ID: 1098457169

View in Genome Browser
Species Human (GRCh38)
Location 12:70687661-70687683
Sequence TTGGGTGACCTAAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098457163_1098457169 12 Left 1098457163 12:70687626-70687648 CCAAAACACTTTGCAAAAGATCC 0: 1
1: 0
2: 0
3: 22
4: 241
Right 1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG 0: 1
1: 0
2: 2
3: 14
4: 137
1098457166_1098457169 -9 Left 1098457166 12:70687647-70687669 CCTAGCATGTCCTTTTGGGTGAC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG 0: 1
1: 0
2: 2
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098457169 Original CRISPR TTGGGTGACCTAAAGGAAGT AGG Intronic
902115878 1:14120644-14120666 TTGTGAAACCTAAAGGAGGTAGG + Intergenic
903963171 1:27070172-27070194 TTGGGTGAACTGAAGGCAGGTGG + Intergenic
905304350 1:37007195-37007217 TTGGGAGACCTAAATGAGTTAGG - Intronic
909585929 1:77288102-77288124 TTGGGTGCTATAAAGGAAGTTGG + Intronic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
916329661 1:163600404-163600426 TTGGGAAACCTAAATGTAGTGGG + Intergenic
917631475 1:176894970-176894992 TTGGGTGCCCCAAATTAAGTGGG - Intronic
918327545 1:183424764-183424786 TTGGGTGACTTAAAGGAAGGAGG - Intergenic
922065624 1:222136893-222136915 TATTGTGACCTAAAGGAAGTCGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063297812 10:4825298-4825320 GTGGGTGTCCTCAAGGCAGTAGG + Intronic
1063354478 10:5385291-5385313 CTGGGTAAGATAAAGGAAGTGGG - Intergenic
1063694773 10:8323493-8323515 TTGGGTGAAAGGAAGGAAGTAGG + Intergenic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1067407438 10:46036095-46036117 TTGGGTGAGGAAAAGGGAGTGGG - Intronic
1067415988 10:46103570-46103592 TGGGGAAACCAAAAGGAAGTGGG - Intergenic
1070842380 10:79496213-79496235 TTCCCTGACCCAAAGGAAGTCGG - Intergenic
1075282431 10:121151345-121151367 TTGGATAACCTAGAAGAAGTGGG - Intergenic
1076171332 10:128322560-128322582 TTTTGTGAACTAAAGGAATTGGG + Intergenic
1078619728 11:12895996-12896018 TAGGGTGACTGAAAGGAAGACGG - Intronic
1079685741 11:23357368-23357390 TCGGGTGGCATAAGGGAAGTTGG + Intergenic
1083946997 11:65929248-65929270 TGGGGTGGCCTGAAGGAAGAAGG - Intergenic
1089185350 11:116611069-116611091 TTGGCTGAGCTACAGGATGTAGG + Intergenic
1090353591 11:126123936-126123958 TTTGGTGAGCTAAAAGATGTTGG + Intergenic
1091715902 12:2775924-2775946 TTGGGTGACCTGAAAGAAACAGG + Intergenic
1092656395 12:10689346-10689368 TTGGGAAACCTAAATGCAGTAGG - Intergenic
1092698895 12:11204939-11204961 ATTGGTTACCTACAGGAAGTGGG + Intergenic
1094794474 12:33954996-33955018 TTGGATGTCCTAAAGGGACTTGG - Intergenic
1097759085 12:63439874-63439896 TTAGGTGACTTGAAGGAAGTTGG - Intergenic
1097989258 12:65817971-65817993 TGGGGTGGCTTAAAGGCAGTTGG + Intergenic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1099275988 12:80576799-80576821 ATGGGTCACGTAAAGGAATTTGG - Intronic
1101147492 12:101854901-101854923 TTGGGTCACCATGAGGAAGTGGG - Intergenic
1104006787 12:124898610-124898632 TGGCATCACCTAAAGGAAGTGGG - Intergenic
1104275943 12:127328011-127328033 TTGAGTGACCAAAAGAAGGTGGG - Intergenic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1104834526 12:131779499-131779521 GTGGCTGACCTACAGGAGGTTGG + Intronic
1107527608 13:41248530-41248552 TTGGGAAACCTAAATGTAGTAGG - Intronic
1107986320 13:45779589-45779611 CTGGGTGATCTTAAGCAAGTTGG + Exonic
1109851401 13:68069838-68069860 TTGGGAGACCAGAAGGTAGTGGG - Intergenic
1110042711 13:70785198-70785220 TGGGGTGAGGTAAAGGAATTTGG + Intergenic
1115204212 14:30884608-30884630 TTGTTTGCCATAAAGGAAGTAGG + Exonic
1116621458 14:47209395-47209417 ATGAGGGACCTAAAGGCAGTAGG + Intronic
1120188538 14:81419299-81419321 TTGTGTGACCTTGAGAAAGTTGG - Intronic
1121989336 14:98540051-98540073 TGGGGTGAGCTAGAGGAGGTGGG - Intergenic
1125077693 15:35638731-35638753 GTGGGTGACCAAAAGGAGCTTGG + Intergenic
1126157567 15:45579505-45579527 TTTGCTGACCTAAAGGGAGAAGG - Intergenic
1128955793 15:71942277-71942299 TGTGGTTACCTAAAGGAGGTGGG + Intronic
1137429916 16:48410334-48410356 GTGGGTGACATCCAGGAAGTGGG + Intronic
1140303525 16:73781102-73781124 TTGGGAGCTCTCAAGGAAGTCGG + Intergenic
1143300354 17:5905215-5905237 TTGATTAACCTAAAGGAAGCTGG + Intronic
1147032736 17:37653565-37653587 ATTGGTTACCTACAGGAAGTGGG + Intergenic
1148121403 17:45214323-45214345 GTGGGTGACCTATAGGGAGCTGG - Intergenic
1203172031 17_GL000205v2_random:157354-157376 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1156460114 18:37316873-37316895 CTGGGTGGCCTAGAGGCAGTGGG - Intronic
1156689170 18:39685391-39685413 TTGGTTGAGCTTTAGGAAGTCGG - Intergenic
1158275693 18:55764767-55764789 TTGGGAGACCTTAAAGAAGTAGG + Intergenic
1158570797 18:58595608-58595630 TTGGGTGACCTATAGGGTGTAGG + Intronic
1160325994 18:77948664-77948686 TTGGGTGACCCTGAGCAAGTAGG - Intergenic
1162904696 19:13816827-13816849 TTGGGGGCCCTAAAGGCTGTTGG + Intronic
1164434174 19:28214761-28214783 TTGAGTGACCTTATGGAGGTAGG - Intergenic
1165931533 19:39362346-39362368 TTGTGTGACCTACTAGAAGTGGG + Intronic
1167716672 19:51146672-51146694 TTGGGGGCCTTATAGGAAGTGGG + Intronic
926551887 2:14310959-14310981 ATGTTTGACCTAAAAGAAGTTGG + Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
928703396 2:33922109-33922131 CAGGATAACCTAAAGGAAGTAGG - Intergenic
929570920 2:43022363-43022385 GTGGGGGACCTCAAGTAAGTTGG - Intergenic
931904638 2:66829420-66829442 ATGAGTGGCATAAAGGAAGTTGG + Intergenic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
935894659 2:107721694-107721716 TTGGATGACCAAGAGGCAGTTGG - Intergenic
935953521 2:108352393-108352415 TTGGATGACCTCAGGAAAGTGGG - Intergenic
936167374 2:110134233-110134255 TTGGATGACCTAAATGAAACAGG + Intronic
937122938 2:119453268-119453290 TTGGGTAAGCTAACGGAAGGAGG - Exonic
937782382 2:125853898-125853920 TTGAGGGAACTAAAGAAAGTAGG - Intergenic
940365346 2:152842790-152842812 TTGGATAACCTAGAGGAAATGGG - Intergenic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
942616593 2:177797174-177797196 TTGGCTGCCCTGATGGAAGTGGG - Intronic
943754677 2:191545650-191545672 TTGAGTGACCCAAAGAACGTGGG - Intergenic
945942697 2:215965779-215965801 TTCATTGACCTAAAGGGAGTAGG + Intronic
1171410063 20:24940494-24940516 TTGGGAAACCTAAACGCAGTGGG - Intergenic
1174361022 20:50029100-50029122 ATGGATGAACTAAAGGAATTGGG - Intergenic
1174494942 20:50932203-50932225 TTGGGTGGCCTCAAGGCACTAGG - Intergenic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1176328014 21:5519191-5519213 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176399743 21:6301760-6301782 TTGGGTGACCGAAAGCAGGAAGG + Intergenic
1176437414 21:6687344-6687366 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176461676 21:7014414-7014436 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176485237 21:7396192-7396214 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1179280603 21:39930891-39930913 ATAGTTCACCTAAAGGAAGTAGG + Intergenic
1181132465 22:20741155-20741177 TTGGGTGTCATAATGGCAGTGGG + Intronic
952359019 3:32611244-32611266 TTGGGAGAACTAAGGGGAGTGGG - Intergenic
961379727 3:126489036-126489058 TTGGGTGACCTACAGGCTGTGGG - Intronic
961671027 3:128531031-128531053 TTAGGTAACCTAGATGAAGTGGG - Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
965719584 3:171646941-171646963 TAAGGTGACCTAGAAGAAGTGGG - Intronic
966968602 3:185020708-185020730 TTGGGAGGCCAAAAGGAGGTTGG - Intronic
967717832 3:192783556-192783578 TTGGGTGGAAGAAAGGAAGTAGG - Intergenic
970089733 4:12391415-12391437 TTGTGTGACCTCATGGAACTAGG + Intergenic
970294301 4:14612050-14612072 TTGGGTGACCTTGAGCAAGCTGG + Intergenic
973006329 4:45011172-45011194 TTTGGTTTCCAAAAGGAAGTTGG + Intergenic
973540176 4:51927602-51927624 TTGGGAAACCTAAATGCAGTGGG - Intergenic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
980802320 4:137768373-137768395 TTTGGTGACTTAAAGGAATAAGG + Intergenic
982284623 4:153722309-153722331 TAGGGAGAGATAAAGGAAGTAGG - Intronic
982851257 4:160318758-160318780 TTGGGCAACCTAAAGGTAATGGG - Intergenic
983046028 4:162986901-162986923 TTGGTTGAGCTAAAGGAAGGTGG - Intergenic
990483622 5:56236105-56236127 TTGGGAAACCTAAATGCAGTGGG + Intergenic
990785501 5:59414314-59414336 TTGGGTGGCCTGATGGAAGGAGG - Intronic
993153764 5:84195473-84195495 TTGTGTGACCTAATTGAAGTAGG + Intronic
993303498 5:86244479-86244501 TTAGATTACCTAAAGGAAATTGG + Intergenic
994063020 5:95502760-95502782 TTGGGTGAACAAAAGGGATTGGG - Intronic
996513834 5:124347735-124347757 TGGAGTGACAGAAAGGAAGTGGG + Intergenic
997311075 5:132883380-132883402 TTCGGTGGCATAGAGGAAGTTGG + Exonic
1000808276 5:165825886-165825908 TTCGGAGGCCTAAAGGCAGTAGG - Intergenic
1003056690 6:2827145-2827167 TTAGGTGACCGAAAGGAAGTGGG - Intergenic
1005230489 6:23696380-23696402 TTGGGTGAAGTTAAAGAAGTTGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1007590908 6:43020552-43020574 GTGGTTGACCTTTAGGAAGTTGG + Intronic
1012482554 6:99683622-99683644 TTGGCTGTCCTTAAGGAAGATGG + Intergenic
1012985348 6:105869400-105869422 TTGGGAGACCTTAAGTATGTGGG + Intergenic
1014296412 6:119623833-119623855 TTCTGTGACCTAAAGGAAGAAGG + Intergenic
1015013895 6:128386470-128386492 TTGGGTGACATAAAAGAGGAAGG + Intronic
1018229905 6:161665593-161665615 TTGGGTGACCTATTAGAAGATGG - Intronic
1021026020 7:15667613-15667635 TTGGGGGACCTAGGGGAGGTAGG + Intronic
1021506478 7:21391068-21391090 TGGGTTGACCTAAAGGAGCTTGG + Intergenic
1025781093 7:64602420-64602442 TTAGGTAACCTTAAGGAAATGGG + Intergenic
1029089999 7:98040650-98040672 TGGGGTGGACTCAAGGAAGTGGG - Intergenic
1031878799 7:127172800-127172822 TTTTGTCACCTAAAGGAAGGAGG + Intronic
1036584779 8:10113351-10113373 TTGGGAGATCTAAAAGAAGGGGG + Intronic
1037055545 8:14435991-14436013 TGGGGAAACATAAAGGAAGTAGG + Intronic
1037545676 8:19918906-19918928 TTGGATAACCTAAAAGAAATTGG + Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1042266715 8:66915985-66916007 TTTGGTAACCTAAAGGTTGTAGG + Intronic
1043108906 8:76152469-76152491 TCGGGTGAACTAAAGGATATGGG - Intergenic
1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG + Intergenic
1043389135 8:79774752-79774774 TAGGGTGTCCTAAAGCAAGCTGG + Intergenic
1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG + Intronic
1047447724 8:124934410-124934432 TGGGGAAACCAAAAGGAAGTAGG + Intergenic
1047752282 8:127890902-127890924 TAGGGAGACCCAAAGGAAGTTGG - Intergenic
1048460369 8:134616331-134616353 TTTGGTGTCCAAAAGGGAGTGGG - Intronic
1048926455 8:139276650-139276672 TTGGGTGACCCAAAGAAGCTGGG + Intergenic
1049210432 8:141384038-141384060 TTGGGTGATCTGCAGGAAGGAGG + Intergenic
1049572973 8:143378201-143378223 TTGGGAGACCTCAGGGAAGGAGG + Intronic
1051100363 9:13514037-13514059 TTTGGTGACCTTGAGGAAGAGGG + Intergenic
1052780810 9:32780883-32780905 TTGGGTGACTTACTGGACGTAGG + Intergenic
1060729426 9:126027753-126027775 TTGGCTGACCTCAAGGACCTTGG - Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1189804868 X:44725227-44725249 TAGGGTGACCAAAAGAAAGCTGG + Intergenic
1192000841 X:67149741-67149763 TTGGGTTACCTGAAGGAAATGGG - Intergenic
1192076822 X:68007514-68007536 TTGGGTGATTTAAAGGAGGGTGG - Intergenic
1198470899 X:136946019-136946041 TTGGGTAAACTACAGGATGTAGG - Intergenic
1199348942 X:146776725-146776747 TTGGGTGACCTCAGGAAACTTGG - Intergenic