ID: 1098466656

View in Genome Browser
Species Human (GRCh38)
Location 12:70794778-70794800
Sequence GTGGCTATGTCAAGGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098466656_1098466663 26 Left 1098466656 12:70794778-70794800 CCTGGAAACCTTGACATAGCCAC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1098466663 12:70794827-70794849 TATGGCAATTTCCTATGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 80
1098466656_1098466660 8 Left 1098466656 12:70794778-70794800 CCTGGAAACCTTGACATAGCCAC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1098466660 12:70794809-70794831 ACTACCACTGCCAACAACTATGG 0: 1
1: 0
2: 2
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098466656 Original CRISPR GTGGCTATGTCAAGGTTTCC AGG (reversed) Intronic
905413850 1:37791556-37791578 GTGGCAGTGTCAAGGACTCCAGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906644717 1:47466113-47466135 CTGGTCATGTCAAGCTTTCCTGG + Intergenic
906797867 1:48711924-48711946 GTTGCTGTGGAAAGGTTTCCAGG - Intronic
911260174 1:95676778-95676800 GTGGATATTTCAAAGATTCCAGG + Intergenic
914684081 1:149962600-149962622 GTGGGTATTTCTGGGTTTCCTGG + Intronic
915125606 1:153661467-153661489 CTGGCTGTGTGTAGGTTTCCTGG - Exonic
916293725 1:163193784-163193806 AAGGGTATGTCAGGGTTTCCAGG - Intronic
917591567 1:176481457-176481479 GTGGCCAGGGCAAGGTTTCCAGG + Intronic
918428706 1:184436531-184436553 GTTGCTATGTCAAGGGCTCCTGG - Intronic
919539808 1:198832243-198832265 GAGGCTAGGTCAAGGATTCAGGG - Intergenic
919900693 1:202042357-202042379 GGGGCTCGGTGAAGGTTTCCTGG - Intergenic
920142166 1:203824374-203824396 GTGGCTATGGGAAGGTGTCAGGG + Intronic
921019995 1:211226602-211226624 GTGGCTATCTCACTGTATCCAGG - Intergenic
1062988655 10:1794694-1794716 ATGGCTATGTCTAGCTTTCTTGG - Intergenic
1064332517 10:14407062-14407084 GTGGCTAAGTCATGTTATCCAGG + Intronic
1064748951 10:18506296-18506318 GTGGCTATTTCAAGTACTCCAGG + Intronic
1065320555 10:24505164-24505186 CTGGCTATCTCAACATTTCCAGG - Intronic
1068192432 10:53668721-53668743 GTTGCTCTGTCAAGGATTTCCGG - Intergenic
1069584367 10:69587946-69587968 GTTGCTAGGCCATGGTTTCCTGG - Intergenic
1070727178 10:78800372-78800394 GAGGCTATATCCAGGTTTCAAGG + Intergenic
1072903224 10:99427977-99427999 GTGCCTTTGTCATGTTTTCCAGG - Intronic
1076203314 10:128575077-128575099 GTTGCTATGTCATCGTTTCAGGG - Intergenic
1086643613 11:89191283-89191305 CTGGATTTGTCATGGTTTCCAGG - Exonic
1090031749 11:123212218-123212240 CTGGCTATTTCATGGTCTCCTGG + Intergenic
1091165045 11:133468174-133468196 ATGGCAATGGCACGGTTTCCAGG + Intronic
1093587485 12:20857901-20857923 GGGGCTTTGTGAAAGTTTCCTGG - Intronic
1097049713 12:56214980-56215002 GTGGTTTTGACAAGTTTTCCAGG + Intronic
1098466656 12:70794778-70794800 GTGGCTATGTCAAGGTTTCCAGG - Intronic
1099886662 12:88539325-88539347 GTGCCTATGTCAACTTTTCTGGG + Intronic
1100252145 12:92837728-92837750 GTGTTAATGTCAAGGTTTTCAGG - Intronic
1110425054 13:75357605-75357627 GAGGCAATGGCAATGTTTCCAGG + Intronic
1110443766 13:75553694-75553716 GTGGCAATGTTAGGGTTTCAAGG - Intronic
1113706440 13:112436294-112436316 ATTGCTCTGCCAAGGTTTCCTGG - Intergenic
1119699285 14:76742142-76742164 GAGGCTATGGTAAAGTTTCCTGG + Intergenic
1119753485 14:77097951-77097973 GCGGCTTGGGCAAGGTTTCCAGG - Intergenic
1124707111 15:31975276-31975298 GTATCTTTGGCAAGGTTTCCTGG - Intergenic
1127721580 15:61706611-61706633 GTGGGTATTTAAATGTTTCCAGG - Intergenic
1134580030 16:15362712-15362734 CTGGCTATGTCAGGGTGCCCAGG - Intergenic
1137895324 16:52205720-52205742 AGGGTTTTGTCAAGGTTTCCTGG - Intergenic
1138814169 16:60185276-60185298 GTGGTTATGTGAAGGTATGCAGG + Intergenic
1140311418 16:73852218-73852240 GTGGCTTTGTCATGATTTTCTGG - Intergenic
1140434535 16:74935251-74935273 GTGACTATGTCTGGATTTCCAGG + Intronic
1142221970 16:88859859-88859881 GTGGCAAGGTCATGGTTTGCTGG + Intronic
1143327795 17:6110821-6110843 GTGGCTTTGTCAAGCTTCCCAGG + Exonic
1153724786 18:7943471-7943493 GTGGCTTTTTGAAGGTGTCCAGG - Intronic
1154145905 18:11866034-11866056 GTGGCCATGTGAAGGGTTCTTGG - Intronic
1155926176 18:31658012-31658034 GTGAGTATGTGAAGTTTTCCGGG + Exonic
1157220868 18:45827729-45827751 GTGACTTTGGCAAGGTTTCATGG - Intronic
925475865 2:4214291-4214313 GTGGCTATGTCAATGATGGCAGG + Intergenic
927495729 2:23550322-23550344 TGGGCTACGTCATGGTTTCCTGG + Intronic
928863823 2:35894579-35894601 TTGGTTAGGTCATGGTTTCCTGG + Intergenic
929051039 2:37837052-37837074 GTGGCAATTCCTAGGTTTCCTGG - Intergenic
933019602 2:77174297-77174319 GTGGCTCTTTTAAGGTTGCCAGG - Intronic
935644804 2:105325398-105325420 GTGGCTTGCTCAAGGTTACCTGG + Intronic
942308736 2:174634478-174634500 GTGGCTACGAAAAGTTTTCCAGG + Intronic
942444666 2:176070165-176070187 GTGACTACCTCAAGGTGTCCAGG - Intergenic
1169053101 20:2597074-2597096 CTGGCTAGGCCAAGGTTCCCTGG + Intronic
1169974817 20:11312607-11312629 GTGGATTTGGCAAGGTTTCCTGG - Intergenic
1170621563 20:18000745-18000767 GTCTGTAAGTCAAGGTTTCCTGG + Intronic
1174270538 20:49365129-49365151 GTGGATATGTCAGAGTTTCTTGG + Exonic
1182359051 22:29735964-29735986 GGGGCTGTGACAAGGTTTCATGG - Intronic
954856712 3:53650081-53650103 GAGGCTCTGCCTAGGTTTCCTGG + Intronic
961492889 3:127267451-127267473 GGGGCAATGGCAAGGTTTCTGGG + Intergenic
963090104 3:141476118-141476140 TTGGCCATCTCAAGGTTTCTTGG - Intergenic
963537147 3:146543586-146543608 GTGGCCATGCCAAGACTTCCAGG + Intronic
964096092 3:152933433-152933455 GTGGCTTTGTCTTGGTTCCCTGG - Intergenic
967097358 3:186187932-186187954 CTGCCAATGTCAAGGTTACCAGG - Intronic
967764486 3:193263283-193263305 TTGGCTATGATAAGGTTCCCAGG + Intronic
969546378 4:7831976-7831998 GGGTCTAAGTCAGGGTTTCCTGG - Intronic
969630155 4:8331191-8331213 TTGGTTCTGACAAGGTTTCCAGG - Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
972707981 4:41564324-41564346 GAGGCTATTTCAGGTTTTCCTGG + Intronic
975818447 4:78244334-78244356 GTGGATAAGTCATGATTTCCTGG + Intronic
976176215 4:82355370-82355392 GTGGTTATGGGAAGGTATCCAGG - Exonic
978194605 4:105956416-105956438 GTGTTGATGTAAAGGTTTCCTGG - Intronic
981028419 4:140099528-140099550 GTGGGTAAGGCAAGGTTTCATGG + Intronic
993865020 5:93183902-93183924 GTGGCTGAATCAAGATTTCCAGG - Intergenic
999099071 5:149007349-149007371 GAGGATGGGTCAAGGTTTCCTGG + Intronic
1003997021 6:11551989-11552011 GTGAATCTGTCATGGTTTCCAGG + Intronic
1005165715 6:22917943-22917965 GTGGCTATGACCAGGTTTTTGGG + Intergenic
1005510260 6:26506204-26506226 AGGGCTCTGTCTAGGTTTCCAGG + Intronic
1006469508 6:34219573-34219595 GTGGCTATGTAAGAGTGTCCAGG - Intergenic
1007938034 6:45751222-45751244 GTGGATTTATTAAGGTTTCCAGG - Intergenic
1010617746 6:78033336-78033358 GTGGGTATGCAAAGATTTCCTGG - Intergenic
1011860168 6:91745182-91745204 ATGGCTATATCAAGTTTTGCAGG + Intergenic
1012191388 6:96284577-96284599 CTGAGTATATCAAGGTTTCCTGG - Intergenic
1013458570 6:110355215-110355237 GTTGCTATGGGAAGGTTTCTGGG + Intronic
1014294479 6:119601890-119601912 GTGGCTATGAGAAGGTATCAGGG - Intergenic
1014844754 6:126261834-126261856 GAGGCTCTGTCAGGCTTTCCAGG + Intergenic
1014876243 6:126663958-126663980 GTGGCAATGTTAATGTTTCATGG - Intergenic
1016365319 6:143310015-143310037 GTGGATATGCCTATGTTTCCTGG - Intronic
1017754977 6:157521739-157521761 GAGGCTATGACATGGTTTCCTGG + Intronic
1021633042 7:22665277-22665299 GTGGCCACTTCCAGGTTTCCCGG - Intergenic
1022430397 7:30313828-30313850 GTGGCCATTTCGAGGTTCCCTGG + Intronic
1023533729 7:41186085-41186107 GTGGCTATGTCACAATTTCCTGG - Intergenic
1023634225 7:42193693-42193715 GTGGTTTTCTCATGGTTTCCTGG + Intronic
1029735616 7:102464459-102464481 GAGGCTACGTCGAGGTTTACAGG + Intronic
1032526935 7:132585313-132585335 GTTGCTATCTAAATGTTTCCTGG - Intronic
1032751636 7:134847274-134847296 AGGACTTTGTCAAGGTTTCCAGG - Intronic
1032766527 7:134999361-134999383 GTGGCTATGGGCAGATTTCCTGG - Intronic
1039350343 8:36757345-36757367 GTGGCTCTTCCATGGTTTCCTGG + Intergenic
1044504034 8:92995888-92995910 GTAGCTATGTCAGGTTTCCCGGG + Intronic
1048064142 8:130950473-130950495 GTGGCTGTGTCAGGGTTTGGGGG + Intronic
1055827161 9:80340276-80340298 TTGGCGATGTCATGTTTTCCTGG - Intergenic
1056777038 9:89520663-89520685 GTGTCTATGAGAACGTTTCCAGG - Intergenic
1057454169 9:95192251-95192273 GTTGCTATGTGAAGGTGACCTGG + Intronic
1057918064 9:99072666-99072688 GTGGCCACGTCCAGGTTGCCAGG - Intergenic
1061606849 9:131717204-131717226 GTGGCTCTGTCAAGTTTATCTGG - Intronic
1185697136 X:2203686-2203708 GTGACTTTGTCAAGCTTTTCCGG - Intergenic
1190322433 X:49186860-49186882 GTGGCTAGGGCCAGGTTCCCAGG - Intergenic
1192925389 X:75750033-75750055 GTTGCTATGGCAATGTGTCCAGG - Intergenic
1193307615 X:79968078-79968100 GTGGCCATGTGAAGATGTCCAGG - Intergenic
1196587225 X:117443850-117443872 GTGGCTATGCCAAGCTTTGGTGG - Intergenic
1198656272 X:138916853-138916875 GTGGCACAGTCAAGGTGTCCCGG + Intronic