ID: 1098467303

View in Genome Browser
Species Human (GRCh38)
Location 12:70801956-70801978
Sequence GGGTAAAAACAGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098467300_1098467303 -10 Left 1098467300 12:70801943-70801965 CCTATAGATAGGAGGGTAAAAAC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 211
1098467292_1098467303 25 Left 1098467292 12:70801908-70801930 CCCACATCCTCCTTACAGAAGGT 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 211
1098467293_1098467303 24 Left 1098467293 12:70801909-70801931 CCACATCCTCCTTACAGAAGGTT 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 211
1098467296_1098467303 15 Left 1098467296 12:70801918-70801940 CCTTACAGAAGGTTTTGGCTTTC 0: 1
1: 0
2: 2
3: 18
4: 161
Right 1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 211
1098467295_1098467303 18 Left 1098467295 12:70801915-70801937 CCTCCTTACAGAAGGTTTTGGCT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098467303 Original CRISPR GGGTAAAAACAGATGGTGCA GGG Intronic
900733874 1:4282491-4282513 GGGGAAAAACAGATGCTGTGTGG - Intergenic
901813535 1:11780966-11780988 GGGCAAAAAGAGCTGTTGCATGG + Intronic
904299425 1:29544493-29544515 GGGCAGAAACAGAGGCTGCAAGG - Intergenic
906857687 1:49326118-49326140 GGGTAAAGACAAATGATCCAAGG - Intronic
907664801 1:56425318-56425340 AGCTAAAAGTAGATGGTGCATGG + Intergenic
912155946 1:106920072-106920094 GTGGAAAAACAGGTGGTGGAAGG + Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912753619 1:112306104-112306126 AGATAAGAACAGAGGGTGCAGGG + Intergenic
912901689 1:113657433-113657455 TGGTAAAAAGAATTGGTGCATGG - Intronic
922330732 1:224573335-224573357 GGCTTAAAACACAAGGTGCAAGG + Intronic
924135012 1:240956744-240956766 AGGTAAAAAGAGATGGTAAAAGG + Intronic
924185232 1:241481827-241481849 GAGTAAATAGAGATGCTGCAGGG + Intergenic
924277954 1:242407175-242407197 AGGTAAAAAAAGCTTGTGCAGGG - Intronic
924576254 1:245283415-245283437 AGAAAAAAACAGATGGTGAAAGG - Intronic
1063614693 10:7591586-7591608 AGGAAAAAACAGCAGGTGCAAGG - Intronic
1065777472 10:29134269-29134291 GGGTAAAATAAAATGATGCATGG - Intergenic
1066356320 10:34687579-34687601 GGCAAGAAACAGATAGTGCAAGG + Intronic
1070001639 10:72382536-72382558 GAGTTAGAACAGAAGGTGCAGGG + Intronic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1074995969 10:118757510-118757532 GGGTAAAAACCCTTGGAGCAGGG - Intergenic
1077083784 11:737267-737289 GGGGAAAAAAAGATGGAGCCGGG - Intergenic
1078754906 11:14199983-14200005 GTGTAAAAACGCATGGGGCATGG - Intronic
1080514719 11:33009634-33009656 GGGAAAAAAAAAATGATGCAGGG + Intergenic
1080654861 11:34250989-34251011 GGGTAAAAACACATGTTTGATGG - Intronic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1081718407 11:45267878-45267900 GGATAACAAAAGATGGTACAAGG - Intronic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1085350272 11:75793675-75793697 GGGGACAAAAAGATGCTGCACGG + Intronic
1086320250 11:85638780-85638802 GGGGAAAATCACATGGTGAAGGG - Intergenic
1087239968 11:95763671-95763693 GGGTCACAACAGAAGGTGAATGG + Intergenic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1087949766 11:104206612-104206634 GGGTAAAGAAAAATGGTTCAAGG + Intergenic
1088560651 11:111112455-111112477 GGGTAAAAAGAGAAGGTGGGTGG + Intergenic
1088729289 11:112666667-112666689 GGGTGAAAACAGAAGCTGAAAGG + Intergenic
1089236081 11:117026944-117026966 GGGTAAAAACATATTATTCAAGG + Intronic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1091998669 12:5015827-5015849 GGGCAAAAACTGATATTGCAAGG - Intergenic
1092162940 12:6325971-6325993 GGGTAAAAATATCTGGTTCATGG + Intronic
1093414174 12:18901319-18901341 TGTTAAAAACAGTTGGGGCAAGG + Intergenic
1094153494 12:27312580-27312602 TGGTAGAAGCAGATGGTGCCTGG + Exonic
1095516310 12:43009836-43009858 TGGTAAAAACAGATTTAGCATGG - Intergenic
1095878287 12:47105426-47105448 GCATAAATACAGATGGTGAAGGG + Intronic
1096657826 12:53102732-53102754 AGGTAAAATCACATGGTTCAGGG - Intergenic
1098171402 12:67750828-67750850 GGTTACAAACAGATGGTAGATGG + Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100122628 12:91386411-91386433 GAGTAAAATCAGGTGGGGCATGG + Intergenic
1100662446 12:96714844-96714866 GGGAAAATAATGATGGTGCAAGG + Intronic
1102391564 12:112553015-112553037 AGGTAAAAGGTGATGGTGCATGG - Intergenic
1102588711 12:113941561-113941583 GGATGAATACAGATGATGCATGG - Intronic
1102674859 12:114650505-114650527 GGGTAAAAACAGAGGACCCAAGG + Intergenic
1102743932 12:115233151-115233173 TTCTAAAAACAGATGGTACAGGG + Intergenic
1106019354 13:25899880-25899902 GGGAAAAAATAGGTGGTACAGGG + Intronic
1108907336 13:55494414-55494436 CAGTAAAAACAAGTGGTGCATGG - Intergenic
1110064876 13:71091118-71091140 GGAGAGAAACAGATGGTGAAAGG + Intergenic
1111105649 13:83642420-83642442 GGGTAAATACAGATATTCCAAGG + Intergenic
1111628450 13:90818667-90818689 AGGAAAAAACAGATGCTGCAGGG + Intergenic
1111977272 13:94979612-94979634 GAGCAAAAACAGAAGGTGTAAGG + Intergenic
1113216387 13:108045592-108045614 AGATAAAAACAGAGGGTGGAAGG - Intergenic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1116602589 14:46945776-46945798 GAATAAAAACAGACAGTGCAAGG - Intronic
1117754348 14:58958630-58958652 GGCTGAAACCAGATGGTCCAAGG - Intergenic
1118230217 14:63940723-63940745 GGGTCAAAACAGAAGGAGTAGGG - Intronic
1120625926 14:86826432-86826454 AAGGAAAAACTGATGGTGCAGGG + Intergenic
1120839419 14:89071143-89071165 GGGTAGAGGCAGTTGGTGCATGG + Intergenic
1121659360 14:95623502-95623524 CAGAAAAAGCAGATGGTGCAGGG + Intergenic
1126354642 15:47782477-47782499 TGGAAACAACAGATGGTGCATGG + Intergenic
1130302831 15:82693101-82693123 GGTTAAAAACAGAAGGTCAAAGG + Intronic
1130929678 15:88414718-88414740 GAGCAAAAACAGATGATACAAGG + Intergenic
1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG + Intronic
1136670190 16:31849664-31849686 AGGTAAAAATAAATGGTGTAAGG + Intergenic
1137638290 16:50006566-50006588 GGGGAAATACAGGGGGTGCAGGG + Intergenic
1137645297 16:50067960-50067982 GGGTACAAACAAAGGGTTCAGGG + Intronic
1137771454 16:51019124-51019146 GTGTTAAAACAGGAGGTGCATGG + Intergenic
1143794042 17:9321910-9321932 GGATAAGAAGAGATGGGGCAGGG + Intronic
1143806950 17:9436789-9436811 GGGCAAGAACAGATGGTGGGAGG - Intronic
1149025337 17:52020794-52020816 GGGTAAAGAAGGATGGGGCAAGG - Intronic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1155382902 18:25244188-25244210 GAGTAAAAACTGCTGGTGTATGG - Intronic
1155549982 18:26954478-26954500 GGAAAGAAGCAGATGGTGCAAGG - Intronic
1157350097 18:46876328-46876350 GTGCAAAATCAGATAGTGCAGGG + Intronic
1159568086 18:70078907-70078929 GGGTCAAAAGATATGATGCATGG + Intronic
1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG + Intergenic
1160027430 18:75229845-75229867 GGGCAAAGAAAGATGGTGAAAGG + Intronic
1160108694 18:76004721-76004743 GGGAAACAAGAGAGGGTGCAAGG - Intergenic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1163026752 19:14517352-14517374 GGCTAAAGACACATGGTCCAGGG + Intronic
1163484991 19:17580265-17580287 GGGAAAAAAGAGATGGAGGAAGG - Intronic
1164136910 19:22424577-22424599 GGGTGAAAACAATTGGTTCAGGG - Intronic
1164138160 19:22433049-22433071 GAGTAAAAACAATTGGTTCAGGG + Intronic
1164161994 19:22633185-22633207 GGGTGAAAACAATTGGTTCAGGG + Intergenic
1165374336 19:35431249-35431271 GAGGGAAAACACATGGTGCAGGG - Intergenic
1166740732 19:45113380-45113402 GGATAAAACCAGCTGATGCACGG - Intronic
925663067 2:6223169-6223191 GGGGAAAAAGAGAAGGTGTATGG - Intergenic
926584695 2:14673338-14673360 GGCTAAAAACAGATGGTCACGGG - Intergenic
927020367 2:19010441-19010463 TGGTACAAAGAGATGCTGCAGGG - Intergenic
927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG + Intronic
928025887 2:27738268-27738290 GGGAAAAAAAAGAGGGTGCTGGG - Intergenic
929049670 2:37825408-37825430 GTTGAAAAACAGATGGTCCAGGG + Intergenic
930051702 2:47221056-47221078 GGGTAAAAATGGAAGCTGCAAGG - Intergenic
930351142 2:50256273-50256295 GGGTAAAAACGTTTGGTACATGG - Intronic
931368490 2:61640274-61640296 GTGTAAAAACAGAAGGTGTTGGG + Intergenic
931471866 2:62546183-62546205 GAGTAAGAAGAGATGGTGCCTGG + Intergenic
935067705 2:99665126-99665148 GGACAAAGCCAGATGGTGCAGGG + Intronic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
940353022 2:152709737-152709759 GGTTAAAAACAGGTTGGGCAAGG + Intronic
942507104 2:176654785-176654807 GGGTAACAACTCATGGGGCAAGG - Intergenic
943792188 2:191945651-191945673 GAGGAACAACAGGTGGTGCAGGG + Intergenic
945234396 2:207621415-207621437 GGGTTAAATCAGATAGTGTATGG + Intronic
946890141 2:224267046-224267068 GGGGAAAAAGAGATGGAGAAAGG - Intergenic
947839977 2:233201582-233201604 GGGGAAACACTGATGGTGCTTGG - Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1170317830 20:15061704-15061726 GGGTAAAAAGAGAAGGGGAAGGG + Intronic
1170415129 20:16131456-16131478 GGGTAAAGACAGATTTTTCAGGG - Intergenic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1177131259 21:17258841-17258863 GGATAAAAACAAATTGTGCATGG + Intergenic
1178630877 21:34260408-34260430 GACTAGAAACAGAAGGTGCAAGG - Intergenic
1179215407 21:39362984-39363006 GGCTAGAAACATATGCTGCACGG - Intergenic
1181068606 22:20319061-20319083 AGGTGGAAACTGATGGTGCAGGG + Intronic
1182336243 22:29585420-29585442 GGGTGAAAAAAGGTGGTGCTGGG + Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1185082791 22:48718944-48718966 GGGGACAGACAGATGGTGGAGGG - Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
951234354 3:20217361-20217383 AGGTAAAAAGAAATGGTGCAGGG + Intergenic
953187104 3:40648267-40648289 GTGTAAAACCAGATGGTGCTTGG + Intergenic
953791654 3:45952154-45952176 GTGTAAGAGCAGCTGGTGCAAGG + Intronic
953808286 3:46090523-46090545 TGCTAAAAACAGCTGGTGAAGGG + Intergenic
955126330 3:56115993-56116015 GGGAAAGAAGAGATGGGGCAGGG - Intronic
958024920 3:88039348-88039370 GGGTAGAAACAGTGTGTGCAGGG + Intergenic
961004819 3:123397870-123397892 GGGTGAAAACAGACAGTGAAGGG + Intronic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
961818237 3:129562096-129562118 GGGTACAAAGAGAAGGTGCCAGG + Intronic
963173546 3:142275617-142275639 GGGAACACACAGATGGTGAATGG - Intergenic
964157662 3:153605155-153605177 GGGTAAAAAGAAATGGTAAACGG - Intergenic
966619981 3:181953070-181953092 GGGTAAGAACAGATAGCACAGGG + Intergenic
970245481 4:14057344-14057366 AGGAAACAACAGATGGTGGAGGG - Intergenic
971432045 4:26578468-26578490 AGATAAAAAAAGATGGTGAAAGG + Intronic
972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG + Intronic
973113395 4:46423972-46423994 AATTAAAAACAGATAGTGCAGGG - Intronic
973147763 4:46849203-46849225 GGGGAGAAACTGATGGCGCAAGG - Intronic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
974210560 4:58768665-58768687 GCGCAAAAACAAATAGTGCATGG + Intergenic
975853301 4:78595808-78595830 TGGTGAGAACAGATGGGGCACGG + Exonic
976782219 4:88773627-88773649 GGGTAAAAAGAAAGGGTCCAAGG - Intronic
977776523 4:100927359-100927381 AGGGAAAAACAGATGGTTTAAGG - Intergenic
978914574 4:114108794-114108816 GGGTAAAAAAAGATAATTCAGGG - Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
981815768 4:148829403-148829425 GGAAGAAAACAGATGGGGCATGG + Intergenic
982754152 4:159198739-159198761 GGGTAAAAACAGAAGAGGCCAGG - Intronic
985012218 4:185594868-185594890 GGGTAAAATCAGAATTTGCATGG + Intronic
986595398 5:9416539-9416561 GGGTACAAGCAGTTGGTGTAAGG + Intronic
987275635 5:16359496-16359518 TGGAAACAACAGATGCTGCAAGG + Intergenic
987750649 5:22034443-22034465 AGGAAAAAACATATGATGCACGG + Intronic
987773453 5:22335626-22335648 AGGCAAAAAGAGATTGTGCAGGG - Intronic
994046189 5:95313081-95313103 AGGTAGGAATAGATGGTGCAAGG - Intergenic
994128625 5:96198225-96198247 AGGTAAAACCAGATTGAGCATGG - Intergenic
994784339 5:104136863-104136885 GGCAAGAAACAGATGGTGCATGG - Intergenic
995502337 5:112821162-112821184 GGTTAAAAGCACATGGTGCTAGG - Intronic
995747344 5:115417783-115417805 GGTTAAAAACAGATGGGGACTGG - Intergenic
999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG + Intergenic
1000292449 5:159883149-159883171 GGGGAAAAAGAGAAGGAGCAAGG - Intergenic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1001098628 5:168795939-168795961 GAGTAAAAAGAGATGGACCATGG + Intronic
1001313563 5:170627664-170627686 GGCTCAAAACAGATCTTGCAAGG - Intronic
1002655442 5:180743037-180743059 GGGGATCATCAGATGGTGCAAGG - Intergenic
1002871606 6:1171291-1171313 AGGTAAAAGCAAATGGTGCCAGG - Intergenic
1005602243 6:27439236-27439258 GGGAAACTACAGATAGTGCAGGG - Intergenic
1006912404 6:37571934-37571956 CGGTGAGCACAGATGGTGCAAGG - Intergenic
1006959827 6:37917377-37917399 GGGTAAAAACAGTTGCTACAGGG - Intronic
1007051436 6:38835089-38835111 GTGTAGAAAAAGATGGTGAATGG - Intronic
1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG + Intergenic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1010950716 6:82033902-82033924 TGAGAAAAACAGACGGTGCAAGG + Intergenic
1011073172 6:83408135-83408157 GGATAAAATCAGATGATGAATGG + Intronic
1011377199 6:86701744-86701766 GAGAAACAACAGATGCTGCAAGG - Intergenic
1011671670 6:89689307-89689329 AGGTATAAACAAATGGTGTAGGG + Intronic
1012129100 6:95468802-95468824 GGTAAAACACAGATGCTGCATGG + Intergenic
1012311664 6:97733039-97733061 GGGTGAAAAATGATGTTGCATGG - Intergenic
1012491094 6:99783175-99783197 GAGGAAAAAGAGATAGTGCAGGG + Intergenic
1012544689 6:100404608-100404630 TGGGAAGAACAGATGGTGAAAGG + Intronic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1016019513 6:139220965-139220987 GGGTAGAATCAGTTGTTGCAGGG + Intergenic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1023351396 7:39323498-39323520 AGGTAGAAGCTGATGGTGCATGG - Intronic
1025943670 7:66090687-66090709 GGGTAAAGACAGCTGGAGCCAGG - Intronic
1028418004 7:90599599-90599621 GGGTATAAACAGAAATTGCAAGG - Intronic
1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG + Intergenic
1029274452 7:99395932-99395954 GGGTAAAAACGGCTCGAGCACGG + Exonic
1030746261 7:113170313-113170335 GGGTAAACAGAGAAGTTGCATGG - Intergenic
1030883506 7:114911349-114911371 GGATAAAAAGAGATGGACCAAGG + Intergenic
1032728764 7:134616784-134616806 AGGGAAAAACTGATGATGCAGGG + Intergenic
1034879611 7:154753214-154753236 GGGAATAAACGGGTGGTGCATGG + Intronic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1039913922 8:41845770-41845792 GGAGAAAAACAGATGGAGAAGGG - Intronic
1040097495 8:43460141-43460163 GGGTGAAAAAAGTTGGTGCAAGG - Intergenic
1041389641 8:57337265-57337287 GGTTAAATAATGATGGTGCATGG - Intergenic
1043159481 8:76827809-76827831 GGGTAAAAACAGACAGGGCAGGG + Intronic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1044802556 8:95972272-95972294 GGCTGAAGACAGATGGTGCTGGG - Intergenic
1046075954 8:109311902-109311924 GGGGAACAACAGATGGTGTTTGG - Intronic
1046557831 8:115797398-115797420 GGGAAAAAAAAGACAGTGCATGG - Intronic
1046678348 8:117137976-117137998 GGGTAAAAAAATATGGTTCATGG - Intronic
1047263890 8:123287340-123287362 GGTTAAAAACAGATGGGGCCGGG - Intergenic
1047585014 8:126261997-126262019 GAGGAAAAACAGACGATGCAGGG - Intergenic
1048033536 8:130655167-130655189 GGGTAAAAGGAGTTGGTGGAAGG + Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1050159903 9:2707527-2707549 GAGTAAGAACATATGGTGTATGG - Intergenic
1051431071 9:16981044-16981066 GGGTAGAGTCAGATGGTGTAGGG - Intergenic
1055494713 9:76842818-76842840 AGGTAACAACAGATGCTGGAGGG + Intronic
1055795665 9:79972485-79972507 GGGCAAGGACAGATGGTGCCAGG + Intergenic
1060173119 9:121477925-121477947 GGGAAAATACAGGTGTTGCAGGG - Intergenic
1060449261 9:123721703-123721725 AGGTAAAGACAGCTGGTACAGGG - Intronic
1061621308 9:131812968-131812990 GGGGAAAAGCAGCTGGTACAGGG - Intergenic
1061887641 9:133600603-133600625 GGGTAAAACCAGAGGGTAAAAGG + Intergenic
1062025293 9:134337470-134337492 GGGTTAAAACATCTGGTCCAAGG - Intronic
1062648090 9:137560349-137560371 AGGAAAAAACAGGTGGGGCAAGG + Intronic
1186023596 X:5284098-5284120 GAATAAAGACAGATTGTGCAGGG - Intergenic
1187215689 X:17274242-17274264 GGGTAACTACAGGAGGTGCATGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188666765 X:32832676-32832698 GTGTAAAAGCACATGCTGCAGGG - Intronic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1191760211 X:64638849-64638871 AGGTAAAAAGAGCTTGTGCAGGG + Intergenic
1192555212 X:72083872-72083894 GAGTAGAGACAGATCGTGCAGGG - Intergenic
1192845841 X:74906472-74906494 GCTTAAAAACACATGGTGGAGGG - Intronic
1193279247 X:79627666-79627688 AGGCAAAAAGAGATTGTGCAGGG - Intergenic
1193975115 X:88108862-88108884 GGGTAAGAACAAATGGGCCAGGG + Intergenic
1194441109 X:93935536-93935558 GGATAAAAAGAGATGGTTAATGG + Intergenic
1195018617 X:100802758-100802780 GGGGAAAAAAAGATGATGAAGGG + Intergenic
1196002937 X:110806119-110806141 GGGTTAAAAAAGATGGTGTGTGG + Intergenic