ID: 1098487598

View in Genome Browser
Species Human (GRCh38)
Location 12:71039750-71039772
Sequence CTCAAAAGGAGCCCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098487598_1098487601 3 Left 1098487598 12:71039750-71039772 CCAGACACAGGGCTCCTTTTGAG No data
Right 1098487601 12:71039776-71039798 TGAGCCCCATAGGCTTGCATCGG No data
1098487598_1098487600 -7 Left 1098487598 12:71039750-71039772 CCAGACACAGGGCTCCTTTTGAG No data
Right 1098487600 12:71039766-71039788 TTTTGAGAGTTGAGCCCCATAGG No data
1098487598_1098487606 23 Left 1098487598 12:71039750-71039772 CCAGACACAGGGCTCCTTTTGAG No data
Right 1098487606 12:71039796-71039818 CGGTCCATGCCCTTGAAGCTGGG No data
1098487598_1098487605 22 Left 1098487598 12:71039750-71039772 CCAGACACAGGGCTCCTTTTGAG No data
Right 1098487605 12:71039795-71039817 TCGGTCCATGCCCTTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098487598 Original CRISPR CTCAAAAGGAGCCCTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr