ID: 1098500792

View in Genome Browser
Species Human (GRCh38)
Location 12:71189286-71189308
Sequence TGAATGCAGCAGATACTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098500792_1098500796 22 Left 1098500792 12:71189286-71189308 CCAACAAGTATCTGCTGCATTCA 0: 1
1: 0
2: 4
3: 32
4: 157
Right 1098500796 12:71189331-71189353 TTCACATAAACTGAAGGTAAAGG 0: 1
1: 36
2: 394
3: 516
4: 782
1098500792_1098500793 -2 Left 1098500792 12:71189286-71189308 CCAACAAGTATCTGCTGCATTCA 0: 1
1: 0
2: 4
3: 32
4: 157
Right 1098500793 12:71189307-71189329 CAAGAGACTCACCTAACATAAGG 0: 3
1: 8
2: 5
3: 11
4: 121
1098500792_1098500795 16 Left 1098500792 12:71189286-71189308 CCAACAAGTATCTGCTGCATTCA 0: 1
1: 0
2: 4
3: 32
4: 157
Right 1098500795 12:71189325-71189347 TAAGGATTCACATAAACTGAAGG 0: 1
1: 23
2: 345
3: 482
4: 536
1098500792_1098500798 24 Left 1098500792 12:71189286-71189308 CCAACAAGTATCTGCTGCATTCA 0: 1
1: 0
2: 4
3: 32
4: 157
Right 1098500798 12:71189333-71189355 CACATAAACTGAAGGTAAAGGGG 0: 5
1: 279
2: 453
3: 421
4: 541
1098500792_1098500797 23 Left 1098500792 12:71189286-71189308 CCAACAAGTATCTGCTGCATTCA 0: 1
1: 0
2: 4
3: 32
4: 157
Right 1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098500792 Original CRISPR TGAATGCAGCAGATACTTGT TGG (reversed) Intronic
900835201 1:4997946-4997968 GGTATGCAGCAGTTGCTTGTGGG - Intergenic
902102831 1:14007152-14007174 TAAATGCAGCTGATTTTTGTGGG + Intergenic
902692603 1:18119180-18119202 TTTATGCAGCAGATATTTATTGG + Intronic
903808108 1:26019804-26019826 TGAATGAATGAGAGACTTGTGGG + Intergenic
906646065 1:47476063-47476085 TGGAGGCAGCAGCCACTTGTGGG + Intergenic
915782298 1:158566322-158566344 TTAATGCATCAGATACTTTTCGG + Intergenic
918983813 1:191596780-191596802 TGCCTGCAGCAGAGACTTGGTGG + Intergenic
921196625 1:212763511-212763533 TGATGACAGCAGATACTTGGTGG - Intronic
921242314 1:213197865-213197887 TGAAGACAACAGATACTTGGTGG + Intronic
921726493 1:218529718-218529740 TCAGTGCAGCAGATATTTTTGGG - Intergenic
921843083 1:219849060-219849082 TGAAGACAGCAGATACTTGTTGG - Intronic
922557589 1:226544632-226544654 TGATTGCAGCTGATGTTTGTAGG - Intergenic
922880919 1:228979752-228979774 TGGCTTCAGCAGATGCTTGTTGG - Intergenic
923732691 1:236567886-236567908 TGAAAGCAGCAGGAAGTTGTTGG - Intronic
924146919 1:241086100-241086122 TGAATACATGAGATACCTGTTGG - Intronic
1063837033 10:10027159-10027181 TTAATTCAGCAAATATTTGTTGG + Intergenic
1066223262 10:33356786-33356808 TGTATTCAACAAATACTTGTTGG - Intergenic
1069824845 10:71248621-71248643 TGAGTGCAGCAGATATTAGCCGG - Intronic
1070667390 10:78354952-78354974 TGAACGCAGGAGACACTAGTGGG + Intergenic
1071012379 10:80953626-80953648 TGAATGCAGCATAAACCTCTGGG - Intergenic
1071062742 10:81592087-81592109 TGAAGGCAGCAGATACTTGGTGG - Intergenic
1075789592 10:125074179-125074201 TGAAAGCAGCAGCTACATGAAGG + Intronic
1077741399 11:4849383-4849405 TGAATGCTGCATATACTATTAGG - Intronic
1077802532 11:5555278-5555300 TGAAAGCAGCAGGTACTTGGTGG + Intronic
1078067021 11:8085350-8085372 TGAATGCACCTGATACATTTGGG + Intronic
1080755039 11:35189067-35189089 TGAGAGCAGCAAATACTTCTAGG + Intronic
1080882388 11:36334477-36334499 TGAAGCCAGCAAATACTTGGTGG - Intronic
1086315501 11:85587607-85587629 TGAAGAGAGCAGATACTTGGTGG + Intronic
1088759971 11:112920149-112920171 TGAATGCAGCAGAGTGTTGTGGG + Intergenic
1090908697 11:131099229-131099251 TGAATACATGAAATACTTGTTGG + Intergenic
1098500792 12:71189286-71189308 TGAATGCAGCAGATACTTGTTGG - Intronic
1098518809 12:71411434-71411456 TGAAGACAGGAGATACTTGGTGG - Intronic
1099351902 12:81581829-81581851 TGAAAGCAGCAGAAACTTATGGG - Intronic
1100087951 12:90934813-90934835 TGAAGGCAACAGATAGTTGGTGG + Intronic
1100645923 12:96531404-96531426 GTAATGCAGCAGATACTTTGAGG + Intronic
1100706491 12:97205578-97205600 TGAAAGCAGCAGATAGTTGTTGG - Intergenic
1104082097 12:125438117-125438139 AGAATGCAGTTGATTCTTGTAGG - Intronic
1104156909 12:126142283-126142305 AGAAGGCAGCAGAGACTGGTGGG + Intergenic
1105302176 13:19145536-19145558 TGAATGAAGAATATACTTCTTGG + Intergenic
1106381039 13:29239519-29239541 TAAATTCAGCAAATACTTATTGG + Intronic
1106870507 13:34013829-34013851 TGGCTTCAGCAGAGACTTGTTGG + Intergenic
1109571417 13:64195447-64195469 TGAATGCAGCATAAACTCTTTGG - Intergenic
1111623412 13:90753024-90753046 TGAATGCATCAGAAAGTTATAGG + Intergenic
1113590162 13:111493241-111493263 TGAATGAAGCACATAATTGTGGG + Intergenic
1114774441 14:25465380-25465402 TGAATGCAGCATCTATTTGTTGG + Intergenic
1115650702 14:35401156-35401178 TGAATTCAGCATATTCTTCTTGG + Intergenic
1117103604 14:52376553-52376575 TGAAGACAGCAGAAACTTGTTGG + Intergenic
1117275133 14:54186255-54186277 TTAATGGAGCAAATACTTTTAGG - Intergenic
1117614966 14:57525378-57525400 TGAAGACAGCAGATTCTTGATGG + Intergenic
1118003696 14:61546319-61546341 TGAATGCTGCATTTACTTTTGGG + Intronic
1118667875 14:68089820-68089842 TGTAGGCAGCAGATATTTGTGGG + Intronic
1123771466 15:23534003-23534025 TGAAGGCAGCAGACATTTATAGG + Intergenic
1124452936 15:29813872-29813894 TACATTCAGCAGATATTTGTTGG - Intronic
1124550511 15:30676633-30676655 TTCATTCAGCAGATATTTGTGGG - Intronic
1124681333 15:31733668-31733690 TTTATTCAGCAGATATTTGTCGG - Intronic
1127376773 15:58392392-58392414 TGAATTCAGCAGAAACCTGTAGG - Intronic
1127885080 15:63191710-63191732 TCAAGGCAGGAGATACTTCTGGG - Intronic
1128290977 15:66477981-66478003 TGAGTCCAGCAGTTGCTTGTTGG - Intronic
1131087657 15:89590271-89590293 TGAATTCAGCTGCTACTTGGTGG + Intronic
1132173305 15:99686143-99686165 TGAAGACAGCAGATACTTGGTGG + Intronic
1135245024 16:20848213-20848235 TGATGGCAGCAGATACTCTTGGG + Intronic
1138208961 16:55146915-55146937 TGAATCCAGCAGAGACTGGGAGG + Intergenic
1140710014 16:77668947-77668969 GGACTGTAGCAGATATTTGTTGG + Intergenic
1141389667 16:83654142-83654164 TCATTCCAGCAGAGACTTGTAGG + Intronic
1143113279 17:4565708-4565730 TGACTGCTGCATATACTTCTAGG + Intergenic
1144862378 17:18313607-18313629 TGAATTCAGCAGAGCCTTGAAGG + Intronic
1147910842 17:43855071-43855093 TCAATGCAGCAGAGACTTGTGGG - Intronic
1149334428 17:55620946-55620968 TAAATGCAGCAGAGTCTTATGGG - Intergenic
1149435314 17:56628992-56629014 TGTAAGCAGCAGATACTGATGGG - Intergenic
1151509267 17:74548339-74548361 TACATTCAGCAGATACTTATGGG - Intergenic
1157218781 18:45808965-45808987 TGAAGGCAGCAGATAGTGGTTGG - Intergenic
1158025753 18:52895205-52895227 TGAATACGGCTGATATTTGTTGG - Intronic
1158085294 18:53643818-53643840 TGAATGGAGCAGTGACTTTTGGG - Intergenic
1158141817 18:54264143-54264165 GGTGTGCAGCAGATACTTTTAGG + Intergenic
1158733841 18:60057152-60057174 GGAGTGCAGCAGATATTTGATGG + Intergenic
1160893068 19:1389613-1389635 TGAAGGCAGTAGATCCTTCTCGG + Intronic
927036531 2:19183369-19183391 TGAAGACAGCAGAAACTTGGTGG + Intergenic
927080148 2:19619314-19619336 TGAAGACAGCAGATACTTGGTGG - Intergenic
930027924 2:47040721-47040743 TGAATGCAGCTGCTACTTAGAGG + Intronic
930264432 2:49183443-49183465 TGAATGCAGGAGCTGCTTTTTGG - Intergenic
933382217 2:81563296-81563318 TGAAGACAGCAGAAACTTGATGG + Intergenic
937060474 2:118977152-118977174 TTAATGCAGCAGGTCCTAGTGGG - Intronic
938309476 2:130278628-130278650 CGCAGGCAGCAGATACTAGTAGG - Intergenic
938933772 2:136110984-136111006 TGAATGTAGAAGATAATTGTGGG + Intergenic
939480245 2:142739327-142739349 TTAATCCAGCAGATACTTTTTGG - Intergenic
939835827 2:147128265-147128287 TGAATGGAGCAGACACTTGCAGG + Intergenic
942147127 2:173037967-173037989 TGAATGCTGCAGATCCTTACAGG - Intronic
946205201 2:218101022-218101044 TGAAGACAGCAGATATTTGATGG + Intergenic
946700849 2:222411759-222411781 TTAGTGCAGCAGATACTGATTGG + Intergenic
946840981 2:223819321-223819343 AGAATGCAACAGATACTTTCAGG + Intronic
947324721 2:228961725-228961747 GGAATGCAGCATATACCTGGGGG - Intronic
948004377 2:234595291-234595313 TGAATGCAGGAGTTACTTGAGGG + Intergenic
948247695 2:236500291-236500313 TGAATGCAGGACGTACATGTAGG + Intronic
1173229163 20:41180734-41180756 AGATTGCAGCAGAAACCTGTTGG + Exonic
1175325686 20:58126885-58126907 TGGATGCTGCAAATACTGGTGGG - Intergenic
1178252859 21:31021086-31021108 TGAATTAAGCAAATACTTGGTGG - Intergenic
1178581049 21:33839083-33839105 TCAATTCAGCAGATATTTGGTGG + Intronic
1182726917 22:32454919-32454941 TGACAGTAGCTGATACTTGTTGG + Intronic
1184490063 22:44803316-44803338 TGAATGCTCCTGATGCTTGTTGG - Intronic
952447895 3:33400925-33400947 TGAAAGCATCAGATAGTTTTAGG + Intronic
953796077 3:45986879-45986901 TGCATGTAGCAGACACTTGACGG - Intronic
953866611 3:46588821-46588843 TGAAGGCAGCAGTTAGTTGGTGG - Intronic
953898911 3:46827318-46827340 TGAATGCAGCGTAGACATGTGGG - Intergenic
955587077 3:60491030-60491052 TGAGTGCAACATATACTTTTTGG - Intronic
957433082 3:80139053-80139075 TGAAGACAGCAGATACTTGGTGG - Intergenic
957971887 3:87392490-87392512 TGAAGGCAGAAGATAGTGGTTGG - Intergenic
958856747 3:99394622-99394644 TGTATGCAGGAGATTTTTGTGGG + Intergenic
960637262 3:119795949-119795971 TGAGTGCTGCAGATACATTTGGG - Intronic
965485932 3:169278452-169278474 TGAATGCAGTAAAAACTTGGTGG + Intronic
966322115 3:178712621-178712643 TAAAAGCAGCAAATGCTTGTAGG - Intronic
970458341 4:16247636-16247658 TGAATGAAGCAGCTCCTTTTTGG + Intergenic
971576619 4:28282686-28282708 TGAAGAGAGCAGATATTTGTTGG - Intergenic
975354170 4:73380959-73380981 TTAATTCAGCAAACACTTGTTGG + Intergenic
976460982 4:85312478-85312500 TGAAGACGGCAGATACTGGTTGG + Intergenic
977073623 4:92425038-92425060 TGAATTCAGCAGAATCTTTTAGG + Intronic
979152435 4:117336909-117336931 TTAATGCAGTAGATAGTTCTTGG - Intergenic
979780021 4:124639132-124639154 TGAATACAGCAAAAACTAGTGGG - Intergenic
979794747 4:124833141-124833163 TGAAGGCAGCAGATAGTTGGTGG + Intergenic
980497184 4:133601182-133601204 TGAGTTCATCAGAGACTTGTGGG - Intergenic
980834571 4:138175200-138175222 TGTATGCAGCATATGCTTTTAGG + Intronic
980868803 4:138586392-138586414 TGTATGCAGCAAATATTTGTTGG + Intergenic
981640988 4:146943673-146943695 TGAATGCAGCAAATATTTAAAGG + Intronic
982258263 4:153470844-153470866 TTAATTCAACAGATACGTGTTGG - Intronic
982296776 4:153837011-153837033 TGAGTGGAGCAGAATCTTGTGGG - Intergenic
982491945 4:156040458-156040480 TAAAGGCAGCAGATAGTTGATGG - Intergenic
982973361 4:162019657-162019679 TTTATGAAGCAGACACTTGTCGG + Intronic
983083036 4:163411163-163411185 TGAATGCTGAAGAAACTTGAAGG + Intergenic
985890182 5:2709089-2709111 TCAATGCAGCAGGTGCTTGTTGG + Intergenic
990899553 5:60735776-60735798 TGAAGGCAGCAGATGGTTGGGGG + Intergenic
992039990 5:72820920-72820942 TGAATGCACCAAATATCTGTGGG + Intronic
993077436 5:83251612-83251634 TTTATGCTGCAGATACTTCTGGG + Intronic
995031586 5:107487842-107487864 TAAATTCAGCAAATATTTGTTGG - Intronic
995101212 5:108308496-108308518 TGACCGCAGAATATACTTGTAGG - Intronic
995454728 5:112339061-112339083 TGAATGCAAGAGATACTGGAGGG + Intronic
996150960 5:120034342-120034364 GGAATGCAACATATACTTTTTGG + Intergenic
996157620 5:120121493-120121515 TGAGTGTAGCAGACACTTGTTGG + Intergenic
997180022 5:131818706-131818728 TGAATGCAGAGCATACTTTTTGG - Intronic
997407372 5:133661918-133661940 TGTATTCAACAGATATTTGTTGG + Intergenic
998683941 5:144503144-144503166 TGAGTGAAGCAAATCCTTGTGGG - Intergenic
999233275 5:150075267-150075289 TGAAGGCAGCAGGAAGTTGTTGG - Intronic
1001448774 5:171807913-171807935 TAAATGGAGCAGACACCTGTAGG + Intergenic
1004109599 6:12703682-12703704 TGAATGGAGAAAATACTTGTAGG + Intergenic
1006890530 6:37423804-37423826 AGAATGCAGCAGATTTTTATAGG + Intergenic
1007388960 6:41538798-41538820 ATGATGCAACAGATACTTGTTGG - Intergenic
1007830684 6:44636179-44636201 TCTATGCAGCAAATAATTGTTGG + Intergenic
1008866465 6:56216959-56216981 TTAATACAGAAAATACTTGTAGG - Intronic
1010880002 6:81155270-81155292 TGAAGGCATCAGATACTTGGTGG - Intergenic
1011394809 6:86895084-86895106 TGTAGGCAGCAGATAGTTGGTGG - Intergenic
1011804512 6:91056551-91056573 GGAATGCTACAGATATTTGTAGG + Intergenic
1014168291 6:118250386-118250408 TGAATTCATAAAATACTTGTAGG + Intronic
1014931385 6:127340635-127340657 CCAATGAAGCAGATACATGTGGG + Intronic
1015222681 6:130822645-130822667 TGAGTGCAGCATATACTGCTCGG + Intergenic
1015722033 6:136252593-136252615 TGAATGCAGCACATACCTTTAGG - Intergenic
1016827009 6:148397739-148397761 TGAATTCAACAAATACTTATTGG - Intronic
1018801151 6:167223140-167223162 TGCATTCAGCAAATATTTGTTGG + Intergenic
1018944305 6:168335494-168335516 GGAATGCACCAGAAACATGTGGG - Intergenic
1020783342 7:12542981-12543003 TGGAGGCAGCAGAAACTTGTTGG - Intergenic
1021157748 7:17232612-17232634 ACATTGCAGCAGATATTTGTTGG + Intergenic
1021670560 7:23031381-23031403 TGAATTCAGCAGATTGTTCTGGG - Intergenic
1022564970 7:31390247-31390269 TGAAGACAGCAGATAGTTGGTGG + Intergenic
1026903992 7:74052238-74052260 TTGATGCAGCAGACACCTGTGGG - Intronic
1027733060 7:81900714-81900736 TAAAGACAGCAAATACTTGTTGG + Intergenic
1028351837 7:89858611-89858633 TGCAGGCAGCAGATAATTTTGGG + Intergenic
1029351106 7:100013624-100013646 TGAATGTAGCAGATACTTCCAGG + Intergenic
1030325398 7:108213495-108213517 TGAAGGCAGCAGATAGTTGGTGG - Intronic
1032484794 7:132277342-132277364 TAAATGCACCAGATGCTTATGGG + Intronic
1033551749 7:142453645-142453667 AGAGTGCAGCAGACACTTCTTGG + Intergenic
1034330088 7:150275035-150275057 TGAGTGAAGCAGATACTTTCTGG - Intronic
1035896796 8:3411395-3411417 TGAACGCAGCATATACTGCTTGG - Intronic
1037025036 8:14024943-14024965 TGAGTGCAGCAGCTACTTACAGG - Intergenic
1037297815 8:17419683-17419705 TGACTGCAGCAGATAGAGGTTGG + Intergenic
1039028475 8:33284099-33284121 TGAAGGCATCAAATCCTTGTTGG + Intergenic
1039575305 8:38618887-38618909 TGAAGGCTGCAGAAACATGTTGG + Intergenic
1039613381 8:38936698-38936720 TGAATTCAGCAGTTACATGTGGG - Intronic
1041024583 8:53670605-53670627 TAAATTCAACAGGTACTTGTTGG - Intergenic
1041311353 8:56520309-56520331 TGAATGCAGCAGCTATTGGAAGG + Intergenic
1042480727 8:69299291-69299313 TAAATGCAGCAGAAAGATGTTGG + Intergenic
1043220234 8:77653444-77653466 TGAATTCAGCACAGACTTCTTGG - Intergenic
1045361905 8:101440725-101440747 TGGATTCAGCAAATATTTGTTGG - Intergenic
1046148204 8:110189528-110189550 TGAATACTGCAGATGCTGGTGGG + Intergenic
1047031078 8:120881523-120881545 TGAAGTCAGCACATTCTTGTTGG - Intergenic
1047379187 8:124341282-124341304 TAAATGCAGAAGAAAGTTGTAGG + Intronic
1047703464 8:127473394-127473416 AGAAAGCACCAGCTACTTGTCGG - Intergenic
1049171772 8:141165945-141165967 TGACTGCAGCAGACACATGTTGG - Intronic
1053356050 9:37446463-37446485 TCAAAGCAGCAGACACATGTTGG + Intronic
1056849686 9:90071958-90071980 TGAAGGAAGCAGATAATTATAGG - Intergenic
1059092600 9:111376376-111376398 TAAATGAAGCAGAGACTTATGGG - Intronic
1060621060 9:125067116-125067138 TCAATTCAACAGACACTTGTGGG + Intronic
1061501638 9:131006855-131006877 TGATTGCAGCAGACTCTTGATGG - Intergenic
1188296667 X:28458381-28458403 TGAATCCAGCAGGTAGTTTTTGG + Intergenic
1196344381 X:114635828-114635850 TTAATGCAACAAATATTTGTTGG - Intronic
1197184574 X:123572225-123572247 TGAAGACAGCAGATACTTGCTGG - Intergenic
1199283575 X:146030848-146030870 TGAAGACAGCAGATACTTGGTGG - Intergenic
1201304429 Y:12538252-12538274 GGAATGCAGGAGATATTTGTGGG + Intergenic