ID: 1098486757

View in Genome Browser
Species Human (GRCh38)
Location 12:71030422-71030444
Sequence CTGGGTGAGTGACACGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098486749_1098486757 23 Left 1098486749 12:71030376-71030398 CCTCATCTGAGAGTCATATGTTT No data
Right 1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098486757 Original CRISPR CTGGGTGAGTGACACGTGGA AGG Intergenic
No off target data available for this crispr