ID: 1098500797

View in Genome Browser
Species Human (GRCh38)
Location 12:71189332-71189354
Sequence TCACATAAACTGAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2290
Summary {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098500794_1098500797 -9 Left 1098500794 12:71189318-71189340 CCTAACATAAGGATTCACATAAA 0: 1
1: 5
2: 7
3: 27
4: 453
Right 1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993
1098500792_1098500797 23 Left 1098500792 12:71189286-71189308 CCAACAAGTATCTGCTGCATTCA 0: 1
1: 0
2: 4
3: 32
4: 157
Right 1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG 0: 5
1: 338
2: 491
3: 463
4: 993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098500797 Original CRISPR TCACATAAACTGAAGGTAAA GGG Intronic
Too many off-targets to display for this crispr