 TAGGGCAGGATGGAGTTGAGAGG + Intronic
1121822430 14:96982277-96982299 TAGTGCACTGAAGAGTTGAGTGG + Intergenic
1121911251 14:97794445-97794467 TAGAGGAAAATGGAGTTGATAGG - Intergenic
1129970337 15:79772800-79772822 TAGAGCACTATGTATATGATTGG - Intergenic
1147039414 17:37706485-37706507 TTGGACACTATGGAGTTGACCGG - Intronic
1156619241 18:38829321-38829343 ATGTGCACAATGGAATTGATTGG + Intergenic
1168385272 19:55958014-55958036 CAGTGCAACATGGAGTTGAAGGG - Intronic
929303892 2:40337490-40337512 GAGTGCGCTATGGAGGTGAGTGG - Intronic
929729868 2:44477185-44477207 TAGTTCATTATAGAGTTAATAGG + Intronic
929888857 2:45903146-45903168 CAGTGCCCGAGGGAGTTGATTGG + Intronic
930260420 2:49140053-49140075 TAGGGAACTATGGATTTGTTAGG + Intronic
934915603 2:98298909-98298931 TAGTGCCCTATGTAGATGAAGGG + Intronic
935161637 2:100534548-100534570 CAGTGCTCTATGGAGTGGCTGGG - Intergenic
941215489 2:162702571-162702593 TAGTGCACTGTAGACGTGATAGG + Intronic
943454414 2:188085617-188085639 TATTGCAATGTGGAGATGATTGG - Intergenic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1174959279 20:55136727-55136749 TAGTAAACTATGGATTTGAGTGG + Intergenic
1179105474 21:38396705-38396727 TGGTGCACTGTGTAGTTAATAGG + Intronic
1180993145 22:19950715-19950737 TAGGGAAGTATGGAGGTGATAGG + Intronic
1181320692 22:22003541-22003563 TGGTGCACTCTGGAGTGGAGTGG - Intergenic
949296345 3:2528624-2528646 TAGTGCATTATTGAGATTATAGG + Intronic
951256637 3:20457739-20457761 AGGTGGAATATGGAGTTGATGGG - Intergenic
969179079 4:5423697-5423719 GGGTGCACTAGGGAGATGATGGG + Intronic
972979632 4:44679741-44679763 TTGTGAAATATGCAGTTGATTGG + Intronic
978100133 4:104828818-104828840 TAGAGAACTAGGGAGTTGGTGGG - Intergenic
978294545 4:107188807-107188829 TAGTTCACTAAGCAGTTGTTTGG + Intronic
984450567 4:179895895-179895917 TAGTGCACAGAGGAGTTGATGGG + Intergenic
986610175 5:9559179-9559201 TGGTGCACCATGGAGGTGTTGGG - Intergenic
994947555 5:106415460-106415482 GAGTGAACTAAAGAGTTGATAGG - Intergenic
1003272649 6:4620971-4620993 TCGTGCATCATGTAGTTGATGGG - Intergenic
1003680748 6:8252346-8252368 TAGTGCACTGTTGATATGATTGG - Intergenic
1007660463 6:43482217-43482239 TAGTAAACTATGGAGTTGCAAGG + Intronic
1013858455 6:114604597-114604619 TAGTGCACGTTGTATTTGATAGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1041886553 8:62816201-62816223 ATGTGTCCTATGGAGTTGATTGG + Intronic
1042114563 8:65416366-65416388 AAGTCCACTGTGGAGTTGACAGG + Intergenic
1042684332 8:71421305-71421327 TAGAGAACTATGGAGATGAAAGG + Intronic
1045857343 8:106779815-106779837 TAGTGCAGTGTGGAGTTAATTGG - Intergenic
1046323090 8:112603333-112603355 TACTGCACTATGCAGTTTACTGG + Intronic
1046994024 8:120495447-120495469 TATTGAACTGTGTAGTTGATTGG + Intronic
1048913298 8:139157527-139157549 TAGTGCACTAAGGTGTTAAATGG - Intergenic
1051100522 9:13515656-13515678 GAGTGCAGTGTGGAGGTGATGGG + Intergenic
1053907691 9:42860613-42860635 AAGTGCACAATGCCGTTGATAGG + Intergenic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1058540055 9:106002515-106002537 TTGTGCAATATGGAGTTCACAGG + Intergenic
1192706298 X:73530839-73530861 TTTGGCACTATGGAGTGGATAGG - Intergenic
1199506934 X:148573381-148573403 AAGTGCTATATGGAGTGGATAGG + Intronic