ID: 1098500794

View in Genome Browser
Species Human (GRCh38)
Location 12:71189318-71189340
Sequence TTTATGTGAATCCTTATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 5, 2: 7, 3: 27, 4: 453}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098500794_1098500800 18 Left 1098500794 12:71189318-71189340 CCTAACATAAGGATTCACATAAA 0: 1
1: 5
2: 7
3: 27
4: 453
Right 1098500800 12:71189359-71189381 AAAAGGAGATTCCATGCAAATGG 0: 1
1: 14
2: 503
3: 1151
4: 1962
1098500794_1098500796 -10 Left 1098500794 12:71189318-71189340 CCTAACATAAGGATTCACATAAA 0: 1
1: 5
2: 7
3: 27
4: 453
Right 1098500796 12:71189331-71189353 TTCACATAAACTGAAGGTAAAGG 0: 1
1: 36
2: 394
3: 516
4: 782
1098500794_1098500797 -9 Left 1098500794 12:71189318-71189340 CCTAACATAAGGATTCACATAAA 0: 1
1: 5
2: 7
3: 27
4: 453
Right 1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1098500794_1098500798 -8 Left 1098500794 12:71189318-71189340 CCTAACATAAGGATTCACATAAA 0: 1
1: 5
2: 7
3: 27
4: 453
Right 1098500798 12:71189333-71189355 CACATAAACTGAAGGTAAAGGGG 0: 5
1: 279
2: 453
3: 421
4: 541
1098500794_1098500799 1 Left 1098500794 12:71189318-71189340 CCTAACATAAGGATTCACATAAA 0: 1
1: 5
2: 7
3: 27
4: 453
Right 1098500799 12:71189342-71189364 TGAAGGTAAAGGGGTAGAAAAGG 0: 1
1: 3
2: 9
3: 98
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098500794 Original CRISPR TTTATGTGAATCCTTATGTT AGG (reversed) Intronic
901371703 1:8804170-8804192 TTTATGTGATTCATTATTGTAGG - Intronic
902866129 1:19280974-19280996 TTTATGTCTAGCCTTATGCTAGG + Intergenic
903385948 1:22926558-22926580 TGTATGTGTGTGCTTATGTTGGG - Intergenic
903827692 1:26157373-26157395 AATATGTTAATCCTTATGTGAGG + Intergenic
904861071 1:33538108-33538130 TTTATCATAATCCTTATATTGGG + Intronic
908366293 1:63426852-63426874 TTTTTGTCAATGCTTGTGTTTGG + Intronic
911435519 1:97852297-97852319 TGTATGTGACTCCTTAGGTCTGG - Intronic
911960286 1:104293183-104293205 TTTATGTTAGTGCTTCTGTTAGG + Intergenic
912699374 1:111865251-111865273 GTTCTGTGAATTCTTGTGTTAGG - Intronic
913403896 1:118466594-118466616 TATATGTGAGTGCTTATGTCTGG - Intergenic
913796948 1:122632785-122632807 TTTATGAGAATCATTCTGTCTGG - Intergenic
913805597 1:122789176-122789198 TTTATGAGAATCATTCTGTCTGG - Intergenic
913964449 1:143363796-143363818 TGTATGGGAATCCTGAGGTTGGG + Intergenic
914058818 1:144189402-144189424 TGTATGGGAATCCTGAGGTTGGG + Intergenic
914120331 1:144776969-144776991 TGTATGGGAATCCTGAGGTTGGG - Intergenic
915812804 1:158933212-158933234 TATATGTGTATGTTTATGTTTGG - Intronic
916004843 1:160650211-160650233 TTTATGCTAATCCTAATGTAAGG - Intergenic
917658345 1:177151210-177151232 TTTTTTCGAATCCTTATGGTAGG + Intronic
918560670 1:185863243-185863265 TTTATGTGATTGCTTATTCTAGG + Intronic
918741923 1:188142782-188142804 TTTAGTTGAATCCTTTTGTCTGG - Intergenic
920147282 1:203872795-203872817 TTTATATATATACTTATGTTCGG + Intergenic
921098698 1:211909920-211909942 TGTATGTGAAGCCTTGTGCTAGG + Intergenic
921801021 1:219402462-219402484 TTGATGTGAATGCTTATCTTAGG - Intergenic
921830887 1:219725947-219725969 TTTATGTATTTCCTTATGATTGG - Intronic
921998639 1:221450174-221450196 TATATGAAAATCCTTATCTTGGG - Intergenic
1063286313 10:4692348-4692370 TTTATGTGTATGACTATGTTTGG + Intergenic
1063917741 10:10901530-10901552 ATAATGTGAAGCCTTATGTTAGG - Intergenic
1064596128 10:16947217-16947239 TTTATGTAAATCCTTTTTTATGG - Exonic
1065365946 10:24937014-24937036 ATCATTTGAATTCTTATGTTAGG + Intronic
1066033663 10:31456538-31456560 TTTGTGTGTATACTTATTTTGGG - Intronic
1066480357 10:35789549-35789571 CTTATGTGGCTCCTTCTGTTGGG + Intergenic
1066824245 10:39544377-39544399 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
1067704209 10:48594933-48594955 TGCATGTGAATCCTTATCTCAGG + Intronic
1068528357 10:58156808-58156830 CTTATCTAAATGCTTATGTTAGG - Intergenic
1071217339 10:83423582-83423604 GTAATGTGAATACTTAAGTTAGG + Intergenic
1072100286 10:92223278-92223300 TTTGTGTGATTCCTAATGTGTGG - Intronic
1072557452 10:96531879-96531901 TTTTTGTAAATCAGTATGTTAGG - Intronic
1076142066 10:128087212-128087234 TTTGTGATAATCCTGATGTTAGG + Intergenic
1076252220 10:128993848-128993870 TCTATGTGTACCATTATGTTTGG + Intergenic
1079017766 11:16884096-16884118 TTTATGTTCATCCTTGTGTATGG - Intronic
1079807816 11:24956665-24956687 TTTTGGTGATTTCTTATGTTTGG + Intronic
1081548458 11:44090042-44090064 TTTATGTGTATTCTTTTGTGTGG + Intergenic
1082164247 11:48925877-48925899 TTTCTGTGAATGCTTCTGTCTGG + Intergenic
1082323010 11:51100445-51100467 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082323362 11:51105545-51105567 TTTCTGTGAATTCTTCCGTTTGG - Intergenic
1082326933 11:51156776-51156798 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082330266 11:51205227-51205249 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082333053 11:51245686-51245708 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082338268 11:51321354-51321376 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082345084 11:51420809-51420831 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082346432 11:51440362-51440384 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082349657 11:51487109-51487131 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082349834 11:51489659-51489681 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082351124 11:51508189-51508211 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082352294 11:51525201-51525223 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082352588 11:51529451-51529473 TGTATGTGAATGCTTCCGTTTGG - Intergenic
1082354705 11:51560058-51560080 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082357309 11:51598307-51598329 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082360158 11:51640151-51640173 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082360399 11:51643550-51643572 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082361390 11:51657832-51657854 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082367467 11:51746234-51746256 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082370976 11:51797242-51797264 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082375491 11:51862702-51862724 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082376592 11:51878851-51878873 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082379954 11:51927304-51927326 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082380649 11:51937503-51937525 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082381353 11:51947832-51947854 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082381760 11:51953781-51953803 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082381880 11:51955484-51955506 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082385607 11:52009894-52009916 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082389335 11:52064296-52064318 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082395827 11:52158801-52158823 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082398167 11:52192801-52192823 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082398460 11:52197051-52197073 TTTAAGTGAATGCTTCCGTTTGG - Intergenic
1082399353 11:52209800-52209822 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082400244 11:52222553-52222575 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082400420 11:52225104-52225126 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082402530 11:52255872-52255894 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082403457 11:52269472-52269494 TTTGTGTGAATGCTTCCGTTTGG - Intergenic
1082403699 11:52272871-52272893 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082404926 11:52290722-52290744 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082405886 11:52304297-52304319 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082407627 11:52329464-52329486 TGTATGTGAATGCTTCCGTTTGG - Intergenic
1082408443 11:52341370-52341392 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082408860 11:52347320-52347342 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082412004 11:52392573-52392595 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082417664 11:52474178-52474200 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082419485 11:52500533-52500555 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082420133 11:52509882-52509904 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082420549 11:52515833-52515855 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082420722 11:52518384-52518406 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082421597 11:52531140-52531162 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082431394 11:52673077-52673099 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082433587 11:52704532-52704554 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082435358 11:52730034-52730056 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082438062 11:52769134-52769156 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082441347 11:52816722-52816744 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082441707 11:52821821-52821843 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082442007 11:52826071-52826093 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082444138 11:52856658-52856680 TTTCTGTGAATGCTTCTGTTTGG - Intergenic
1082445543 11:52877062-52877084 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082447940 11:52911918-52911940 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082448592 11:52921271-52921293 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082450003 11:52941677-52941699 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082452695 11:52980780-52980802 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082455533 11:53022432-53022454 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082459158 11:53075140-53075162 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082459930 11:53086190-53086212 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082460220 11:53090439-53090461 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082460868 11:53099787-53099809 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082461455 11:53108287-53108309 TTTTTGTGAATGCTTCTGTTTGG - Intergenic
1082461815 11:53113386-53113408 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082463989 11:53144840-53144862 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082464408 11:53150793-53150815 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082464525 11:53152493-53152515 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082464586 11:53153343-53153365 TGTATGTGAATGCTTCCGTTTGG - Intergenic
1082465124 11:53160995-53161017 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082465248 11:53162695-53162717 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082467232 11:53191603-53191625 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082468228 11:53206054-53206076 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082468818 11:53214556-53214578 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082468935 11:53216257-53216279 TTTAAGTGAATGCTTCCGTTTGG - Intergenic
1082470557 11:53239423-53239445 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082472411 11:53266623-53266645 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082472758 11:53271724-53271746 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082477868 11:53345683-53345705 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082478338 11:53352487-53352509 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082479276 11:53366090-53366112 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082480050 11:53377145-53377167 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082480166 11:53378851-53378873 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082481352 11:53395857-53395879 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082484223 11:53436671-53436693 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082484337 11:53438371-53438393 TCTCTGTGAATCCTTCCGTTTGG - Intergenic
1082487859 11:53489352-53489374 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082491262 11:53537411-53537433 TTTGTGTGAATGCTTCCGTTTGG - Intergenic
1082491787 11:53545061-53545083 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082491964 11:53547611-53547633 TTTGTGTGAATGCTTCCGTTTGG - Intergenic
1082496240 11:53609675-53609697 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082497886 11:53633466-53633488 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082500097 11:53665437-53665459 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082502726 11:53703697-53703719 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082507461 11:53772555-53772577 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082507582 11:53774256-53774278 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082510462 11:53815921-53815943 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082511163 11:53826123-53826145 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082511222 11:53826974-53826996 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082514663 11:53876299-53876321 TTTGTGTGAATGCTTCCGTTTGG - Intergenic
1082517608 11:53918806-53918828 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082523021 11:53997369-53997391 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082524558 11:54019480-54019502 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082526489 11:54047347-54047369 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082529493 11:54090714-54090736 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082530663 11:54107727-54107749 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082530723 11:54108578-54108600 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082530900 11:54111130-54111152 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082531724 11:54123036-54123058 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082531838 11:54124734-54124756 TTTGTGTGAATGCTTCCGTTTGG - Intergenic
1082536270 11:54189348-54189370 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082541593 11:54266040-54266062 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082542413 11:54277942-54277964 TGTCTGTGAATCCTTCCGTTTGG - Intergenic
1082542643 11:54281345-54281367 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082545038 11:54316203-54316225 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082545984 11:54329805-54329827 TGTCTGTGAATGCTTCTGTTTGG - Intergenic
1082547374 11:54349314-54349336 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082547523 11:54351362-54351384 TTTCTGTGAATGCTTCAGTTTGG - Intergenic
1082547681 11:54353406-54353428 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082547843 11:54355454-54355476 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082548000 11:54357502-54357524 TTTCTGTGAATGCTTCAGTTTGG - Intergenic
1082548152 11:54359549-54359571 TTTCTGTGAATGCTTCAGTTTGG - Intergenic
1082548465 11:54363643-54363665 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082548783 11:54367737-54367759 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082549170 11:54372855-54372877 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082549325 11:54374903-54374925 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082549624 11:54378999-54379021 TTTCTGTGAATGCTTCAGTTTGG - Intergenic
1082549775 11:54381046-54381068 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082550224 11:54387188-54387210 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082550377 11:54389235-54389257 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082550531 11:54391283-54391305 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082550684 11:54393331-54393353 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082550988 11:54397427-54397449 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082551141 11:54399475-54399497 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082551298 11:54401523-54401545 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082551454 11:54403571-54403593 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082551914 11:54409714-54409736 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082552236 11:54413809-54413831 TTTCTGTGAATGCTTCAGTTTGG - Intergenic
1082552530 11:54417900-54417922 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082552843 11:54421997-54422019 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082552996 11:54424044-54424066 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082553194 11:54526661-54526683 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082553347 11:54528709-54528731 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1082554170 11:54539787-54539809 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1085150115 11:74245009-74245031 TTTATGTGAAGGTTTATTTTTGG + Intronic
1085957166 11:81413347-81413369 TTTATGTCAAGTATTATGTTAGG + Intergenic
1086051598 11:82598335-82598357 ATTATGTGAAATCTGATGTTTGG - Intergenic
1086264780 11:84984746-84984768 TTTATGTGAGTCCTTATGTTAGG - Intronic
1086554079 11:88088798-88088820 TTGATGTGTAACCTTATTTTTGG - Intergenic
1087559226 11:99763332-99763354 TTTATGATTATCCTTTTGTTTGG - Intronic
1087977970 11:104573995-104574017 TTTATGTGAGTCTTAATGCTAGG + Intergenic
1088797734 11:113278031-113278053 TTCATGTGAATACATATGTATGG - Exonic
1090654225 11:128830502-128830524 TTTATGTGAATTCATCTATTAGG + Intergenic
1091270436 11:134307796-134307818 TTTATGATAATCCTCACGTTTGG - Intronic
1093147660 12:15586170-15586192 TATATGAGAATCCTTGTCTTGGG - Intronic
1094758642 12:33501701-33501723 TATATGTGTGTCCTTATGTCAGG + Intergenic
1095557588 12:43525634-43525656 TTTATATGAATCCTTGTGTTAGG - Intronic
1098010129 12:66042078-66042100 TGTATGTGAAACCTCATTTTTGG + Intergenic
1098500794 12:71189318-71189340 TTTATGTGAATCCTTATGTTAGG - Intronic
1098824499 12:75277122-75277144 CACATGTGAATGCTTATGTTAGG + Intronic
1099020827 12:77402104-77402126 TTTATGTCAATATTTATGATAGG + Intergenic
1099540850 12:83905378-83905400 TTTATTTGAACCATTAAGTTGGG + Intergenic
1099815671 12:87644355-87644377 TTTTTGTGAAAGCATATGTTTGG + Intergenic
1102616368 12:114158139-114158161 CTTATGTGAATCCATATATCAGG - Intergenic
1104267474 12:127248406-127248428 TTTATGTGAATGTTTATTTCTGG - Intergenic
1105112160 13:16635396-16635418 TTTATGAGAATGCTTCTGTCTGG - Intergenic
1105159161 13:17402568-17402590 TTTATGAGAATGCTTCTGTCTGG - Intergenic
1105984125 13:25548989-25549011 TTTATTTGTATTCTTATCTTTGG + Intronic
1106699345 13:32212182-32212204 TTCCTGTAAATTCTTATGTTTGG - Intronic
1106779912 13:33048788-33048810 TTTGTGTGAAACTTTTTGTTGGG + Intronic
1107590983 13:41905017-41905039 ATTATGTGAATCACTAGGTTTGG + Intronic
1107936266 13:45347739-45347761 TTTATTTGCATTATTATGTTTGG - Intergenic
1108007201 13:45961312-45961334 TTTATTGGGATCCTTATTTTTGG + Intronic
1109596897 13:64568410-64568432 TTTATGTGAGTCCATGTGTTAGG + Intergenic
1109938162 13:69321639-69321661 TTTATGTGAATTCTATTATTTGG - Intergenic
1110168898 13:72476155-72476177 TTTATGTATATCTTTATCTTGGG - Intergenic
1110567588 13:76971833-76971855 TTTAAGTGAAGCCTCATGTTGGG - Intergenic
1112706223 13:102072081-102072103 TTTACTTGCATCCTTATGTAAGG - Intronic
1113069217 13:106403571-106403593 GTTATGTGAATGTTTATGTTGGG - Intergenic
1113278577 13:108762931-108762953 TTTATGTTAATCCAGAAGTTGGG - Intronic
1114374242 14:22126585-22126607 TTTATTTGATTCATTATTTTGGG - Intergenic
1114955751 14:27816673-27816695 TTTATGTGAAACTTTCTGTTTGG - Intergenic
1115318581 14:32053265-32053287 TTTATATGCATCCTTATAATGGG - Intergenic
1116261070 14:42627456-42627478 TATATGTGAATCATTGTGGTAGG + Intergenic
1116334751 14:43642612-43642634 TGTATATGAATTCTTACGTTAGG - Intergenic
1116460292 14:45165213-45165235 TTAATGTGAATCTATATATTTGG - Intronic
1118529040 14:66681257-66681279 TTTATGTGAAAACTTATTTAAGG + Intronic
1122578027 14:102754112-102754134 TATATATAAATCCTTATTTTGGG + Intergenic
1124969834 15:34476429-34476451 TTTATGTGAATTCTTCTCTTAGG + Intergenic
1125068265 15:35518675-35518697 TTTATGTGAATCTGAAAGTTGGG - Intronic
1127930018 15:63589100-63589122 TTTATCTGAATCCATTTTTTAGG - Intronic
1131335007 15:91540358-91540380 TTTATCTGAATCCTTTGATTTGG + Intergenic
1131933950 15:97480292-97480314 TTTATTTCAATTCTTATTTTAGG - Intergenic
1132212925 15:100038224-100038246 TTTATGTCTATCCTTATGCCAGG + Intronic
1132361657 15:101221057-101221079 TTTATTTGTCTCCTTATTTTCGG + Intronic
1134343651 16:13368956-13368978 TATATGTGAATCTGTGTGTTTGG + Intergenic
1136591805 16:31222079-31222101 TTTCTTTTAATCCTTCTGTTGGG - Intronic
1138086919 16:54141862-54141884 TTAAAGTGAATCCATTTGTTTGG + Intergenic
1139049280 16:63103341-63103363 TATATGAGAATCCCTATCTTAGG + Intergenic
1140495229 16:75380742-75380764 TTTATGTTAATTCTTTGGTTTGG - Intronic
1140759455 16:78098170-78098192 ATGATGTGATTCCTTAGGTTTGG - Intergenic
1140926458 16:79589127-79589149 TTTGTGAGAATACTTAAGTTAGG - Intronic
1143133015 17:4692503-4692525 TTCATGTGAGACCTTATTTTAGG + Intronic
1145676062 17:26520449-26520471 TTTCTGAGAATGCTTCTGTTTGG - Intergenic
1145684979 17:26644749-26644771 TTTCTGTGAATGCTTGTGTCTGG - Intergenic
1147484472 17:40799042-40799064 TTTATGTGATTCATTATTTCAGG + Intronic
1149592290 17:57839585-57839607 GTTATGTGAACTTTTATGTTAGG - Exonic
1154383627 18:13873909-13873931 TTCATTTTACTCCTTATGTTGGG + Intergenic
1154962936 18:21328050-21328072 TTTATGTGGGTCCTGAAGTTAGG - Intronic
1155291895 18:24350812-24350834 TTTTTGAGAATTCTTATGTCTGG - Intronic
1155390953 18:25336068-25336090 TTTATTTGAGACCTTATTTTGGG - Intronic
1156705002 18:39870581-39870603 TTTATGTGATGCTTTTTGTTAGG + Intergenic
1157400102 18:47380094-47380116 TCTAAGTCAAGCCTTATGTTGGG + Intergenic
1157670640 18:49525530-49525552 TTCTGGTGAATGCTTATGTTAGG + Intergenic
1158966825 18:62629381-62629403 TTTATTTGACTCCTTGAGTTTGG - Intergenic
1159831359 18:73281822-73281844 TTTATGTAAATCTTTAAATTTGG + Intergenic
1164251957 19:23485268-23485290 TTTATTTGAGTCTTTATGTTAGG - Intergenic
1168574348 19:57496955-57496977 TTTATGTTATTCCTAATGTTGGG - Intronic
1168575999 19:57510467-57510489 TTTATGTTATTCCTAATGTTGGG - Intronic
1202698221 1_KI270712v1_random:141287-141309 TGTATGGGAATCCTGAGGTTGGG + Intergenic
925371786 2:3350743-3350765 TGTGTGTGAATCCGTATGGTAGG - Intronic
926522672 2:13935322-13935344 ATCATGTGAATCCTTTTGCTTGG + Intergenic
927627720 2:24740758-24740780 TTTATGTGAATCCAAAAGTGGGG - Intronic
928718624 2:34093329-34093351 TTTATCTTAGTCCTTCTGTTTGG + Intergenic
928885149 2:36139828-36139850 TTTATGTGAATCATTATTAGAGG + Intergenic
929641133 2:43581079-43581101 TTTATATAAATACTTGTGTTAGG + Intronic
929993143 2:46806310-46806332 ATTATATGAATCCTTATGTAGGG + Intergenic
930919790 2:56738896-56738918 CTTTTGTAAATCCTTCTGTTAGG - Intergenic
931958951 2:67460328-67460350 TTTTTGTCACTTCTTATGTTGGG + Intergenic
932094660 2:68837056-68837078 TTAAGGAGAATCCTTATATTGGG - Intergenic
932516548 2:72356617-72356639 TATATGTGATTCTTTAAGTTGGG - Intronic
934470311 2:94522310-94522332 TTTCTGTGAATGCTTCTGTCTGG + Intergenic
934481526 2:94651391-94651413 TGTATGTGAAACTTTCTGTTTGG + Intergenic
935302992 2:101709875-101709897 TTTTTGTGATACCTTTTGTTAGG + Intronic
939828463 2:147044519-147044541 TTTATGTGACTCTTTATGCATGG - Intergenic
941435255 2:165462526-165462548 TTTGTGTAAATCTTTATGATGGG - Intergenic
941841520 2:170089792-170089814 TTTCTGTGAATTGTTATATTAGG + Intergenic
942626029 2:177901621-177901643 TTTAAGTGAATCTTGATATTTGG + Intronic
942787225 2:179713675-179713697 TTTGTGCCAAGCCTTATGTTAGG - Intronic
943004002 2:182366665-182366687 TTTATGTAAAGCTTTATTTTGGG + Intronic
943793090 2:191957686-191957708 TTTATATGCATCATTATGATGGG + Intronic
943853556 2:192759564-192759586 TATACCTGAATTCTTATGTTTGG + Intergenic
944618893 2:201491221-201491243 TTTAGGTGAATTCTTGTGGTGGG + Exonic
945957845 2:216102877-216102899 TTAATATGAATCCTTGTGTCTGG + Intergenic
947091887 2:226521221-226521243 TGTATGTGAATCCCTGTGTTAGG + Intergenic
948566195 2:238888220-238888242 ATTATTTGAATTCTTATCTTTGG + Intronic
1169296405 20:4403659-4403681 TGTATGTGAAAACATATGTTTGG + Intergenic
1169517649 20:6334653-6334675 TATAACTGATTCCTTATGTTTGG + Intergenic
1170177390 20:13487418-13487440 TTTATATGAATCCTTGAGGTTGG - Intronic
1171129143 20:22632701-22632723 ATTATCTGGATCCTTGTGTTTGG - Intergenic
1171808356 20:29712156-29712178 TTTCTGAGAATGCTTATGTCTGG + Intergenic
1173129756 20:40379973-40379995 TTTTTGTGTATCCTTTTGTGTGG + Intergenic
1177126443 21:17199295-17199317 TTTATGTGAATCAGTATCTTTGG - Intergenic
951765312 3:26191227-26191249 TTTATGTGATTCCATATAGTAGG + Intergenic
952005473 3:28837615-28837637 ATTATGTGAATCCACATCTTGGG - Intergenic
952077226 3:29712013-29712035 TTTATGTGATTAATTATGGTAGG + Intronic
953247131 3:41204130-41204152 TTTATGTGAATGATTATTTCAGG + Intronic
954168987 3:48784898-48784920 TATATGTGATTCATGATGTTAGG + Intronic
955425521 3:58785597-58785619 TCTATGTGTATCCTTCTGGTGGG - Intronic
955744648 3:62127929-62127951 ATTGTGTGGATCCTTATGGTGGG + Intronic
958408214 3:93775797-93775819 TTTCTGAGAATCCTTCTGTCTGG + Intergenic
958659291 3:97044579-97044601 TTGATGGGTATCTTTATGTTAGG - Intronic
959328226 3:104966222-104966244 TTTATTTTAAGCCTTATCTTTGG + Intergenic
959466316 3:106691906-106691928 TCTCTGTGAAACCTTATATTTGG - Intergenic
960324141 3:116274481-116274503 TTCATGTGAACCCATATTTTAGG - Intronic
962930444 3:140030964-140030986 TTTATGTCAGCCCTTCTGTTGGG + Intronic
963373685 3:144436282-144436304 TTTACGTGAGTCCTTGTGTTAGG + Intergenic
963554261 3:146767932-146767954 TTTATTTGAAGCCTACTGTTTGG - Intergenic
964585406 3:158293407-158293429 TTTATGGGAAACCTTTTTTTGGG + Intronic
964772827 3:160242124-160242146 TTTATGTGAGTCCTTATGTTAGG - Intronic
965514064 3:169601724-169601746 TTTATGTGATTCTTTCTTTTGGG - Intronic
965541155 3:169872444-169872466 TTCTTGTCAATCCTTAGGTTTGG + Intergenic
966017239 3:175155505-175155527 TTAATGGCAATCTTTATGTTGGG + Intronic
967785624 3:193490989-193491011 TTTAAGCTAATCCTTTTGTTAGG - Intronic
970933016 4:21535726-21535748 TTTATGTTATTCCTTACTTTTGG + Intronic
971020504 4:22530517-22530539 TTTATTTGAAACCATATGTGTGG + Intergenic
971295990 4:25392441-25392463 TTTATGTGAATATTTATTATCGG + Intronic
973405140 4:49723103-49723125 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973413321 4:49857804-49857826 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973414104 4:49870724-49870746 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973416321 4:49907276-49907298 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973423836 4:50031365-50031387 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973427749 4:50096152-50096174 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973429119 4:50118767-50118789 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973430750 4:50145806-50145828 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973448768 4:50444546-50444568 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973456020 4:50564576-50564598 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973459274 4:50617642-50617664 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973467619 4:50754879-50754901 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973469888 4:50792245-50792267 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973472630 4:50837658-50837680 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973473498 4:50851764-50851786 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973475438 4:50883878-50883900 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973478144 4:50928931-50928953 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973490092 4:51126376-51126398 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
973499212 4:51276558-51276580 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
974060485 4:57029583-57029605 TTTATTTCACTTCTTATGTTGGG + Intronic
974670979 4:65029719-65029741 TTTATGTAAATGATTTTGTTAGG - Intergenic
975087646 4:70362495-70362517 GTTAGGTGACTCCATATGTTAGG - Intronic
976344701 4:83986816-83986838 TTTATGTGAATATTTATATGGGG + Intergenic
976571098 4:86611906-86611928 TTTCTTTGAATCCTTTTGTGTGG - Intronic
977276696 4:94986067-94986089 TTTATATAAATACTTATGTTTGG - Intronic
977935454 4:102797879-102797901 TTTATCTGAATCCTAGAGTTTGG + Intronic
978829993 4:113072358-113072380 CTTAAGTGACTCCTTATGTCTGG - Intronic
979189987 4:117845000-117845022 TTCATGAGAATCCTTGTCTTAGG - Intergenic
979645664 4:123064873-123064895 GTAATGTGACTCCTTTTGTTTGG + Intronic
979885636 4:126024584-126024606 TGTATGTGAATCTGTATGTGTGG + Intergenic
979890734 4:126090199-126090221 TGTATGTGAATCTGTATGTGTGG - Intergenic
980451658 4:132981165-132981187 TTTATGCGAATTCTTATTCTAGG + Intergenic
982491950 4:156040490-156040512 TTTCTGTGACTCCTTCTGTTAGG - Intergenic
982606483 4:157523088-157523110 TTTATGTGAATCATGAAGGTTGG + Intergenic
982918108 4:161240234-161240256 TTTATGTGAATGCTTAGCTAGGG - Intergenic
983335770 4:166389997-166390019 TTTATTTAAAACATTATGTTAGG + Intergenic
983375320 4:166920150-166920172 TTTATATGTATGCTTATGGTAGG - Intronic
983894707 4:173069780-173069802 TTTATGTCTTTCCTTATATTTGG + Intergenic
984651672 4:182277297-182277319 TTTCAGAGAAACCTTATGTTAGG + Intronic
986886538 5:12244607-12244629 TTAATGTGAAACATTATGATGGG + Intergenic
988711631 5:33783817-33783839 TTTATGTGAAAATTTATTTTGGG - Intronic
989090959 5:37730916-37730938 TTTATGTAAATCTTTATCTCAGG - Intronic
989135726 5:38152425-38152447 TTTATGTGAATCATCAGATTTGG - Intergenic
989333568 5:40288358-40288380 TTTATGTGAAACTTTATGTCAGG - Intergenic
989865017 5:46491533-46491555 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989865826 5:46505372-46505394 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989865983 5:46508104-46508126 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989866139 5:46510840-46510862 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989866292 5:46513574-46513596 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989866445 5:46516303-46516325 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989866908 5:46524507-46524529 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989867260 5:46530189-46530211 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989867339 5:46531557-46531579 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989867652 5:46537019-46537041 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989867811 5:46539748-46539770 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989868420 5:46550786-46550808 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989868622 5:46554043-46554065 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989869262 5:46565297-46565319 TTTCTGAGAATCCTTCTGTCTGG - Intergenic
989935148 5:50012772-50012794 TTTCTGTGAATCCTTCCGTCTGG - Intergenic
989937719 5:50050428-50050450 TTTCTGTGAATCCTTCTGTCTGG - Intergenic
990125486 5:52511932-52511954 TTTATGTGCCTCCTGATGTGAGG + Intergenic
990597426 5:57325585-57325607 TTACTGTGTATCCTTATCTTGGG + Intergenic
992333943 5:75746104-75746126 TTTATTTGAATCTTTATCTCAGG - Intergenic
992699099 5:79322344-79322366 TTTATGTGCATCCTTGTTTATGG + Exonic
993191655 5:84690622-84690644 TATATATGAATCCATATATTTGG - Intergenic
993384137 5:87243833-87243855 TATATTTGAATCATTATTTTGGG - Intergenic
994847587 5:105009672-105009694 TTTATGTGGATCTTTGTGATGGG + Intergenic
995592898 5:113717971-113717993 TTTATGTGAATCTGCATCTTAGG + Intergenic
995848171 5:116516717-116516739 TTAATGTGAAATCTTATCTTTGG + Intronic
996657286 5:125956190-125956212 TTTATGTGAATCTTTATGTTAGG - Intergenic
999108862 5:149097750-149097772 TTTATGTGAGTCCTTAATGTTGG - Intergenic
999169637 5:149582250-149582272 TTTGTGTGAACCCTTCTGCTGGG - Intronic
1000711920 5:164590972-164590994 TGAATGTGAATTTTTATGTTAGG - Intergenic
1000916042 5:167083057-167083079 TTTATGTAAATCTTTCTTTTGGG - Intergenic
1002889729 6:1322032-1322054 ATTATGTTAATGTTTATGTTTGG - Intergenic
1003077122 6:2992343-2992365 GTGTTGTGAATTCTTATGTTGGG + Intronic
1004212763 6:13668298-13668320 TTAATGTTAATTTTTATGTTTGG - Intronic
1006526343 6:34608826-34608848 TTTATTTGAACCCTTAGCTTTGG - Intronic
1007158886 6:39772975-39772997 TTTATGGGAATCCGCATGTAAGG - Intergenic
1007434841 6:41802720-41802742 AATATGTGGATGCTTATGTTTGG - Intronic
1009332316 6:62439379-62439401 TTTATGTGAGTCCTTATGTAAGG + Intergenic
1009644572 6:66381551-66381573 TTTATGTAAGTCCTTGTGTCAGG + Intergenic
1009719925 6:67455696-67455718 TTTATGTGATTCCTTTTATAAGG + Intergenic
1009777250 6:68219917-68219939 TTTATGCTAATCTTTCTGTTGGG + Intergenic
1009881609 6:69573409-69573431 TTCATTTGAATCCTTAAGCTTGG - Intergenic
1010115414 6:72301400-72301422 TTCATGTTGATCCTTATTTTTGG - Intronic
1010528637 6:76938378-76938400 TTTATGTCTATCCTTATGTCAGG - Intergenic
1010707716 6:79134794-79134816 TCTGTGAGAATCCTTATATTTGG + Intergenic
1011202951 6:84857628-84857650 TTTATTTGATTCCTTTTGTATGG + Intergenic
1012203213 6:96432160-96432182 TTTATGTGAGTTCTTATGTTAGG + Intergenic
1012880915 6:104788108-104788130 TTTATTTGAATCCTTTTTGTTGG - Intronic
1014496827 6:122135241-122135263 TTAATGTTAAGCCTCATGTTGGG - Intergenic
1016530157 6:145050352-145050374 TTCATTTTACTCCTTATGTTGGG + Intergenic
1016718467 6:147263692-147263714 TTTAAGTGAGTCCTTCTGTTTGG + Intronic
1016775575 6:147900932-147900954 TTTATTTGAATACTTAGGTAGGG + Intergenic
1017928737 6:158933967-158933989 TTTATGTGAATCCTTAACTTAGG + Intergenic
1023462687 7:40417364-40417386 TTTATCTATATCCTAATGTTTGG + Intronic
1024359476 7:48453810-48453832 TTTATCTCAACCCGTATGTTGGG + Intronic
1024445921 7:49478997-49479019 TTTCTTAGAATCCTTGTGTTGGG + Intergenic
1027579335 7:79974661-79974683 TTGAAGTGAAACATTATGTTTGG - Intergenic
1028804195 7:95006155-95006177 TTTATTTTAATCCTTATGAAAGG - Intronic
1031655684 7:124351674-124351696 TTTATATGCATCTTTATGTAAGG - Intergenic
1034058666 7:148065667-148065689 TTTATGTGAGTCCTTATGTTAGG + Intronic
1034222343 7:149456102-149456124 TTTATGTGTATACTTGTCTTTGG - Intronic
1036019246 8:4824638-4824660 GTTATGAGATTCCTTCTGTTGGG - Intronic
1040040021 8:42906279-42906301 TTTATGTGTATTCTTATGCATGG + Intronic
1040143314 8:43954737-43954759 TTTCTGGGAATCCTTCTGTCTGG - Intergenic
1040272017 8:45961965-45961987 TTTCTGGGAATCCTTCTGTCTGG - Intergenic
1040739153 8:50550431-50550453 TTTATTTGATTGCTTATGTTAGG + Intronic
1041529175 8:58843263-58843285 TTTATGTGTATCCTTTAGATTGG - Intronic
1042832567 8:73048142-73048164 TTTTTTTGAATCCTTTTTTTTGG + Intergenic
1042974713 8:74454764-74454786 TTTATTTGTATCATTATATTTGG - Intronic
1044136299 8:88590506-88590528 TTTATTTGAATACTTAATTTGGG + Intergenic
1045039247 8:98205786-98205808 TATATGTGAGCCCTTTTGTTAGG + Intronic
1046135744 8:110024530-110024552 ATTACGTGAATTCATATGTTGGG - Intergenic
1046785637 8:118263270-118263292 TTCATTTTAATCCTTATGTGTGG + Intronic
1047708276 8:127524295-127524317 TTTATGTGCACCCTGAAGTTAGG + Intergenic
1048312218 8:133333051-133333073 TTTATCTCTATCCATATGTTCGG + Intergenic
1051287887 9:15514653-15514675 TGTATGTTAATCCTTATGATGGG + Intergenic
1051988191 9:23117432-23117454 TTTAAGTTGTTCCTTATGTTGGG - Intergenic
1052101867 9:24456799-24456821 TTTATGTCAAACATTCTGTTGGG - Intergenic
1052497967 9:29252463-29252485 TGTAAGTGAATCCTAATTTTGGG + Intergenic
1052522622 9:29568224-29568246 TTGATGTGAACCCTGCTGTTTGG + Intergenic
1052669921 9:31543226-31543248 TTTTTGTGTATCTGTATGTTTGG - Intergenic
1053712990 9:40842338-40842360 TTTCTGTGAATGCTTCTGTCTGG - Intergenic
1054064013 9:45332822-45332844 TTTATGAGAATGCTTCTGTCTGG - Intergenic
1054082387 9:60636221-60636243 TTTCTGAGAATGCTTCTGTTTGG + Intergenic
1054423522 9:64975589-64975611 TTTCTGTGAATGCTTCTGTCTGG - Intergenic
1055265797 9:74494830-74494852 TTTATTTGAATGATTATGTCTGG - Intergenic
1055769290 9:79699970-79699992 TCTATTTTAAACCTTATGTTAGG - Intronic
1056062788 9:82901115-82901137 TCTCTCTGAATCCTTCTGTTAGG - Intergenic
1056978744 9:91286566-91286588 ATTATGTGATTCCTAATGTTAGG - Intronic
1057089878 9:92247769-92247791 TTAATGTGAAACATTATGCTAGG + Intronic
1059359234 9:113727170-113727192 TTTATTTGATCCCTGATGTTTGG + Intergenic
1203341287 Un_KI270418v1:703-725 TTTCTGTGAATGCTTCCGTTTGG + Intergenic
1203341199 Un_KI270419v1:405-427 TTTCTGTGAATGCTTCGGTTTGG - Intergenic
1203341489 Un_KI270420v1:1463-1485 TTTCTGTGAATGCTTCCGTTTGG + Intergenic
1203341894 Un_KI270423v1:716-738 TTTCTGTGAATGCTTCCGTTTGG - Intergenic
1203355749 Un_KI270442v1:140422-140444 TTTCTGAGAATCCTTCTGTCTGG + Intergenic
1203593737 Un_KI270747v1:100094-100116 TTTATGAGAATGCTTCTGTCTGG - Intergenic
1186493527 X:9993663-9993685 TTTATGTTTATCTTTATGTCGGG + Intergenic
1186738885 X:12496256-12496278 TTTAAGTGGATACTTTTGTTTGG + Intronic
1186756835 X:12679919-12679941 TGTTTGTGAATCCTTGTCTTAGG + Intronic
1188029004 X:25243312-25243334 CTTATCTGAACCCTTATTTTTGG + Intergenic
1188069577 X:25702619-25702641 TTTATTTCAATCCCTATTTTAGG + Intergenic
1188187575 X:27133512-27133534 TTTATGTGAATCCATGTGTCTGG + Intergenic
1189567398 X:42257003-42257025 TTTATGTGAGTCCTTGTGTTAGG - Intergenic
1190717829 X:53118936-53118958 TTTATGTGGATCCTCATCATTGG + Intergenic
1190894709 X:54605616-54605638 TTTAGGTGAACCATTGTGTTGGG + Intergenic
1191180999 X:57563581-57563603 TTTATGTGTGTCTTTATGTGTGG - Intergenic
1191269880 X:58451517-58451539 TTTCTCTGAATCCTTCTGTCTGG - Intergenic
1191566666 X:62545117-62545139 TTTCTGAGAATTCTTCTGTTTGG - Intergenic
1191590260 X:62875214-62875236 TTTATATTATTCCTTATGCTTGG - Intergenic
1192873845 X:75208866-75208888 TTTCTGTTAATCCTGAAGTTTGG - Intergenic
1192982170 X:76356377-76356399 TTTATACGAATCCTTATGTCAGG - Intergenic
1193208538 X:78778020-78778042 TTTATGTGAGTCCTTGTGTTAGG + Intergenic
1194108322 X:89799114-89799136 TTAATGTGATTTCTTCTGTTTGG + Intergenic
1194187412 X:90790711-90790733 TTGATGTGTAGCCTTATTTTTGG - Intergenic
1194527311 X:94992760-94992782 TTTTTGTAATTCTTTATGTTTGG + Intergenic
1194950818 X:100123554-100123576 TTTATGTGAATCTGTATTTGAGG - Intergenic
1194957658 X:100199773-100199795 TTAATATGAAGCCTTATCTTTGG + Intergenic
1195399221 X:104444355-104444377 TTTATTTCATTCCTTTTGTTTGG + Intergenic
1196530879 X:116784824-116784846 TTTATGTGAGTTCTTATGTTAGG - Intergenic
1196822950 X:119717824-119717846 TCTATGTCTATCCTTATGCTAGG - Intergenic
1197911183 X:131483926-131483948 TTTATGTGAGTCCTTATGTTAGG - Intergenic
1200460982 Y:3453850-3453872 TTAATGTGATTTCTTCTGTTTGG + Intergenic
1200534006 Y:4372664-4372686 TTGATGTGTAGCCTTATTTTTGG - Intergenic
1202581413 Y:26384974-26384996 TTAATTTGAATACTTATGATGGG - Intergenic