ID: 1098458536

View in Genome Browser
Species Human (GRCh38)
Location 12:70704475-70704497
Sequence GAGGATCCAGAACATCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098458536 Original CRISPR GAGGATCCAGAACATCATCA GGG Intronic
900241303 1:1618767-1618789 GAGGATCCAGCCCAGCATCGAGG - Intronic
902082188 1:13828811-13828833 GAGGATCCAGCACTTCAGTAAGG + Intergenic
903238722 1:21968287-21968309 GAGGAGCCAGAATGCCATCAGGG - Intergenic
903242647 1:21993951-21993973 GAGGAGCCAGAATGCCATCAGGG - Intronic
906555729 1:46711471-46711493 CAGGATCCAGAATATTTTCAGGG - Intronic
908563316 1:65328975-65328997 GAAAATACAGAACATAATCAGGG - Intronic
909633100 1:77787301-77787323 GAAGATGCTCAACATCATCAGGG - Intronic
910520710 1:88118923-88118945 AAGGATCCAGACCATGATCTGGG - Intergenic
911901859 1:103516464-103516486 GAGAATCAAGAAAATCATTAGGG + Intergenic
912804939 1:112748280-112748302 GAAAATCCAGAACAGCCTCACGG + Intergenic
913091228 1:115478077-115478099 GAAGATACAGAGCATCATCACGG + Intergenic
915650744 1:157308603-157308625 GAGGATCCAGAGCAATTTCATGG + Intergenic
916634972 1:166658744-166658766 AAGGATCCACATAATCATCATGG - Intergenic
917358504 1:174151271-174151293 GAGGTTCCACAAAGTCATCATGG + Intergenic
918188025 1:182144655-182144677 GAGGAACCAGAAGTTCATAAGGG - Intergenic
921332262 1:214051048-214051070 GAGGATACAGATCAGCATGAGGG - Intergenic
923378639 1:233392265-233392287 GTGAATCCAGAACTTCATCTGGG - Intergenic
1063824657 10:9881072-9881094 GAATATCCATAATATCATCAAGG - Intergenic
1066961340 10:42230621-42230643 GAGGATCCAGAGAAACAGCAGGG + Intergenic
1068365583 10:56045159-56045181 GAGGATAAAGACCATTATCATGG + Intergenic
1068770751 10:60818108-60818130 GGTGATCCAGAAAATCTTCAAGG + Intergenic
1068809924 10:61243811-61243833 GGGGACCCAGAGTATCATCATGG - Intergenic
1070250049 10:74765705-74765727 CAGGCTCCAGAACATAACCACGG + Intergenic
1071267260 10:83975278-83975300 GAGGATCCAAAACATTATTGTGG - Intergenic
1071908785 10:90205950-90205972 GAGGATACAGAATATCTCCAGGG + Intergenic
1076425491 10:130364503-130364525 GGCCATCCAGAACCTCATCATGG + Intergenic
1076577436 10:131478990-131479012 GAGGAGGAAGAACATCACCATGG + Intergenic
1078737445 11:14033388-14033410 GATGAACCTGAACAGCATCAAGG - Intronic
1079339703 11:19601876-19601898 TAGGAACTAGAAAATCATCAGGG + Intronic
1080418027 11:32087878-32087900 GTGGTTTCAGGACATCATCAAGG - Intronic
1081359014 11:42149185-42149207 GAGGAACCAGCCCTTCATCACGG - Intergenic
1085257994 11:75187605-75187627 GATGATTCTGATCATCATCATGG + Intronic
1087162196 11:94959605-94959627 GAGGATCCAAATCAGCATCCTGG - Intergenic
1089342172 11:117765398-117765420 GAGGATCCAGACCCTCATGGTGG - Intronic
1089537256 11:119168539-119168561 GATGAGCCAGAACAACATCCCGG - Intronic
1089903440 11:122012317-122012339 GGGGACCCAAAACATCATTATGG + Intergenic
1093342796 12:17998752-17998774 CAGGATCCAGAACCACCTCATGG + Intergenic
1094166312 12:27447283-27447305 AAGGATCAAGATCATCTTCAGGG - Intergenic
1094777013 12:33741280-33741302 GTGTATTCAGAACATCATCCAGG + Intergenic
1098068935 12:66651073-66651095 GAGGAGCTAGCACATCATCTGGG - Intronic
1098458536 12:70704475-70704497 GAGGATCCAGAACATCATCAGGG + Intronic
1098832080 12:75375328-75375350 GGGGATCCAAAACATCATTGTGG - Intronic
1100737636 12:97554887-97554909 GAGCTTCCAGGACATCTTCATGG + Intergenic
1101638817 12:106570386-106570408 GAGGCTCAAGAATGTCATCATGG - Intronic
1104387872 12:128366433-128366455 GAGGAGCCAGAAGGTCATTAAGG - Intronic
1105859719 13:24398755-24398777 GGGGATCCAGGACATTATCTGGG - Intergenic
1114331222 14:21638872-21638894 GAGGGTCAAGAACACCTTCAAGG + Intergenic
1116214604 14:41996458-41996480 AAAGATCCAAAACATCATCCTGG - Intergenic
1119133777 14:72197851-72197873 GAGGATCCAGAAAGTCTTCTAGG - Intronic
1123443684 15:20306762-20306784 GAGGATCCAGAGCAAGAGCAGGG - Intergenic
1123792003 15:23731084-23731106 TAGCAACCAGAACAGCATCAAGG - Intergenic
1125326985 15:38546057-38546079 GAGGATCCAAAATCACATCATGG - Intronic
1126463551 15:48939265-48939287 GAGGCTCCAGACCAGCCTCAGGG + Intronic
1130882592 15:88068122-88068144 GAGGATACAGAACACTATTAAGG + Intronic
1132521226 16:390384-390406 GAGGATCAACAACAGCTTCATGG + Intergenic
1134102314 16:11460964-11460986 GAGGATCCAGTACAGCCTCCTGG - Exonic
1136030781 16:27501325-27501347 CAGGATTCAGAAGATGATCATGG - Exonic
1138941659 16:61799055-61799077 GAGGATCAAGGTCATCATGAGGG - Intronic
1141408169 16:83812816-83812838 GAGGCTTGAGAACATCACCAGGG - Exonic
1146678279 17:34788890-34788912 GAGGCTCAAGAAGATAATCAAGG + Intergenic
1147200363 17:38797724-38797746 CAGGATGCAGAACAAAATCAAGG + Intronic
1147211784 17:38876037-38876059 GGTGATCCAGCACATCATCCTGG + Intronic
1148455430 17:47808663-47808685 GAGGATCCAGATCAAACTCAGGG + Intronic
1151344812 17:73495041-73495063 GAGGATCCAACAGAGCATCAAGG + Intronic
1152024807 17:77801915-77801937 GAGGAGCCAGAACAAGATCTGGG - Intergenic
1153942737 18:9991598-9991620 AAGGATCCACAGCAGCATCAAGG - Intergenic
1159030876 18:63229827-63229849 GAGGATAAAGAAGATCCTCATGG - Intronic
1159032703 18:63247568-63247590 GAAGAACCAGAAAAACATCAGGG + Intronic
1159168714 18:64735363-64735385 GGAGATCCAAAACATCACCATGG + Intergenic
1161046806 19:2139440-2139462 GTGTCTCCAGAACACCATCAAGG + Intronic
1163496083 19:17647433-17647455 CCGGACACAGAACATCATCATGG - Exonic
1165168690 19:33875392-33875414 GAGGGCCGTGAACATCATCATGG - Intergenic
1165337010 19:35177978-35178000 GAGGATCCCTAATATCATAAGGG + Intergenic
1168173012 19:54601942-54601964 GAGGATCCTGAAAAACATGAGGG + Intronic
927279367 2:21290397-21290419 CAGTAGCCAGAGCATCATCACGG - Intergenic
927286666 2:21363843-21363865 GAAAATCCAGCACAGCATCATGG - Intergenic
929786612 2:44997967-44997989 AAGGCTCCAGACCAACATCAGGG + Intergenic
932559973 2:72858897-72858919 GATGATGCTCAACATCATCAGGG - Intergenic
934323580 2:91986472-91986494 GAGGATCCAGAGAAACAGCAGGG - Intergenic
934514743 2:94979662-94979684 CAGGAACCAGAATGTCATCAAGG + Intergenic
936497114 2:113032043-113032065 GAGGTTCCAACACATCACCACGG + Intronic
939883680 2:147658188-147658210 GGGGCTCCACAACGTCATCAAGG + Intergenic
943318020 2:186412953-186412975 GAGGACCCAAAACATCATTGTGG - Intergenic
1169025593 20:2368471-2368493 GAGGCCCCAGAACATCAGCTGGG - Intergenic
1169333679 20:4737466-4737488 AAGAAAACAGAACATCATCAAGG + Intronic
1170367364 20:15612363-15612385 GAGGATGTGGAACAGCATCAGGG - Intronic
1171177616 20:23064993-23065015 GAGGATTTATTACATCATCAGGG - Intergenic
1172759128 20:37309624-37309646 GATGAGCCAAAACATCATCAGGG - Intronic
1173661574 20:44737920-44737942 GAGGACTCACAACATCTTCAGGG + Intergenic
1175201638 20:57281974-57281996 GAGAATCCAGAACAGCAAAACGG + Intergenic
1179955358 21:44735276-44735298 GAGGACCCAGAAATTCTTCATGG + Intergenic
1182933455 22:34196792-34196814 GAGTATGCAGAACACCATCCAGG + Intergenic
1184987216 22:48144094-48144116 GAGGAACCAGCCCATCTTCAGGG - Intergenic
1185141809 22:49106750-49106772 GAGGATCCTGAAAATCTTCCAGG - Intergenic
952156225 3:30646544-30646566 GAGGATCCATAACATTTGCAAGG + Intronic
952583644 3:34865066-34865088 GAGAATCCAGAACACCAGCTGGG - Intergenic
958070951 3:88610504-88610526 GAGGAACCAGGACATGACCAGGG + Intergenic
959664621 3:108906646-108906668 TAAGAGCCAGAACATCAGCAAGG - Intergenic
966706594 3:182923243-182923265 AAGGATTAAAAACATCATCATGG - Intergenic
967182858 3:186921649-186921671 GAGGCCCCAGAACTTCATCCAGG - Intergenic
967464483 3:189787925-189787947 GATGATCCTGAAAATCATCCAGG - Intronic
970462852 4:16292817-16292839 CAGTTTCCAGAATATCATCAGGG + Intergenic
972263973 4:37440733-37440755 GAGGTTCCAGACCATCATGCAGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975124990 4:70771953-70771975 AAGGAACCAGATCATCATAAAGG + Intronic
975492095 4:75000412-75000434 GTGGATCAACAATATCATCAAGG + Intronic
977833448 4:101619478-101619500 GAAGACTCAAAACATCATCATGG - Intronic
979465145 4:121028578-121028600 GAGGACCCAGAGAATCAACACGG + Intergenic
980519566 4:133913143-133913165 GAGGATTCTGAAAATCCTCAAGG + Intergenic
981050252 4:140302738-140302760 GAATATCAAGAACATTATCAAGG + Intronic
983862485 4:172724894-172724916 AAGGAGCTTGAACATCATCAGGG + Intronic
984235801 4:177157204-177157226 AAGGAGACAGAACATCATGAGGG + Intergenic
986398918 5:7360181-7360203 GAGGATGCAGGACATCCTCTAGG + Intergenic
990238862 5:53797216-53797238 GAGGCTCAACAACATCAGCAAGG + Intergenic
992220036 5:74562754-74562776 GAGGATGCAGAACCAGATCAAGG - Intergenic
995778159 5:115747463-115747485 GTGTATCTAGAATATCATCAGGG - Intergenic
1000223423 5:159235581-159235603 GAGGACCCAAAACATCATTGTGG - Intergenic
1001233418 5:170009475-170009497 GAGGATTCAGGACATGAGCAAGG - Intronic
1003478277 6:6505351-6505373 GAGGGTCCAGTACATAATCTAGG - Intergenic
1003814718 6:9825749-9825771 GAGGATCCAACATATGATCAAGG - Intronic
1008179725 6:48313462-48313484 GAGGATTCAGAAAATATTCATGG + Intergenic
1012098141 6:94992934-94992956 GAAGATCCAGAAAATTATCATGG - Intergenic
1014125856 6:117776333-117776355 GAGGATCCAGATTAACAACAGGG - Intergenic
1015467104 6:133559532-133559554 GGGGACCCAAAACATCATTATGG - Intergenic
1016085163 6:139904497-139904519 CAGCATCCAGAACTTCACCATGG + Intergenic
1016185615 6:141195161-141195183 GATGATCCTGAACAACATCTGGG + Intergenic
1016576421 6:145573895-145573917 GGGGATCCAAAACATCATTATGG - Intronic
1017307362 6:152934693-152934715 GAGGACCCAGAGAATCAGCAAGG - Intergenic
1022166673 7:27771924-27771946 TAGGAACCAGAGAATCATCAAGG + Intronic
1023522286 7:41060511-41060533 GAGGATGAAGAACATCATTGAGG - Intergenic
1023874239 7:44278148-44278170 GACGATCCAGGACAGCTTCATGG + Intronic
1024139875 7:46451528-46451550 GAGGTTCCAGAGCAGCAACATGG + Intergenic
1028237653 7:88381545-88381567 GGGGATCCAAAACATCCTCGTGG + Intergenic
1028480580 7:91300396-91300418 GAGGATTCAGAAGATAATAAAGG - Intergenic
1033354339 7:140587346-140587368 GAAGATCCAGAACCACATCTTGG - Intronic
1033411540 7:141122681-141122703 GAGGAACCATAATATCATGATGG + Intronic
1035472858 7:159121198-159121220 GAGGAATCAGAACAGCAGCATGG - Intronic
1035492343 7:159291384-159291406 GAGAATCTAGAGCATCCTCAAGG - Intergenic
1039120543 8:34141618-34141640 CAGGAACCAGAACATCACTATGG - Intergenic
1040979414 8:53230471-53230493 GAGAATCATCAACATCATCAAGG + Intronic
1042809313 8:72806394-72806416 GGAGATCCAGACCATCATCCTGG + Intronic
1043593219 8:81853759-81853781 GAGGAACCAGATCAACTTCAGGG - Intergenic
1044593263 8:93934463-93934485 GAGTATCCAGGACATTTTCATGG + Intergenic
1047032981 8:120903595-120903617 GAGCATCCATACCATCATGAGGG - Intergenic
1048271195 8:133029576-133029598 GAGGTACAAGAACATGATCAAGG + Intronic
1049308106 8:141918233-141918255 GAGGATCCATAGACTCATCAGGG - Intergenic
1049681571 8:143920937-143920959 GATCATCAAGATCATCATCACGG - Exonic
1050600837 9:7248503-7248525 AAAGATATAGAACATCATCATGG + Intergenic
1051117076 9:13708060-13708082 GATGATCCTGAAGATGATCATGG + Intergenic
1052713794 9:32090169-32090191 GAGGATCCAAAAGATTATAATGG + Intergenic
1052716020 9:32118435-32118457 AAGGAGCCACACCATCATCAGGG + Intergenic
1053101800 9:35377505-35377527 CCGGACCCAGAACATTATCATGG + Exonic
1054727416 9:68666167-68666189 GAGCATGAAGAACATCATAAGGG - Intergenic
1056464698 9:86842309-86842331 GTGGAAGTAGAACATCATCAAGG - Intergenic
1058905338 9:109478031-109478053 GAGGATCCAGGACAGCCTCACGG + Intronic
1060274957 9:122175362-122175384 GAGGATCCAGAACCTCAGTTTGG + Intronic
1187175790 X:16895350-16895372 GAGCAGCCAGACCATCATCTCGG - Intergenic
1189609600 X:42717988-42718010 GATGATCCAGAAGATCTTGAAGG - Intergenic
1192354944 X:70393480-70393502 GAGTATGCAGAAAATCAGCAAGG - Intronic
1192419509 X:71016698-71016720 GAAAATCCAGCACAGCATCACGG - Intergenic
1193055989 X:77151615-77151637 GAAAATCCAGAACATTTTCAGGG + Intergenic
1194431405 X:93811345-93811367 GAATATCAAGAACATCATAAAGG - Intergenic
1197554429 X:127936855-127936877 GGGGATCCAAAACATCATTGTGG - Intergenic
1198343462 X:135737154-135737176 GAGGATCTGGAACATTATGAGGG + Intergenic
1199255979 X:145719347-145719369 GAGCCTCCAGAACATCACCTTGG + Intergenic
1199903235 X:152198623-152198645 GAGAAACCAGAAAAGCATCATGG - Intronic