ID: 1098493098

View in Genome Browser
Species Human (GRCh38)
Location 12:71105085-71105107
Sequence GAGAAGCAAGTATTCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098493098_1098493103 -2 Left 1098493098 12:71105085-71105107 CCCTCTTGGAATACTTGCTTCTC 0: 1
1: 1
2: 4
3: 37
4: 286
Right 1098493103 12:71105106-71105128 TCGGTAGGATTTTGTAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 126
1098493098_1098493104 -1 Left 1098493098 12:71105085-71105107 CCCTCTTGGAATACTTGCTTCTC 0: 1
1: 1
2: 4
3: 37
4: 286
Right 1098493104 12:71105107-71105129 CGGTAGGATTTTGTAATTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 103
1098493098_1098493102 -3 Left 1098493098 12:71105085-71105107 CCCTCTTGGAATACTTGCTTCTC 0: 1
1: 1
2: 4
3: 37
4: 286
Right 1098493102 12:71105105-71105127 CTCGGTAGGATTTTGTAATTTGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098493098 Original CRISPR GAGAAGCAAGTATTCCAAGA GGG (reversed) Intronic
902256476 1:15192383-15192405 CTGGAGCAAGGATTCCAAGAAGG - Intronic
902859020 1:19231318-19231340 GAGAAGCAAGGACTGCAAGATGG + Exonic
904329285 1:29747428-29747450 GAGAGGCAAGGATCCAAAGATGG - Intergenic
904907046 1:33905388-33905410 GAGAAGGAAATAGTTCAAGAAGG + Intronic
905758284 1:40531210-40531232 GGGAAGGAAGTGTTTCAAGAAGG - Intergenic
907775494 1:57510295-57510317 GAGAAGAGAGCACTCCAAGAAGG - Intronic
908389003 1:63668618-63668640 CAAGAGCAAGTATGCCAAGAGGG + Intergenic
908855306 1:68420074-68420096 GAGAACCCAGGCTTCCAAGATGG + Intergenic
910555317 1:88525394-88525416 GCAAAGAAGGTATTCCAAGAAGG + Intergenic
911206586 1:95097538-95097560 GAAAAGGAGGTAGTCCAAGATGG + Intergenic
911254005 1:95613472-95613494 GAAAAGATAGTATTCCAGGAGGG - Intergenic
912480805 1:109980990-109981012 GAGAAGCAAGTGTGGCTAGAGGG - Intergenic
913079870 1:115373553-115373575 GAGGAGAAAGTATTTCAAGAAGG - Intergenic
917249752 1:173045353-173045375 GAAAAGAAAGTATTTCATGAAGG + Intronic
917317623 1:173741880-173741902 GAAAAGCAAGGCTTACAAGAAGG + Intronic
917478204 1:175386877-175386899 GAGAAGCAAGTTTACCCAGAAGG - Intronic
917768925 1:178254685-178254707 GAGAAGAAAGAATTCCAACAAGG - Intronic
919266048 1:195267357-195267379 AAGAAGCAAGTATTTAAAGTAGG + Intergenic
919377518 1:196813338-196813360 GTGAAGCAGGTATTTCAAAATGG + Intergenic
919447919 1:197732723-197732745 GAGAAGCAATTAGTCCAGGTTGG + Intronic
921791168 1:219292333-219292355 GAGAATCTAGGATTACAAGAGGG - Intergenic
922688290 1:227665147-227665169 GAGATGAAAGAATTACAAGAAGG + Intronic
924053347 1:240099662-240099684 ACGAATCATGTATTCCAAGAGGG - Intronic
924657377 1:245985146-245985168 GAAAAGCAGATATTCCAGGACGG - Intronic
924680489 1:246226785-246226807 GATATGCAAGTACTCCAAGAAGG + Intronic
1065064379 10:21945535-21945557 GAAAAGCCAGCATTCAAAGAGGG + Intronic
1065372919 10:25008524-25008546 AAGCAGAAAGTAGTCCAAGAAGG + Intronic
1066046434 10:31599513-31599535 GAGAAGAAAGAGTTTCAAGATGG + Intergenic
1069613460 10:69790953-69790975 GAGAACAAATTCTTCCAAGATGG - Intergenic
1070143322 10:73755221-73755243 GTGAAGAGAGTATTTCAAGAAGG + Intronic
1071396481 10:85228672-85228694 GAGAAGGAAGTGTTCATAGAAGG - Intergenic
1072480626 10:95807633-95807655 GAGAAGGATCCATTCCAAGATGG - Intronic
1075231171 10:120679733-120679755 GAGAAGGGAATATTCCCAGACGG + Intergenic
1076293233 10:129363796-129363818 GGGAAGAAAGTGTTACAAGAAGG - Intergenic
1078550764 11:12279167-12279189 GAGAAGAAAGTGTCTCAAGAGGG + Intronic
1079499018 11:21081224-21081246 GAGAAGAAAGTGTCTCAAGAAGG - Intronic
1079589762 11:22167849-22167871 GAGAAGAAAGTGTTTCAAGAAGG - Intergenic
1080043009 11:27778904-27778926 AAGAAACAAGAATTCCAAGCTGG - Intergenic
1081027581 11:38035070-38035092 GCGAAGCAGGTATTTCAAGAAGG + Intergenic
1081302519 11:41469784-41469806 GAGAAGCAACCTTTACAAGAAGG + Intergenic
1081613502 11:44577387-44577409 GAGGAGCAAGTCTTCCCTGAGGG - Intronic
1082189645 11:49227329-49227351 GTGAAGAAAGTATTTCAAGAAGG - Intergenic
1082872737 11:57958594-57958616 GAGAAGCAAGAAGTACAATATGG + Intergenic
1082965201 11:58959824-58959846 GACAAGCAAGGATACAAAGATGG + Intronic
1082971894 11:59031546-59031568 GATAAGCAAGAATTGGAAGAGGG - Intronic
1083187251 11:61024887-61024909 AAGAAGCAAGGAGCCCAAGAGGG - Intergenic
1083717747 11:64588081-64588103 GGGAAGAAAGTATTCTCAGATGG + Intergenic
1084920930 11:72469106-72469128 GATAACCAAATATTCCAAGCAGG + Intergenic
1086676880 11:89619171-89619193 GTGAAGAAAGTATTTTAAGAAGG + Intergenic
1087709924 11:101536586-101536608 GAGAAGAAAGCATTCCAGAAAGG + Intronic
1087943926 11:104135400-104135422 GAGAAGAGAGTAGTCCAAAATGG + Intronic
1089492128 11:118890428-118890450 GAGAAGAGAGAATTCCAAGAGGG + Intronic
1089762438 11:120738171-120738193 GAGAAGAAAGTATTTCAAGATGG + Intronic
1090126784 11:124094404-124094426 GATAAGCACGTTTCCCAAGAGGG + Intergenic
1090787347 11:130061557-130061579 CAGAAGAAATTATTCAAAGAAGG + Intergenic
1092074121 12:5659221-5659243 GAGGAGGAAGTATTTTAAGAGGG - Intronic
1092992183 12:13913409-13913431 GAGAACCAACTATGCCAAGAGGG + Intronic
1093197725 12:16148523-16148545 GAGAAGAAGGTATTTCAGGAAGG + Intergenic
1093790503 12:23244619-23244641 GAGAAGAAATTATTTAAAGATGG + Intergenic
1094413564 12:30193320-30193342 GAGAAGCAAGAATTTCATGCTGG + Intergenic
1094834269 12:34314917-34314939 AAGAAGCAAGAAGTCCCAGAAGG - Intergenic
1094836024 12:34322471-34322493 AAGCAGCAAGAAATCCAAGAAGG - Intergenic
1096726195 12:53565064-53565086 TAGAAGCAAGTATTGCAGTATGG - Intronic
1097395562 12:59069551-59069573 GAGACAGAAATATTCCAAGAAGG - Intergenic
1098339310 12:69435376-69435398 GTGAAGAAAGTATGCCAAGGAGG + Intergenic
1098493098 12:71105085-71105107 GAGAAGCAAGTATTCCAAGAGGG - Intronic
1098563488 12:71904189-71904211 GTGAAGAAAGTATTTCAAGAAGG + Intronic
1101668694 12:106845926-106845948 GTGAAGAAAGTATTTCAAGGAGG - Intronic
1101747303 12:107552755-107552777 GGGAAGGAAGCATTTCAAGAGGG - Intronic
1102426582 12:112848697-112848719 GAGAAGCAAGGCTTATAAGAAGG + Intronic
1102800942 12:115733192-115733214 GAAAAGCAATTATTCTTAGAAGG - Intergenic
1104707278 12:130956512-130956534 GAGAAGCAAGGTGTCCAAGGTGG - Intronic
1105661570 13:22501453-22501475 AAGAAGGAAGTATTCCAACTAGG + Intergenic
1107782329 13:43917020-43917042 GTGCAGCAAGTAGTCCAAGGAGG - Intergenic
1110264796 13:73525102-73525124 GAAAGGGAAGGATTCCAAGAAGG - Intergenic
1111128000 13:83936685-83936707 AAGAAGCAATTTTTCCATGAAGG + Intergenic
1112915474 13:104544670-104544692 GAAATTCAAGTATTTCAAGAGGG - Intergenic
1113586961 13:111472269-111472291 GAGAACCAAGGATTCTGAGATGG + Intergenic
1115896164 14:38090080-38090102 GAAAAGCAAGTATAACATGATGG + Intergenic
1117079186 14:52133771-52133793 GAGAAGGAAGTCTTCAAGGAGGG - Intergenic
1117590343 14:57261722-57261744 TAGAAGATAGTCTTCCAAGATGG + Intronic
1117593351 14:57299784-57299806 GAGAAGTAACTATTAAAAGATGG - Intergenic
1117875435 14:60247158-60247180 GAGTATTAAGGATTCCAAGAAGG + Intronic
1117925521 14:60775196-60775218 GAGAATAAAGTGTTCCCAGATGG + Intronic
1118437824 14:65787524-65787546 CAAAAGCAGGAATTCCAAGAAGG - Intergenic
1118742230 14:68747959-68747981 GAGAAGAAAGTATTTCTAGAAGG - Intergenic
1120180000 14:81333544-81333566 GGGAAGCCAGTATTCCAACCAGG + Intronic
1120703175 14:87721167-87721189 GATAAGCAGGTATCCAAAGAAGG + Intergenic
1120742860 14:88127537-88127559 GAAAAGCAAATATTCCAGAACGG + Intergenic
1121086825 14:91153062-91153084 CAGAAGCAAGTATTTCAAGGAGG - Intronic
1121591482 14:95115794-95115816 GAGAAACAAGTGTTCCAAGTCGG - Exonic
1121620573 14:95345114-95345136 GTGAAGGAAGTGTTTCAAGATGG + Intergenic
1122106327 14:99459421-99459443 GAGAAGCAAATAATCAAAAAAGG + Intronic
1122630517 14:103105610-103105632 GAGAAGGAGGTGTCCCAAGATGG - Intronic
1123156729 14:106234449-106234471 GAGAATCAAGTATGCAGAGAAGG + Intergenic
1123207502 14:106727550-106727572 GAGAATCAAGTATGCAGAGAAGG + Intergenic
1123887965 15:24746957-24746979 GTGAAGCAAGCATTCCTAAAGGG + Intergenic
1123888925 15:24756154-24756176 GAAAGGCAGGTATTCTAAGAGGG + Intergenic
1126838988 15:52697277-52697299 GAGAAGGCAGTATTGGAAGAAGG - Intronic
1127416800 15:58765813-58765835 GAGAAGTGAGTGTTCCAGGAAGG + Intergenic
1128990765 15:72258050-72258072 GAGCAGCATGTCTTCCAAAATGG - Exonic
1132051510 15:98611361-98611383 GAGAAGCATAAAGTCCAAGAGGG - Intergenic
1132459591 16:44648-44670 GAGAAGCTAGCTTTGCAAGAAGG + Intergenic
1132770158 16:1557637-1557659 TAGGAGCAATTATTCCCAGAGGG + Intronic
1132872116 16:2119911-2119933 GAGAAACAAGACCTCCAAGACGG + Intronic
1133726502 16:8542451-8542473 GATATGAAAGTTTTCCAAGATGG - Intergenic
1133821344 16:9239320-9239342 GAGAAGAAAGTGTTTTAAGAAGG - Intergenic
1134520409 16:14916985-14917007 GAGAAACAAGACCTCCAAGACGG - Intronic
1134551166 16:15138989-15139011 GAGAAACAAGACCTCCAAGACGG + Intronic
1134708083 16:16315636-16315658 GAGAAACAAGACCTCCAAGACGG - Intergenic
1134715296 16:16355669-16355691 GAGAAACAAGACCTCCAAGACGG - Intergenic
1134951519 16:18353009-18353031 GAGAAACAAGACCTCCAAGACGG + Intergenic
1134959461 16:18396490-18396512 GAGAAACAAGACCTCCAAGACGG + Intergenic
1137271416 16:46904752-46904774 GGGAAGCAAGGAGTCCTAGAAGG + Intronic
1138039790 16:53650763-53650785 GTGAAGAAAGTATTTGAAGAAGG - Intronic
1139198717 16:64950694-64950716 GAGAAGCATGTGTTTCAAGGAGG + Intronic
1141215057 16:82015929-82015951 AAGAAGGATGTATTCAAAGATGG + Intergenic
1144421740 17:15104912-15104934 GAGAAGCAAGTATTCATCCAGGG + Intergenic
1145737476 17:27243068-27243090 GAGAAGAAAGTATTCCAAGCAGG - Intergenic
1146408561 17:32561970-32561992 GAGAAGAAAATATGCCAAAATGG - Intronic
1146675172 17:34768311-34768333 GAGAAGCAATCGTTTCAAGAGGG - Intergenic
1149027195 17:52040787-52040809 AGGAAGGAACTATTCCAAGATGG + Intronic
1149220049 17:54406685-54406707 GAATAGTGAGTATTCCAAGATGG + Intergenic
1149259379 17:54862352-54862374 GAGTAGAAAGAATTCTAAGAAGG + Intergenic
1151237007 17:72727958-72727980 GAAAAGGAACTATTCCAAGAAGG - Intronic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1152120343 17:78414579-78414601 GAGAAGCAGGCTTTCCCAGAGGG - Intronic
1152341939 17:79730445-79730467 AAGAAGGAAGCATCCCAAGAAGG + Intergenic
1152341942 17:79730461-79730483 AAGAAGGAAGCATCCCAAGAAGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155033597 18:22005134-22005156 GAGAAGAAAGAGTTCCCAGAAGG + Intergenic
1155897339 18:31346584-31346606 GGGATGCAAGCATTCCAGGAGGG - Intronic
1156707993 18:39907170-39907192 GGAGAGCAAGCATTCCAAGATGG + Intergenic
1157711125 18:49850344-49850366 CAGAAGCGAGTATTCCATGGTGG + Intronic
1157815629 18:50727810-50727832 GGGAAACTAGCATTCCAAGAGGG - Intronic
1158363974 18:56709272-56709294 GAGAAGAAAGTATTGAAAAAGGG + Intronic
1159257513 18:65966293-65966315 GTGAAGAAAGTGTTTCAAGAAGG - Intergenic
1165590461 19:36964990-36965012 GACAAGCAAGTACTATAAGAGGG + Intronic
1166209765 19:41298789-41298811 GAGAAGCAATGCTGCCAAGACGG - Intronic
1168125874 19:54282520-54282542 GAGAAGCAAGGATTACAATATGG + Intergenic
1168176097 19:54629030-54629052 GAGAAGCAAGGATTACAATCTGG - Intronic
925145244 2:1578354-1578376 GTGGAGCAAGTCTTCCAAAAGGG - Intergenic
927282553 2:21322178-21322200 CAGAAGGAAGCACTCCAAGAGGG - Intergenic
927665666 2:25030862-25030884 GAGAAGCAATAATTGCAAAAAGG - Intergenic
927807717 2:26162543-26162565 GAGCAGCAAGTCTACCCAGAAGG - Intergenic
928152764 2:28847019-28847041 GAAAAGGGAGTATTCCATGATGG + Intronic
928641688 2:33305817-33305839 GAGAAGAAAGTGTTTCAAGGAGG + Intronic
929178721 2:39009398-39009420 GAAAAGCAAGTGATCCCAGATGG + Intronic
930225387 2:48787064-48787086 AAGAACAAAGTATTTCAAGAAGG - Intergenic
932858407 2:75263246-75263268 GAGAAGGAAGAATTTCAAGGAGG + Intergenic
935174492 2:100637984-100638006 GAGAAGAGAGTATTTCAAGAAGG + Intergenic
936877177 2:117204370-117204392 GAGAAGAAGGTATTCTAATATGG - Intergenic
937115022 2:119398795-119398817 GGAAAGCAAATATTCCCAGACGG - Intergenic
937748695 2:125447538-125447560 AAGCAGCAAATATTCAAAGAAGG + Intergenic
939325511 2:140683395-140683417 GATAACCCATTATTCCAAGATGG - Intronic
940204335 2:151186083-151186105 GAGAAGCTGGTATTTCAAAATGG + Intergenic
940263144 2:151806168-151806190 GAGATGAAAGTATTTCAAGAAGG - Intronic
940700931 2:157041927-157041949 GAAAAGCTAGGATTCCAAGAAGG + Intergenic
940810551 2:158237916-158237938 GGGAATCAAGTTTTCCAAGGAGG + Intronic
941290551 2:163668376-163668398 GAGAAGAAACTATTTGAAGAAGG + Intronic
941365455 2:164605599-164605621 GTCAAGAAAGTATTTCAAGAAGG + Intronic
941791951 2:169561594-169561616 GAAAAGAAAGTATTCCCAGATGG + Intronic
941869273 2:170366786-170366808 GAGAAGCAAGGCTTCCAACACGG - Intronic
942927756 2:181454577-181454599 GAGAAGAGAGTCTTCCTAGAAGG + Intergenic
944174240 2:196811921-196811943 CAGAAGAAAGTGTTTCAAGAAGG + Intergenic
947080304 2:226388531-226388553 GAGAAGAAAGTATCCTAAGAGGG - Intergenic
947511531 2:230758974-230758996 AACATGCAACTATTCCAAGAAGG - Intronic
947826970 2:233113132-233113154 AATAAGCATGTAATCCAAGAAGG - Intronic
1169069290 20:2712828-2712850 GATAAGAAAATGTTCCAAGAAGG + Intronic
1169806981 20:9569544-9569566 GGGAGGAAAGTATTTCAAGAAGG + Intronic
1169829806 20:9811873-9811895 GAGAAGCCAGTGTTTGAAGAAGG - Intronic
1170003924 20:11645823-11645845 GAGAAGCAAGTTTGTCCAGAAGG - Intergenic
1171142818 20:22757905-22757927 GAGAACCAAGAATTCCAAAGGGG + Intergenic
1172959674 20:38789817-38789839 TAGAGGCAAGAAATCCAAGATGG - Intergenic
1174132436 20:48355512-48355534 GAGAGTGAAGTATTCCAGGAAGG + Intergenic
1174569326 20:51490325-51490347 GAGAAGCCAGGATTCCAACACGG + Intronic
1175315382 20:58043495-58043517 GAGAAGCAGGAATAGCAAGAGGG - Intergenic
1175335889 20:58196057-58196079 GAATAGCAAGGATTTCAAGACGG - Intergenic
1177206925 21:18021029-18021051 GAGAAGTCAGTATTTCAAAACGG - Intronic
1179505326 21:41836011-41836033 GAGAAGAAAGAATCCCAGGAGGG - Intronic
1182234697 22:28866112-28866134 AAGAAGCAACTATTGCAAGTTGG + Intergenic
1183667879 22:39255704-39255726 GAGAAGAAAGTTGTCCAGGAGGG + Intergenic
949553070 3:5128317-5128339 GAGAAGCTAGTCTTCCAATAAGG + Intronic
950314588 3:11989377-11989399 GAAAAGCAAGTAATAAAAGATGG - Intergenic
950801459 3:15555045-15555067 GGGAAGGAAGTAATCCAGGAAGG - Intergenic
950942760 3:16910425-16910447 GCGAAGTAAGTGTGCCAAGAAGG - Intronic
951765310 3:26191200-26191222 GAGAATAAAGTGTTTCAAGAAGG - Intergenic
952191170 3:31024930-31024952 GAGAAGGAAGTAGTCCAACAAGG - Intergenic
952494761 3:33906158-33906180 AGGAAGCAAGTGATCCAAGAAGG + Intergenic
953068227 3:39494377-39494399 GTGAAGTAAGCATTCAAAGAAGG - Intronic
955253883 3:57309750-57309772 GAGGAGCAAGGACTCAAAGAGGG + Intronic
955834241 3:63036704-63036726 GAGAAGCAGATCTTACAAGAAGG - Intergenic
956657770 3:71568538-71568560 AAGTAGTAAGTATTTCAAGAAGG - Intronic
957990476 3:87620683-87620705 GAAAAGCAAATATTACAAAAAGG - Intergenic
958127451 3:89375494-89375516 CTGAAGCAAGTATTCCAAACGGG - Intronic
958149938 3:89678546-89678568 AGGAAGAAAGTATTTCAAGAAGG - Intergenic
958907918 3:99962112-99962134 GAGAGGAAGGTATTCCAGGAAGG + Intronic
960271923 3:115684103-115684125 GGGAAGAAAGTATTCTAGGAAGG + Intronic
961838429 3:129685064-129685086 GGGAAGCATGTATTAAAAGAAGG + Intronic
962477582 3:135769864-135769886 GACAGGCAAGAATTTCAAGAAGG + Intergenic
963784875 3:149524168-149524190 GAGAAGCAAGGATTCAAATCAGG + Intronic
964295653 3:155230410-155230432 CAAAGGCAAGCATTCCAAGAAGG - Intergenic
964412086 3:156408217-156408239 GAGAAACAAGTAGGCCTAGAAGG - Intronic
966041933 3:175501934-175501956 AAGAAGTAAGCATTTCAAGAAGG + Intronic
967186973 3:186952385-186952407 GAGAAGAAACTATTTCAAGGAGG - Intronic
970146373 4:13040682-13040704 AAGAGGCTAGTAGTCCAAGAAGG + Intergenic
971043590 4:22780795-22780817 GAGAATCAAGTTTTCCCTGAGGG - Intergenic
971560107 4:28068380-28068402 GAGAAAAAAGTAATCCCAGAAGG + Intergenic
971790021 4:31157319-31157341 AAGAAGCAAATATTTCAATAAGG - Intergenic
973249124 4:48043454-48043476 GAGATTCAAGTATTTCAAAAGGG - Intergenic
973720773 4:53721259-53721281 AAGAAGAGAGTATTTCAAGATGG + Intronic
974576142 4:63725746-63725768 ATGAAGAAAGTATTTCAAGAAGG - Intergenic
975703976 4:77093446-77093468 GAGAAACTATTTTTCCAAGATGG - Intergenic
975887648 4:78984109-78984131 GAGATGAAAATGTTCCAAGAGGG - Intergenic
976294127 4:83452688-83452710 CAGAAACAAGAATTTCAAGAAGG + Intronic
977139861 4:93355489-93355511 CAAGAGCAAGTGTTCCAAGAGGG + Intronic
977173026 4:93786103-93786125 GAGAAGAGAGTATTTCAATAGGG + Intergenic
977192524 4:94018617-94018639 GAGAATAAAGCATTTCAAGAAGG - Intergenic
979861984 4:125706170-125706192 GAGAAGCAAGGATGCCAGCATGG + Intergenic
981451690 4:144905612-144905634 GAGAAGGAAATATTTCAAGGGGG - Intergenic
981771464 4:148314199-148314221 GATGAGCAAGTATGACAAGAGGG + Intronic
983368896 4:166833778-166833800 GAGAAGCAAGAATGCTAAAAAGG - Intronic
983398962 4:167238526-167238548 GGGAAGCATGTATTCCTACAGGG - Intergenic
983987048 4:174072567-174072589 GACAAGAAAGAATTTCAAGAAGG + Intergenic
984781999 4:183534344-183534366 GAGAAGAAATTGTTTCAAGAAGG - Intergenic
985514813 5:336124-336146 GAGAAGGAAGTGCTCCAGGAGGG - Intronic
985990808 5:3559404-3559426 GAAAAGCCAGTATTTCAACAGGG - Intergenic
986508162 5:8474135-8474157 AAGAAGCAAATTTTACAAGAAGG + Intergenic
987015662 5:13816057-13816079 GAGAAGGAAGGGTTTCAAGAAGG + Intronic
987365695 5:17146805-17146827 GAGAAGCAAGGAAGGCAAGAAGG - Intronic
989524213 5:42434453-42434475 GAGACTCAAGTATTTCAATAGGG - Intronic
992866649 5:80962957-80962979 GAGAAGCAAGCATTCCAGAATGG + Intronic
993326482 5:86544663-86544685 GAGAAGGAAATACTTCAAGAAGG + Intergenic
993570294 5:89529212-89529234 TGGAAGGAAGTATTCTAAGATGG + Intergenic
993888357 5:93442874-93442896 GAGCAGCAAATATTGCAAAACGG - Intergenic
995701141 5:114937362-114937384 AAGAAACAAGTACTCCAAGAAGG + Intergenic
995813900 5:116144595-116144617 GAGAAGGAAATATTTCAAGATGG + Intronic
997285645 5:132676357-132676379 GAGAAGCGATGATTCTAAGAAGG + Intronic
999227635 5:150040272-150040294 AAGAATAAAGTATTCCAACATGG - Intronic
999414449 5:151382451-151382473 TAGAAGCAAGGAATCAAAGATGG + Intergenic
999950095 5:156639759-156639781 AAGAAGTATGTATTTCAAGAAGG - Intronic
1003883631 6:10500799-10500821 GAGAAGCAATTGTACCTAGAGGG + Intronic
1005353658 6:24961291-24961313 GAGAAGGGAGTATTCCAGGTTGG + Intronic
1006202726 6:32311053-32311075 GAGAAGATAGTATTTCAATATGG - Intronic
1008860079 6:56138549-56138571 GAGAAGAAATTGTCCCAAGAAGG + Intronic
1011978406 6:93337747-93337769 GAGAAGTAAGTATCACAGGATGG + Intronic
1012173449 6:96048505-96048527 GAGAAGCAAGGTTTCCAAATTGG + Intronic
1012271652 6:97219813-97219835 GAGGAGCCAGTATTCCAGGCAGG - Intronic
1013402504 6:109812558-109812580 GAGAAGAAAGTGTTTCAAGAAGG + Intronic
1013764176 6:113554938-113554960 GAGAATCAATTATTCCTTGAAGG + Intergenic
1013989513 6:116237226-116237248 GAGGAGCAAGGATTCCAAGCAGG + Intronic
1014727504 6:124990106-124990128 GTGAAGAAAGTATTTCAAGGAGG - Intronic
1016110675 6:140219415-140219437 GAGAAGAAACTACTCCAAGGAGG - Intergenic
1016724016 6:147339347-147339369 AAGCAGAAAGTTTTCCAAGATGG + Exonic
1016825666 6:148386438-148386460 GAGAAACCAGTATTCCATGTTGG + Intronic
1017317420 6:153047853-153047875 GAGAAGAAAGTATTTCAAAGAGG - Intronic
1021582118 7:22167123-22167145 GAGAAGGAAGTCATCCAGGAGGG + Exonic
1021773777 7:24031314-24031336 GTGAAGGAAATATTCCAAGAAGG + Intergenic
1023069275 7:36412928-36412950 GAAAAGGAAGAATTCCTAGAGGG - Intronic
1023111237 7:36813017-36813039 GAGAAGACAGTAGTCAAAGATGG - Intergenic
1023714669 7:43030975-43030997 GATAGGCAAGTATTCCAAGAGGG + Intergenic
1025599434 7:62976947-62976969 GAAAAGAAAGCATTCCCAGAGGG + Intergenic
1026504597 7:70971507-70971529 ACAAAGCAAGTATTCCAAGGTGG + Intergenic
1027784928 7:82568907-82568929 GTGAAGAAAGTATTCTAAAAAGG - Intergenic
1028017171 7:85730815-85730837 TACAAGTAAGTATTTCAAGATGG + Intergenic
1028114422 7:86981654-86981676 GGGAAGTAAGTATTCCCAGAAGG - Intronic
1028533139 7:91861411-91861433 GAGAGGATAGTATTTCAAGAAGG - Intronic
1029605390 7:101596126-101596148 CAAGAGCAAGTGTTCCAAGAGGG - Intergenic
1030132225 7:106211437-106211459 GAGAAGTAATTAATTCAAGATGG + Intergenic
1030197868 7:106869799-106869821 GAGAACAAAGTATTCCCACAGGG - Intronic
1030384547 7:108852368-108852390 TAGAATAAAGTATTGCAAGAAGG - Intergenic
1030623506 7:111818026-111818048 GTGAAGAAAGCATTTCAAGAAGG - Intronic
1030740806 7:113107324-113107346 AAGAAGCAAGTTTTCCAACATGG - Intergenic
1032777897 7:135134088-135134110 GGGAAGCAGGTACTACAAGAGGG + Intronic
1032807324 7:135369317-135369339 TAGAGGCAGGAATTCCAAGACGG - Intronic
1033382437 7:140835869-140835891 GAGAAGCAAATATTTTAAAATGG + Intronic
1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG + Intergenic
1035318163 7:158010433-158010455 AAAAAGTAAGAATTCCAAGATGG + Intronic
1035488551 7:159252073-159252095 GAGAAGAAAGTATTTGAAGTGGG - Intergenic
1037172624 8:15911451-15911473 GAGAAGCTAGAATGACAAGACGG + Intergenic
1038381677 8:27101182-27101204 GAGAAGTAGGGATTCCATGAAGG + Intergenic
1039037994 8:33380507-33380529 GAGAAGGAACAATTCCAAGTGGG - Intronic
1039946674 8:42135511-42135533 GAGACGAAAGTGTTCAAAGAGGG + Intergenic
1039951196 8:42174096-42174118 GAGTAGAAAGTAGTCTAAGAGGG + Intergenic
1040982226 8:53255585-53255607 GAGAAGAAAGAATTTCAGGATGG + Intergenic
1041566994 8:59289871-59289893 GAGTGTCAAGTATTCCAATAAGG - Intergenic
1041811967 8:61921703-61921725 GAGAATAAAGCATTTCAAGAGGG - Intergenic
1041858282 8:62482592-62482614 GACCAGCAAGTCTTCCAAAATGG + Intronic
1042040590 8:64584994-64585016 GCAAAGGAAGTATTTCAAGAAGG - Intergenic
1042680658 8:71379822-71379844 GAGAAGGAATTTTTCTAAGATGG - Intergenic
1045074939 8:98554073-98554095 GAGAAGCAAGAATTCTAGGCAGG + Intronic
1045886075 8:107099318-107099340 GAGAAGAAAGAATTCCTACAAGG + Intergenic
1046517108 8:115276798-115276820 GAGAAGCAAGAATTTCTAGCAGG + Intergenic
1046748791 8:117905164-117905186 AAGAAGCCAGAATTCCAAGTGGG + Intronic
1048119532 8:131563867-131563889 GAGAAGCCAGTAGACCAAGGAGG + Intergenic
1049839017 8:144758619-144758641 GGAAATCAAGTGTTCCAAGAAGG - Intergenic
1049912161 9:279608-279630 GGGAAGAAAGTATGTCAAGAGGG + Intronic
1050876383 9:10642351-10642373 GAAAAGGAAGAATTGCAAGATGG - Intergenic
1051443799 9:17118025-17118047 CAGAAGCAAGTGTCCTAAGATGG + Intergenic
1053331491 9:37212673-37212695 GAGAAGCAATTCATCCAACAAGG - Intronic
1054920210 9:70536033-70536055 GAGAAGCAAGTCCTCCAAGCCGG - Exonic
1054957804 9:70933460-70933482 GAAAAGAGAGCATTCCAAGAAGG + Intronic
1055931925 9:81567660-81567682 GAGTTTCAAGTATTCCAAAATGG + Intergenic
1057750945 9:97792590-97792612 GAGAAGAAAGCAGTTCAAGAAGG + Intergenic
1058158111 9:101537719-101537741 ATGAAGAAAGTATTTCAAGAAGG + Intronic
1058648917 9:107156854-107156876 GTGAAGAAAGTGGTCCAAGAAGG - Intergenic
1058812751 9:108657065-108657087 GAGCAGCAGGAATTCCAAAAAGG + Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059693048 9:116704366-116704388 GAGAAGCAATTATATCAAGTTGG - Intronic
1187458529 X:19464739-19464761 GATAAGCAAGGATTGCAACATGG + Intronic
1187477411 X:19624311-19624333 GAAAAAAAAGTATTCCAAGATGG + Intronic
1188467305 X:30496425-30496447 GAGCAGCAAGTTTCCCTAGAAGG - Intergenic
1188555170 X:31403491-31403513 GAGAAACAAATACTCCAAGTTGG + Intronic
1189147209 X:38667435-38667457 GAGAAGCAAAGATTCCATCAGGG + Intronic
1190651923 X:52576159-52576181 GAGAAGCCAGATTTGCAAGAGGG - Intergenic
1194291302 X:92075125-92075147 TAGAATCCAGTATTGCAAGAAGG - Intronic
1196834689 X:119803279-119803301 TAGAAACAAGTAGCCCAAGAGGG - Intergenic
1197688113 X:129465874-129465896 GAGAAGCAAGAATTCAACGAAGG - Exonic
1198086255 X:133285600-133285622 AAGAAGCCAGTATTCCTTGAAGG - Intergenic
1198213764 X:134538042-134538064 GAGTTGGAAGTATGCCAAGAGGG - Intergenic
1198228070 X:134664736-134664758 GAGAAGCACTATTTCCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198425893 X:136519927-136519949 GAAAAGAAAATATTTCAAGAAGG + Intergenic
1198495248 X:137185732-137185754 TTGAAGCAAGTATTTCCAGAAGG + Intergenic
1199791998 X:151163894-151163916 GAGAAGAGAGTGTTTCAAGAAGG + Intergenic
1199975174 X:152890725-152890747 GAGAAGCAAGTTTTTCCAGAAGG + Intergenic
1200608817 Y:5299710-5299732 TAGAATCCAGTATTGCAAGAAGG - Intronic
1200701210 Y:6404054-6404076 GAGAAGAAGGCATTTCAAGATGG + Intergenic
1201032902 Y:9760644-9760666 GAGAAGAAGGCATTTCAAGATGG - Intergenic