ID: 1098499052

View in Genome Browser
Species Human (GRCh38)
Location 12:71169156-71169178
Sequence CTAGGCTGCAGTTAGTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098499049_1098499052 13 Left 1098499049 12:71169120-71169142 CCTAAGTTAGGTTTTCAGTCTTG 0: 22
1: 122
2: 152
3: 111
4: 245
Right 1098499052 12:71169156-71169178 CTAGGCTGCAGTTAGTCATAAGG 0: 1
1: 0
2: 1
3: 14
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098499052 Original CRISPR CTAGGCTGCAGTTAGTCATA AGG Intronic
904851281 1:33461571-33461593 CTGGGCTGCAGTTCTTCATCTGG + Intergenic
904897313 1:33826618-33826640 CTAGGCTGGACTTAGTGACAGGG - Intronic
905221708 1:36452328-36452350 CTAGGCTGCAGTGAGCCACCAGG - Intergenic
910524593 1:88163727-88163749 CCAGGTTTCAGTTAGGCATAAGG + Intergenic
913542372 1:119834171-119834193 TTAGGCTGAATTTAATCATAAGG + Intergenic
914378955 1:147099150-147099172 TTAGGCTGAATTTAATCATAAGG + Intergenic
917195215 1:172457142-172457164 CTAGGCTGGAGTTAGGCCTTCGG + Intronic
917358718 1:174154090-174154112 CAAGGCTGCAGTGAGCCATAAGG - Intergenic
918280707 1:183002125-183002147 CAAGGCTGCAGTGAGCCAGACGG + Intergenic
921121168 1:212139003-212139025 CTCTGCTGCAGCTAGTCTTAAGG - Intergenic
921356168 1:214286421-214286443 CCAGGCTGGAGTAAGTGATATGG - Intronic
921644424 1:217597265-217597287 CCAGGCTGCAGTTAGCTATGAGG + Intronic
921803878 1:219432543-219432565 CTTGGCTGCGGTTAGTCATCAGG - Intergenic
924576563 1:245285931-245285953 CAAGGCTGCAGTGAGCTATATGG + Intronic
1064107152 10:12509683-12509705 TGAGGCTGCAGTGAGCCATAAGG + Intronic
1066472653 10:35714145-35714167 CTAGACTGCACTCAGTCATATGG - Intergenic
1066674372 10:37873003-37873025 GGAGTCTGCAATTAGTCATATGG + Intergenic
1067455896 10:46419064-46419086 CTAGGATGCTGTTACTCATGGGG + Intergenic
1067631304 10:47965575-47965597 CTAGGATGCTGTTACTCATGGGG - Intergenic
1072162838 10:92784381-92784403 AAAGGCTGCAGTGAGCCATAAGG - Intergenic
1072270747 10:93774046-93774068 CTAGGCTACACGTAGTTATAGGG + Intronic
1078906265 11:15690869-15690891 CTAGGCTACAGGTAGACAAAGGG - Intergenic
1079420251 11:20279501-20279523 TTAGGTTGCAGTTAGTTACACGG - Intergenic
1080884840 11:36357333-36357355 ATAAGCTGCAGTAAGTTATATGG + Intronic
1083575960 11:63791590-63791612 CTATGCAGCTGTTAGACATAAGG + Intergenic
1083805389 11:65070547-65070569 CGAGGCTGCAGTGAGCCATGAGG - Intronic
1087051233 11:93888383-93888405 CTAGCCTGAGGGTAGTCATATGG - Intergenic
1089926304 11:122261890-122261912 TAATGCTGCAGTGAGTCATATGG + Intergenic
1095543148 12:43334409-43334431 CTAGGCTACAGTGAGTTGTATGG + Intergenic
1098499052 12:71169156-71169178 CTAGGCTGCAGTTAGTCATAAGG + Intronic
1101581423 12:106045229-106045251 CTTGGCTGCACCTAGTTATAAGG + Intergenic
1101658858 12:106748386-106748408 TTAGGCTGCAGTTATTCATGAGG + Intronic
1101893266 12:108734117-108734139 CGAGGCTGCAGTGAGCCAGATGG - Intergenic
1104655011 12:130567829-130567851 CTAGCCTGCAGTTCTTCATAGGG + Intronic
1104751430 12:131242415-131242437 CTAGGTAGCTGTTAGACATATGG - Intergenic
1109598187 13:64585616-64585638 TTAGCCTGAAGATAGTCATATGG - Intergenic
1112403501 13:99097043-99097065 CGAGGCTGCAGTTTGCCATTAGG + Intergenic
1115410325 14:33066883-33066905 ATAGGCTGCAGTAATTGATACGG + Intronic
1116850181 14:49900967-49900989 CTAGGTTGGAGTTAGGCCTAAGG + Intergenic
1127771162 15:62231966-62231988 CTGCGCAGCAGTTAGTCTTATGG - Intergenic
1130180526 15:81622722-81622744 CTATACTGTATTTAGTCATATGG + Intergenic
1130334123 15:82944164-82944186 CCGGGGTGCTGTTAGTCATATGG - Intronic
1132604820 16:789228-789250 CTAGGCTGCAGGTGGTCAAGAGG + Exonic
1133462187 16:5996617-5996639 CTATGCTGCAATTAGCCCTAGGG - Intergenic
1134399527 16:13896579-13896601 CTAGGCAGAACTTAGTCATATGG - Intergenic
1140709337 16:77662242-77662264 CTATGCAGCTGTTAGACATAAGG + Intergenic
1142574695 17:898783-898805 CGAGGCTGCAGTGAGCCATGAGG + Intronic
1143446074 17:7010373-7010395 CTGGGCTTCAGATATTCATAGGG - Exonic
1143845264 17:9768995-9769017 CTAGGGAGCATTTAGTCAGAGGG + Intergenic
1145899231 17:28479146-28479168 TGAGGCTGCAGTGAGCCATATGG + Intronic
1146158256 17:30542370-30542392 CTGGGCTTCAGATAGTCATAGGG - Intergenic
1146577699 17:34009280-34009302 CTAGGCTGCTGCTAGACACAAGG - Intronic
1149271083 17:54978033-54978055 GTAGGCTGCAGTTGGTCATTTGG - Intronic
1151262086 17:72924079-72924101 CAAGGCTGCAGTGAGCCAAATGG + Intronic
1152012079 17:77724888-77724910 CCAGGCTGCAGTAAGTCATTAGG - Intergenic
1155915091 18:31549732-31549754 CTAGGCTGCAGTTCGTCATGTGG + Intergenic
1156635933 18:39029635-39029657 CCAGGCTGCAGTTAGCTATGAGG - Intergenic
1156906257 18:42355854-42355876 CCAAGCTGCAGTGAGCCATATGG - Intergenic
1157441463 18:47715071-47715093 CTGGGCTGGAGATAGTCATATGG + Intergenic
1157830651 18:50854291-50854313 CTTGCCTGCAGTGAGTCTTAAGG + Intergenic
1159970723 18:74648679-74648701 CTATGCTGCATTAAGTTATATGG - Intronic
1162423897 19:10582389-10582411 CGAGGCTGCAGTGAGCCATGAGG + Intronic
1166948527 19:46411898-46411920 AGAGGCTGCAGATAGTCAAAGGG - Exonic
1167765044 19:51476600-51476622 GTAGGCTGCAAATATTCATATGG + Intergenic
926167882 2:10532795-10532817 CTCGGCCGCAGTTAGTCATCAGG - Intergenic
942895952 2:181054720-181054742 CTAGGCTGCAGTTACAGATTTGG + Intronic
943761553 2:191615026-191615048 TTAGGTTGCAGTTTGTTATATGG + Intergenic
944141632 2:196463062-196463084 CTAAGTGGCAATTAGTCATAGGG + Intronic
1178146402 21:29745203-29745225 CTCGGTTGCAGTTAGCCAGAGGG - Intronic
1179677007 21:42990030-42990052 CGAGGCTGCAGTGAGCCAGATGG + Intronic
950107742 3:10398916-10398938 CCAGCCTGGAGTGAGTCATAGGG - Intronic
954834360 3:53452720-53452742 CTCAGCTGCAGTTAGTCTCAAGG + Intergenic
957527129 3:81391926-81391948 CTAGGCAGCAGTTAGCCAACTGG - Intergenic
957848342 3:85770371-85770393 CAAGGCTGCAGTGAGCCATGAGG - Intronic
959048860 3:101504951-101504973 CAAGGCTGCAGTGAGGCATGTGG + Intronic
964332407 3:155618709-155618731 CAAGGCTGCAGTGAGCCCTATGG - Intronic
964697502 3:159526232-159526254 CAAGGCTGCAGTGAGCCATCAGG - Intronic
965238486 3:166160270-166160292 GTAGGCTGTAGTTAGTCATGTGG + Intergenic
965265282 3:166535522-166535544 CGAGGCAGCAGTTATTCCTAAGG + Intergenic
970709401 4:18844053-18844075 CTTGGCCTCAGTTAATCATAAGG + Intergenic
975586524 4:75955485-75955507 CGAGGCTGCAGTGAGCCATGAGG + Intronic
976242129 4:82968704-82968726 CTTGGCTGCAGTTAGTACTGGGG - Intronic
983247512 4:165305283-165305305 CAAGGCTGCAGTATGTCATAGGG - Intronic
987167859 5:15219840-15219862 CTCCGCTGCAGTTATTCTTAGGG - Intergenic
997979694 5:138461176-138461198 CTTGACTGCAGTTAGTCCTCAGG + Intergenic
1000871367 5:166581364-166581386 CTAGGCTCCAGCCAGTCATGGGG - Intergenic
1001351779 5:170974795-170974817 CTAGGCTGCACTTGGGCCTATGG + Intronic
1006507051 6:34496113-34496135 ATAGGCTGCCTTTAGTCCTATGG - Intronic
1007505707 6:42333698-42333720 GGAGGCTGAAGTTAGTCATGGGG - Intronic
1010380677 6:75221043-75221065 TGAGGCTGCAGTGAGTTATAAGG - Intergenic
1012994837 6:105963013-105963035 CAAGGCTGCAGTGAGCCATCAGG - Intergenic
1014512074 6:122335166-122335188 CAAGGCTGCAGTGAGCCATGAGG + Intergenic
1021275702 7:18648220-18648242 CTAGGCTGTGGTGAGTCGTATGG + Intronic
1024585410 7:50837590-50837612 CTTGGCTGCAGTTAGACTTGAGG - Intergenic
1024904284 7:54358998-54359020 CGAGGCTGCAGTGAGGCATTAGG - Intergenic
1027650315 7:80858862-80858884 CTTGGGTTCAGTTATTCATATGG - Intronic
1032298151 7:130661301-130661323 CAAGGCTGCTGTTACTCAGAGGG - Intronic
1036762918 8:11524150-11524172 ATAGCATGCAGTTATTCATATGG + Intronic
1038000755 8:23389537-23389559 CTAGGAATCAGTTAGTCACATGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1041976702 8:63807333-63807355 CAAAGTTGCAGTTAGACATATGG + Intergenic
1044739816 8:95314695-95314717 CTTGGCTGGAGTTAGCCATCTGG + Intergenic
1044908227 8:97028320-97028342 CCAGGCTGCAGTTAGCCAGCTGG + Intronic
1046815807 8:118582216-118582238 CTAGGCTGCAGTTAATATTTGGG - Intronic
1049938294 9:520428-520450 CTTGGCTGAAGAAAGTCATATGG + Intronic
1052435611 9:28424336-28424358 CTAGCCTGGACTTATTCATATGG - Intronic
1055173354 9:73287785-73287807 TGAGGCTACAGTGAGTCATAAGG + Intergenic
1057165415 9:92921510-92921532 CTGGGCCGCAGGTATTCATAGGG - Intergenic
1060067991 9:120521326-120521348 CAAGGTTACAGTTAGTGATATGG + Intronic
1061003359 9:127915156-127915178 CTAGCCTCCAGTTAGGAATATGG - Intronic
1061195015 9:129102790-129102812 CTGGGCTTCAGTTTGTCACAGGG + Intronic
1062305684 9:135906092-135906114 CTAGACTCGAGTTAGTCATAAGG - Intronic
1195504206 X:105638162-105638184 AAAGACTGCAGTTAGACATAAGG + Intronic