ID: 1098456785

View in Genome Browser
Species Human (GRCh38)
Location 12:70683398-70683420
Sequence CTTAGAAAAGACTACTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098456785 Original CRISPR CTTAGAAAAGACTACTAGTA TGG Intronic
911543744 1:99190433-99190455 ATTAGATAAGGCTACAAGTATGG + Intergenic
913465325 1:119135430-119135452 TTGATAAAAGACTACTGGTAAGG + Intronic
920889080 1:209964969-209964991 CTTAGAAAAGCCTGCTTATAAGG - Intronic
921155388 1:212434305-212434327 CTTAGAAAAGCCTACTTGCAAGG + Intronic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
924402880 1:243706537-243706559 CTAAGAAAAGTCTAGTAGTATGG + Intronic
1066093576 10:32050916-32050938 CATAGAAAAAACTATTAGTATGG - Intronic
1066490719 10:35891554-35891576 CTTATAAATGAACACTAGTAAGG + Intergenic
1068442335 10:57074117-57074139 CTTTAAAAAGACTAATAATATGG - Intergenic
1069228617 10:65977135-65977157 CTTTTAAAAGAATACTATTAGGG + Intronic
1072905711 10:99451331-99451353 CTTAGAACAGACTATTATGAAGG - Intergenic
1073653200 10:105383374-105383396 ATTAGAAAAGATTACTAGGGGGG - Intergenic
1074347729 10:112704307-112704329 TTTAGAAAAGACTATTTGAAAGG - Intronic
1075142632 10:119853264-119853286 CTTATAAAAAATTACTAGTTTGG + Intronic
1081258233 11:40924430-40924452 CTTAAAAAATACTAGTAGTCTGG + Intronic
1084913602 11:72410924-72410946 TTTAAAAAAGAGTAATAGTATGG - Intronic
1085211993 11:74789888-74789910 CTTTGAAAAGACAACTAAAAAGG - Intronic
1086417995 11:86608310-86608332 TTTAGAAAAAATTACTAGGAGGG + Intronic
1093151955 12:15632284-15632306 CTTACAAACGAATACTAGAAAGG + Intronic
1093650000 12:21632194-21632216 CGTAGAAAAGACTACTGATTTGG + Intergenic
1098456785 12:70683398-70683420 CTTAGAAAAGACTACTAGTATGG + Intronic
1099265154 12:80437082-80437104 CATAGTAAAGAATACAAGTATGG + Intronic
1099855576 12:88161330-88161352 CTGAGTAAAGACTATTACTAGGG - Intronic
1099867269 12:88298982-88299004 CTAAGAAAAGCCAACTAGCATGG + Intergenic
1100096929 12:91051741-91051763 CTTAGTATAGAGCACTAGTAAGG + Intronic
1100900128 12:99229809-99229831 CTTAAAAAATACTAATTGTATGG - Intronic
1101116589 12:101537886-101537908 CTTAGAAAAGACAACTGGCTGGG + Intergenic
1102058239 12:109912840-109912862 CTTTGAAAAGATTACAATTAAGG - Intronic
1104371132 12:128224902-128224924 CTTCCAAAAGACTACCAGGAGGG - Intergenic
1107445078 13:40463322-40463344 GTGAGAAAAGACTACAAATATGG - Intergenic
1108633966 13:52314360-52314382 CGGAGGAAAGACTACTAGGATGG - Intergenic
1109535948 13:63719696-63719718 CTTAGAAAGGACTGCTCTTATGG - Intergenic
1109540152 13:63766590-63766612 CTTAGAAAGGACTGCTCTTATGG + Intergenic
1109906858 13:68854502-68854524 CTTAGAAAAAACTACAAGTTTGG - Intergenic
1110017720 13:70429007-70429029 CTTACAAAAGACTATTCTTAAGG + Intergenic
1110921492 13:81092447-81092469 CTCGGAAAAGACTACTATCATGG - Intergenic
1111845412 13:93501851-93501873 ATGTGAAAAGACTACTACTATGG - Intronic
1115527202 14:34293263-34293285 CTTGGAAAAGACTCCTGATATGG - Intronic
1120984660 14:90323982-90324004 CATAGAAGTGACTGCTAGTAGGG - Intronic
1121062582 14:90928463-90928485 CTTATAAAAGACTAATAAAATGG + Intronic
1124588466 15:31032977-31032999 CTAAGACAAGACTTCTAATACGG - Intronic
1126116045 15:45208523-45208545 CTGAGAAAAGAATATTTGTAAGG + Intergenic
1127100564 15:55560665-55560687 ATTAGAAAACACTACTAGCTGGG + Intronic
1128624983 15:69191791-69191813 CTTAGAAAGGCCTACTTGTAAGG - Intronic
1129651262 15:77492066-77492088 CTTAGAAAACATTCCTAGAAGGG - Intergenic
1130025682 15:80268694-80268716 CTTACCAATGACTACTTGTAGGG + Intergenic
1133950594 16:10388548-10388570 CTTAGTAAAGAGTACTAAAAAGG - Intronic
1140290417 16:73649272-73649294 CTTAGAAAAGACTTCTGGCTTGG + Intergenic
1144102646 17:11956018-11956040 CTTAGAAATGCCTGCTAGCAAGG - Intronic
1145275769 17:21429357-21429379 CTTAGAAAAGACCAAGAGTGGGG + Intergenic
1145313617 17:21715266-21715288 CTTAGAAAAGACCAAGAGTGGGG + Intergenic
1145712059 17:26987243-26987265 CTTAGAAAAGACCAAGAGTGGGG + Intergenic
1148495291 17:48049843-48049865 CTGAGAAAAGACAACTGTTATGG + Intronic
1150006521 17:61473111-61473133 CTTAGAGAAGACTGATAGGAAGG + Intronic
1150950718 17:69800499-69800521 TTTAGAAGAGACAACTAGGAGGG + Intergenic
1151065587 17:71145837-71145859 CTTAGAAAAAACAATTAGAAAGG - Intergenic
1151176960 17:72296626-72296648 CTTAGAAATGAGTAATAGTTTGG + Intergenic
1153417238 18:4860277-4860299 CTTAGAGAAGACCAAGAGTATGG + Intergenic
1155589100 18:27404624-27404646 CTGAAAAAAGACTTCTAGGAAGG + Intergenic
1156140557 18:34104297-34104319 GGTAGAAAAAACAACTAGTAAGG + Intronic
1156591546 18:38495114-38495136 TTTAGAAAAGATTAGTAGAATGG + Intergenic
926471122 2:13259557-13259579 CTTTGAAATCACTACTTGTAAGG - Intergenic
927581080 2:24248241-24248263 CTGAGAAAATACTACTAATTGGG - Intronic
936977699 2:118235881-118235903 CTTAGAAAGGTCTACTTGCAAGG - Intergenic
938779454 2:134572038-134572060 CTTAGAAAAGCCTGCTTGCAAGG - Intronic
939892423 2:147752903-147752925 CATAGAAAGGACTAATGGTATGG - Intergenic
940168069 2:150797104-150797126 CTAAGAAAAGAATACTATAATGG + Intergenic
943204216 2:184870771-184870793 CTTAGATAAAACTATTTGTAAGG + Intronic
943470304 2:188287462-188287484 CTTACAAAAAAGTAGTAGTATGG + Intergenic
948638888 2:239360658-239360680 CTTAGGAAAGAGTACTAGACAGG + Intronic
1172266017 20:33614910-33614932 CTTAGAAAGGCCTGCTTGTAAGG - Intronic
1173177460 20:40775186-40775208 CTAAGCAAAGACTTCTAGTGTGG + Intergenic
1174316930 20:49710716-49710738 CTTAGAAAATAATACTAGGTTGG - Intronic
1175686719 20:61034941-61034963 CTTAGAAAAGATTAATAAAATGG - Intergenic
1178454636 21:32737036-32737058 CTAAGGAAAGACTTCTGGTAAGG - Intronic
1178685575 21:34708114-34708136 TTTAGAACTGACTACTAGTGGGG - Intronic
953445341 3:42959718-42959740 CTTTGAAAAGACAAATAGCATGG - Intronic
959567316 3:107845780-107845802 TGTAGAAAAGACTACTTATAGGG - Intergenic
966262200 3:177992704-177992726 ATTAGCAAAGACCACTAGCAAGG - Intergenic
966470721 3:180285882-180285904 CTTAGAAAAGAGTAGTAATCTGG + Intergenic
968042862 3:195602419-195602441 TGTAAAAAAGACTACTAATAAGG + Intergenic
968126789 3:196165997-196166019 CTTTGAAAAGACTCCTGATACGG - Intergenic
971752455 4:30667915-30667937 CTTAAGAAAAACAACTAGTAGGG - Intergenic
972511027 4:39769366-39769388 CTTAGAAAAGAACACAAGAAGGG - Intronic
973175752 4:47203043-47203065 CTCAGAAAAGCCTACTTGGAAGG - Intronic
975611017 4:76203293-76203315 CTTAGAATAGACTCCTAGATTGG + Intronic
977033224 4:91915110-91915132 ATTGGAAAACACTACAAGTAAGG - Intergenic
978115378 4:105014007-105014029 CTCAGAAAAAACTTCAAGTAGGG + Intergenic
980723768 4:136730882-136730904 TTTAGAAAAGTTTATTAGTATGG - Intergenic
981426361 4:144608156-144608178 CTTAGAAAACACTACCACAAAGG + Intergenic
981457687 4:144973589-144973611 CTTAGAAAAGACCAAAAGAATGG + Intronic
981762709 4:148211214-148211236 CTTACAAAAGAATACTTCTAAGG + Intronic
982805905 4:159761960-159761982 CTTAGAAAGGACTATTTGCAAGG - Intergenic
985304596 4:188524635-188524657 CTGGGAAAAGACTAATAGTCTGG - Intergenic
988984917 5:36608320-36608342 ATTAGAAAACACAACTAGAATGG - Exonic
990385220 5:55253808-55253830 TTTAGAAGAGACTGCTTGTAGGG + Intergenic
991984655 5:72272257-72272279 CTTAGAAAGGTCTACTTGCAAGG + Intronic
996983327 5:129527469-129527491 CTTAGAAAAGACTGGTTGTTAGG - Intronic
997140948 5:131380229-131380251 TTTATAAAAGACTACAAATATGG - Intronic
999015189 5:148095173-148095195 GTTAGAAAAGACAATTACTAAGG - Intronic
999355176 5:150921553-150921575 TTTAGAAAAGAACACTAGGATGG + Intergenic
1010759120 6:79701779-79701801 CTGATAAAAGAATACAAGTAAGG - Exonic
1012021241 6:93922586-93922608 ATTAGAAAAGTCTAATATTATGG - Intergenic
1012383538 6:98649846-98649868 CTTAGAAAACAATAGTGGTAGGG + Intergenic
1013280248 6:108629407-108629429 GTAAGGAAAGACTACCAGTAGGG + Intronic
1017560897 6:155627037-155627059 CTTAGAAAAGATGAGTAGAAAGG - Intergenic
1018194915 6:161347087-161347109 ATTAGAAAAGTTTGCTAGTAAGG + Intergenic
1018585852 6:165357775-165357797 CTTTGAAAAGACTATTAAAATGG - Intronic
1021528161 7:21611953-21611975 CTTAGAAAAGACTAACTCTATGG + Intronic
1025299011 7:57801842-57801864 CTAAAAAAAGACCACTAGGATGG - Intergenic
1027610453 7:80353261-80353283 CTTGGATAAGAATAATAGTAGGG + Intergenic
1029013678 7:97291229-97291251 CATTAAAATGACTACTAGTAAGG - Intergenic
1031092360 7:117374684-117374706 CTTAGAAAAGAATACTAAGCTGG + Intronic
1031600098 7:123697712-123697734 CTTAGAAAGGACCACTTGCAAGG + Intronic
1032834864 7:135662998-135663020 CTCAGAAAAGCCAACTAGCAGGG - Intronic
1039207180 8:35170078-35170100 CTTAGGAAAGGCTCCTTGTATGG + Intergenic
1042861001 8:73314293-73314315 ATTAGAAAAGAAAACTAGTCAGG + Intronic
1047255097 8:123208209-123208231 CTTAGGAAAGGCTAATACTAGGG + Exonic
1047269178 8:123338627-123338649 CTTTTAAAATACTACTAATATGG - Intronic
1048253321 8:132885541-132885563 CCTAGAAAAGACTACTCCCAAGG + Intronic
1048360902 8:133696537-133696559 CTTAGAAACAACTACTAGCAAGG + Intergenic
1053318122 9:37070184-37070206 CTTAGGAAAGATTCCTAGAATGG + Intergenic
1053780791 9:41605075-41605097 CTTTGAACAGACTAATAGGAAGG + Intergenic
1054668797 9:67765579-67765601 CTTTGAACAGACTAATAGGAAGG - Intergenic
1055544381 9:77352703-77352725 CTTAGAAAGTATTACAAGTAAGG + Intronic
1057992960 9:99791907-99791929 CATATAAAAGACTACTACTCAGG - Intergenic
1186774147 X:12847331-12847353 CTTAGAAAGGCCTGCTTGTAAGG + Intergenic
1188408521 X:29842280-29842302 CTTAGAAAGGACTGCTTGCAAGG - Intronic
1189018534 X:37309671-37309693 CTTAGAAAGGCCTGCTTGTAGGG - Intergenic
1192479470 X:71472291-71472313 CTTAGAACAAACTAATAATAGGG - Intronic
1193136347 X:77975195-77975217 CTTAGAAATGGCAACTGGTATGG - Intronic
1196257323 X:113536460-113536482 CTTAGAGAAGTCTAAAAGTAAGG + Intergenic
1201417025 Y:13757334-13757356 CTTAGAAAAAACTATTAGCCAGG - Intergenic