ID: 1098463846

View in Genome Browser
Species Human (GRCh38)
Location 12:70764481-70764503
Sequence CAAAAGGCATCATGGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098463840_1098463846 15 Left 1098463840 12:70764443-70764465 CCAATCTTTTGCAACTACTGAAC 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG 0: 1
1: 0
2: 1
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098463846 Original CRISPR CAAAAGGCATCATGGGCAAT GGG Intronic
902752233 1:18524985-18525007 CTAAAAGTATCATGGGCCATAGG + Intergenic
902802133 1:18837118-18837140 TAAAAGGCATCATGAGAAAGAGG + Intergenic
903518954 1:23933044-23933066 CAAAAGGCAACCTAGGGAATGGG + Intergenic
904393485 1:30201583-30201605 GAAAATGCATCATGGCCAAGTGG - Intergenic
908057364 1:60303944-60303966 CAAAAATAATCATTGGCAATTGG - Intergenic
908213547 1:61926612-61926634 CAAAATGCCTCTTAGGCAATAGG - Intronic
909174577 1:72339980-72340002 AAAAAGGCAATATGGGGAATGGG - Intergenic
910599279 1:89013189-89013211 CAGGAGGCATCAAGGTCAATGGG - Exonic
911723182 1:101213402-101213424 CAAAAGCCATTATGGTCCATGGG + Intergenic
912051251 1:105530551-105530573 AAAAAGGCAACATGTGGAATGGG - Intergenic
917185642 1:172351992-172352014 CAAAAGGCATCATGATCCACTGG + Intronic
919420590 1:197365475-197365497 CCAGAGGCATCATAGGCAAGGGG - Intronic
920963853 1:210686185-210686207 CTAAAGGCCTCATGGGGGATGGG + Intronic
921745418 1:218735007-218735029 CATTAGGCAGGATGGGCAATAGG - Intergenic
923925860 1:238626644-238626666 GAAAAGGCATCATGGTCAGGTGG - Intergenic
924368131 1:243318607-243318629 CAAAAGGCATGAGGGTCAAACGG - Intronic
1063243431 10:4194212-4194234 CATAGGGCATCTTGGGCTATAGG - Intergenic
1063533116 10:6855347-6855369 CAAAAGGCATCCTATGGAATTGG - Intergenic
1064534243 10:16342431-16342453 CAAAAAGCTTCATGAGCATTTGG + Intergenic
1065262857 10:23943586-23943608 CAACAGGCATTTTTGGCAATAGG + Intronic
1067898689 10:50215078-50215100 CAAAAGCCAACATTGGCAAATGG - Intronic
1070488721 10:76955804-76955826 CAAAAGCCATCATGGAGAAGAGG + Intronic
1071929300 10:90449049-90449071 AAAAAAGCATCATGTGAAATAGG + Intergenic
1078615775 11:12864382-12864404 CAAGAGAAATCATGGGCACTGGG - Intronic
1079123166 11:17699397-17699419 CAAGAGGGATCTTGGGCCATGGG - Intergenic
1080274047 11:30483780-30483802 CACAAGGCTTCATGAGCCATGGG - Intronic
1080371742 11:31655425-31655447 CAAAAGGTATAATCCGCAATTGG + Intronic
1080482144 11:32662699-32662721 CAAAAGCCAACATTGACAATTGG - Intronic
1087264160 11:96042636-96042658 GAAAAGGCTTCATGGGGAACAGG - Intronic
1089938239 11:122387944-122387966 AAAAAGGCTTCATGACCAATTGG + Intergenic
1091880701 12:3975105-3975127 CAAAAGCAGTCGTGGGCAATAGG - Intergenic
1095082567 12:38023357-38023379 CAGAGGGCATCATGGCCTATAGG + Intergenic
1096939960 12:55332487-55332509 GAAAAGGCATCATTGACAAAAGG + Exonic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1098647579 12:72923631-72923653 AGAAATGCATCATGGGCTATGGG - Intergenic
1100349179 12:93762492-93762514 GTAAAGGCCTCATGGGCAATAGG + Intronic
1104481280 12:129110385-129110407 CAAAAGGCTTCATGGTCCAAAGG - Intronic
1105438408 13:20396433-20396455 CAGAAGGCAGCATGGGCATTGGG - Intergenic
1108588602 13:51892683-51892705 GAAAGGCCATCATGGGGAATGGG - Intergenic
1109626179 13:64978185-64978207 CAAAAGGCAAAATGGACAAATGG - Intergenic
1112827458 13:103408232-103408254 CAGAAGGCACCATGCGCACTTGG + Intergenic
1115387558 14:32815039-32815061 CAAAAGGGATCAGGGACAAAAGG - Intronic
1129117874 15:73375291-73375313 GAAAAGGGATCATGTGAAATTGG - Intergenic
1129541293 15:76349487-76349509 CAAAATTCTTCCTGGGCAATAGG + Intronic
1130750290 15:86704266-86704288 CAAAAGGCAAAATTGGCAAATGG + Intronic
1130870146 15:87964725-87964747 CAAATGGCATCATAGAAAATGGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1136071740 16:27791576-27791598 CAAAAGGCATGATGGGCAGAAGG - Intronic
1139694946 16:68667339-68667361 CAAAAGGCAGCCTGGGGAGTTGG - Intronic
1141825372 16:86475455-86475477 CAAAGTGCATCATGGGACATGGG + Intergenic
1142755671 17:2015159-2015181 CAAAGGGCATCATGGGAGAAGGG + Intronic
1143096444 17:4480882-4480904 CAAAAGGCATCTTTGGCCACGGG - Intronic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1147442795 17:40457655-40457677 GAAAAGACATCATGGCCAACTGG - Exonic
1148392929 17:47286196-47286218 GAAAAGGCAGCATGGGAATTGGG - Intronic
1148586190 17:48782475-48782497 GAAAAGGCAACTTGGGCAATGGG - Intronic
1150495127 17:65601934-65601956 CAAAAGTCAAAATGGGAAATTGG - Intronic
1150590286 17:66556350-66556372 CAATAGTCTTCATGGGCATTAGG + Intronic
1153497894 18:5718500-5718522 CAAAACGGCTCATGTGCAATGGG - Intergenic
1157772495 18:50361531-50361553 GAAAAGGAAGCATGGGCAAAAGG + Intergenic
1157854098 18:51088326-51088348 AAAAAAGCATCATGAGCAAGTGG + Intergenic
1159187990 18:65003329-65003351 CAACAGGAATTATGGGGAATAGG + Intergenic
1160038039 18:75319386-75319408 CAAAACTCATCTTGGGCACTTGG + Intergenic
1161745949 19:6060252-6060274 CAAAAGCCATCATAGATAATGGG - Intronic
1164133258 19:22385120-22385142 TAAAAGACATCTTGGGCTATAGG + Intergenic
1164165554 19:22671636-22671658 TAAAAGACATCTTGGGCTATAGG - Intergenic
1165875284 19:39002292-39002314 CAAAAGGCATCATGGCCAAGAGG + Intronic
1166156663 19:40917786-40917808 CAAAAGGCAAAATGGACAAATGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
929596185 2:43177843-43177865 CAAAAAGCTTCCTGGGCCATTGG - Intergenic
932929382 2:76015798-76015820 CAAAAGCCATCATGAGAAATTGG - Intergenic
932940677 2:76161164-76161186 CAATAGGCATCATTGGTCATTGG - Intergenic
934561238 2:95314637-95314659 CAACTGGCATCAAGGGCCATCGG - Intronic
935091440 2:99898694-99898716 CAAGAGGCTTCCTGGGGAATGGG - Intronic
935222736 2:101028858-101028880 CACCAGGCATCATGGGCATCAGG - Intronic
936116405 2:109706415-109706437 CAAAGGGCATCTTGGGCAGAGGG - Intergenic
936480864 2:112883784-112883806 CCAAATGCAGCATGGGCAAATGG + Intergenic
937404925 2:121618203-121618225 CAACAGGCATTATAGGCATTAGG - Intronic
937502948 2:122502920-122502942 CAATAGGAATCATGGGCCACTGG + Intergenic
938110142 2:128558876-128558898 AGAGAGGAATCATGGGCAATGGG - Intergenic
939520737 2:143226607-143226629 TAAAAGGCAAAATGGGCACTAGG + Intronic
940040810 2:149358528-149358550 CATAAAGCGGCATGGGCAATTGG + Intronic
941073078 2:160976583-160976605 CAAAAGCCAAAATTGGCAATTGG - Intergenic
941756452 2:169191718-169191740 CTAAAAGCATCATGGGCCCTGGG + Intronic
942901444 2:181124709-181124731 CAAAAGGCCTGAAGGTCAATAGG - Intergenic
944940804 2:204624083-204624105 GAAAAGGCAGCCTGGGGAATGGG + Intronic
945586049 2:211664423-211664445 GAAAAGGCTTTATGGGCAGTAGG + Intronic
948667388 2:239545275-239545297 CCACTGGCATCATGGCCAATGGG - Intergenic
1169487647 20:6046556-6046578 GATAATTCATCATGGGCAATGGG + Intronic
1172825234 20:37777338-37777360 CAAAAGGCATCTTTGCCTATGGG - Exonic
1172968599 20:38857061-38857083 CAACAGACCTCACGGGCAATGGG - Intronic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1174571844 20:51507711-51507733 CAAGAGGCAGCATGGGCCAGTGG + Intronic
1175483751 20:59329894-59329916 CAAAACCCATCAAGGGCCATTGG + Intergenic
1176416548 21:6478809-6478831 CACAGGGCCTCATGGGCCATGGG - Intergenic
1177746636 21:25222604-25222626 CAAAAGGAATCATATGCACTAGG - Intergenic
1179692048 21:43087144-43087166 CACAGGGCCTCATGGGCCATGGG - Intergenic
1185239017 22:49731510-49731532 GAAAAGGCAACATGTGGAATGGG - Intergenic
949349243 3:3108498-3108520 CAAATTGCACCATGTGCAATTGG - Intronic
952146707 3:30540986-30541008 CAAAAGCCATCATTGACAAATGG + Intergenic
956034039 3:65071050-65071072 CAAAAGGCACAAAGGGCATTTGG - Intergenic
956517307 3:70063350-70063372 CAGAAGGCATCACAGGAAATGGG - Intergenic
956963520 3:74431645-74431667 GAAAAGGCCACATGTGCAATTGG + Intronic
959655331 3:108797962-108797984 AAAAAGGCATCAGGGGAAACCGG + Intergenic
959842082 3:110988979-110989001 CCAAAGGCATCCTGAGCAAAAGG + Intergenic
959895831 3:111604851-111604873 CAAAAGCAACCATGGACAATAGG + Intronic
963641884 3:147870983-147871005 CCAAAGCCATCATGGGCATCAGG - Intergenic
964447986 3:156780597-156780619 CTACAGGCATCATGGGCACCTGG + Intergenic
965287151 3:166830754-166830776 TAAAAAGCATCATGGGGTATAGG - Intergenic
965808011 3:172562281-172562303 CAAGAGTCATCAGGGGCAAATGG + Intergenic
971048246 4:22830362-22830384 AAAAAGGCAACATGAGCAATGGG + Intergenic
971788808 4:31140854-31140876 CAAATGGCAGCATCGGCAACTGG + Intronic
972033321 4:34490240-34490262 CAAAAGGAATTCTAGGCAATGGG + Intergenic
974085317 4:57254257-57254279 GAAAAAACATCATGGGCTATAGG + Intergenic
977141846 4:93383311-93383333 CAAAAGCCAGCATGGGCAAAAGG - Intronic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
980591964 4:134902081-134902103 CAAAAGCCAACATTGGCAAATGG - Intergenic
982603644 4:157485337-157485359 CAAAAGCCAAAATGGACAATTGG - Intergenic
983617878 4:169727920-169727942 CCAAAGGCAACATGAGCCATTGG + Intergenic
985067663 4:186139078-186139100 CAAAATACATCATGTGCTATCGG - Intronic
986262565 5:6161097-6161119 CAAAATGCATCCTGGACAAGAGG - Intergenic
986921654 5:12691213-12691235 AAAAAGGCCTGATGTGCAATGGG + Intergenic
988985902 5:36618714-36618736 CAAAAGGCACCAGGGGAACTTGG + Intronic
995006619 5:107204398-107204420 CAAAAGACAACAATGGCAATGGG - Intergenic
995433872 5:112113565-112113587 CCAAAAGCATTATGGGTAATTGG - Intergenic
996890469 5:128412592-128412614 CAAAAAACAGCATGGGCAACTGG + Intronic
997797378 5:136824024-136824046 CAAAAGGCAAAATCGACAATTGG - Intergenic
999067899 5:148711206-148711228 CAAAAGGCAGCAAGTGCTATTGG + Intergenic
999683775 5:154084254-154084276 AAAAAGACATCATGCTCAATGGG - Intronic
1008201113 6:48592036-48592058 CAAAAGCCAAAATAGGCAATGGG - Intergenic
1008452340 6:51667557-51667579 CAAAAGGCAAAATGGACAAATGG - Intronic
1009307441 6:62108073-62108095 CAAAAGGCAAAATGGACAAATGG + Intronic
1011302366 6:85889924-85889946 CAGAAGGCAAAATTGGCAATGGG - Intergenic
1015972900 6:138760749-138760771 CAAAAAGCATCAGGGCTAATGGG - Intronic
1018980875 6:168600711-168600733 AAAAAGCCATCTTGGACAATCGG - Intronic
1020558879 7:9704085-9704107 CAAAAGGCAACATGGAATATGGG - Intergenic
1023333705 7:39146412-39146434 TAAGAGCCATCATGGGCCATTGG + Intronic
1024907964 7:54410161-54410183 CAAAAGGCAGCCTGGTCTATGGG - Intergenic
1025861338 7:65332712-65332734 CTAAAGCCATCATGAGCAAAAGG - Intergenic
1026367811 7:69667108-69667130 CACAGGGCATCATGTGCAAGGGG + Intronic
1027389478 7:77691107-77691129 CAAGAGGCTTCATGGGCAAGTGG + Intergenic
1028135194 7:87217814-87217836 TCAAATGGATCATGGGCAATAGG + Intronic
1030309853 7:108058203-108058225 CAAAACACATAATGGGAAATGGG + Intronic
1031806523 7:126314569-126314591 TAAAAGGCTGCATGGGTAATTGG - Intergenic
1031835604 7:126677984-126678006 GAAGAGGCATCCTGGGCACTGGG + Intronic
1033030908 7:137825473-137825495 CAACAGCCATGATGGGAAATAGG + Intronic
1034970398 7:155415499-155415521 CAAAAGGCTTCAAGGCCAAGAGG + Intergenic
1035560260 8:598911-598933 CAACTGGTAACATGGGCAATGGG - Intergenic
1037938400 8:22930635-22930657 CAAAAGGCATCCAGGGCTAAGGG - Intronic
1038554990 8:28504692-28504714 CACAATGCATCATACGCAATAGG + Intronic
1040852995 8:51921424-51921446 CCAAATACATCATGGGCAAGTGG + Intergenic
1042023775 8:64400864-64400886 CAAAAGCCAACATAGGCAAATGG - Intergenic
1047720695 8:127636385-127636407 CAAAAGGCATCAGGGGAATCAGG - Intergenic
1051120538 9:13747390-13747412 CTGAAGGAATCAAGGGCAATGGG + Intergenic
1051237904 9:15021227-15021249 CCAAAGGCAGCATGAGCCATTGG - Intergenic
1051680193 9:19599763-19599785 CAGGAGGCATCATGGGCTGTAGG - Intronic
1051807891 9:21016559-21016581 CAGAAGGCATCCTAGGCAAAGGG + Intronic
1052804735 9:33002623-33002645 CAAACAGCAGCATGGGCAAGTGG - Intronic
1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG + Intronic
1056997290 9:91474797-91474819 CAAAAGCAGCCATGGGCAATAGG + Intergenic
1059736560 9:117105702-117105724 CATATGGCAGCCTGGGCAATGGG + Intronic
1061137044 9:128740956-128740978 CAAAAAGCTTCATGGGCATCTGG + Intronic
1062271198 9:135710090-135710112 CAAAAGACATCACTGGCAAAAGG - Intronic
1187528924 X:20079196-20079218 CCAAGGGCAGCATGGGAAATAGG + Intronic
1189383456 X:40518212-40518234 CAAAAGTCAACATGGCGAATTGG - Intergenic
1191956021 X:66643042-66643064 TAAAAGCCATCTTGGGCAAGTGG - Intergenic
1192741524 X:73897814-73897836 CAAAAGGCAAAATGGACAAATGG + Intergenic
1192975654 X:76281545-76281567 CAAAAGCCAAAATTGGCAATGGG - Intergenic
1195544685 X:106101177-106101199 GGAAAGGCATCGAGGGCAATTGG - Intergenic
1195854422 X:109314827-109314849 CATAAGACATGAGGGGCAATGGG - Intergenic
1196257947 X:113544853-113544875 CATAAGGCATTCTGGGCAAAAGG - Intergenic
1196477127 X:116101053-116101075 CAAAAGGCAGAATGGACAAATGG + Intergenic
1201252271 Y:12071405-12071427 CAAAAGTCAAAATGGGCAAATGG - Intergenic
1201765831 Y:17572886-17572908 GACTAGGCATCATGGGCATTTGG - Intergenic
1201835721 Y:18333103-18333125 GACTAGGCATCATGGGCATTTGG + Intergenic