ID: 1098502359

View in Genome Browser
Species Human (GRCh38)
Location 12:71207566-71207588
Sequence TGAGACTCCTTGGAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 3, 2: 15, 3: 36, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098502359 Original CRISPR TGAGACTCCTTGGAAAAAAC AGG Intronic
901355869 1:8648241-8648263 TGAGACCCCATCGCAAAAACAGG - Intronic
901689868 1:10965686-10965708 TGAGACTACTTGGTAAAGGCGGG - Intronic
902724563 1:18326047-18326069 TGCTACTCCCTGGAAAAAAAAGG - Intronic
903790666 1:25890796-25890818 AGAGACCATTTGGAAAAAACTGG + Intronic
905322652 1:37128890-37128912 TGAGAGTCCATGGAAGAGACTGG + Intergenic
905371602 1:37485425-37485447 TGAGGCTGCCTGGAAAAAATAGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG + Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911215170 1:95185164-95185186 TGACTCTCCTTTCAAAAAACTGG + Intronic
911315617 1:96353184-96353206 TGAGACCCCCTGGAAAAGACAGG - Intergenic
915997525 1:160578802-160578824 TGAGACTATTTGTAAAAAATGGG + Intronic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
918296674 1:183163569-183163591 TGAGACTCCTTGATACAAAAGGG + Intergenic
918621628 1:186612116-186612138 TGAGACCCCTTGTAGAACACAGG - Intergenic
918748722 1:188242533-188242555 TGAGCTTCTTTGGTAAAAACTGG + Intergenic
919354171 1:196500130-196500152 TGAGACTCCATCAAAAAAAAGGG + Intronic
919497962 1:198300453-198300475 TGAGTTTCTTTGGAAAGAACAGG - Intronic
919824258 1:201492607-201492629 TGATACTGCTTGGAAATAAAGGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920619235 1:207527721-207527743 AGAGAGTCCCAGGAAAAAACTGG + Intronic
920621017 1:207546276-207546298 AGAGAGTCCCAGGAAAAAACTGG + Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921782471 1:219182161-219182183 TGAGACTCATTAGTTAAAACTGG - Intronic
921881013 1:220253959-220253981 TCAGCCTCCTTGGAAGAAAAGGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923510244 1:234645217-234645239 TGACATTTGTTGGAAAAAACTGG - Intergenic
923511009 1:234653442-234653464 TGAAACTCCTAGAAGAAAACAGG + Intergenic
923522093 1:234743015-234743037 TGAGTCTTGTTGGAGAAAACGGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063218082 10:3942074-3942096 TGAGACTCTGTGGAAAAAAAAGG + Intergenic
1066425622 10:35305087-35305109 TGACATTGCTTGGAGAAAACCGG + Intronic
1067220477 10:44340560-44340582 TGAGACTCACTGGTAAAAAATGG + Intergenic
1067781731 10:49212645-49212667 TGAGACTCCATTGAAAGAAAGGG + Intergenic
1068177656 10:53482602-53482624 TGAGAATACTTTGTAAAAACTGG - Intergenic
1068181377 10:53523167-53523189 TATGATTCCTAGGAAAAAACAGG + Intergenic
1070275627 10:75003498-75003520 TGACACTTGTTGGAAAATACTGG + Intronic
1071236278 10:83653358-83653380 TAAAACTCCTGGGAAATAACAGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072520779 10:96228109-96228131 TGAGACTCCATCTCAAAAACAGG - Intronic
1073854284 10:107656840-107656862 TGACCCTTCTTGGAAAAAAATGG - Intergenic
1073900005 10:108209110-108209132 TGAGACATCTTGGAGAAAATTGG + Intergenic
1079557258 11:21774683-21774705 TAAAACTCCTTGAAAGAAACGGG - Intergenic
1079884954 11:25975831-25975853 TGAGCCTCATTGGAAAAAGAGGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080892797 11:36424075-36424097 TGAGTCTCCGTGGAAAAAAATGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083090155 11:60191312-60191334 TGATCCTCCCTGGAAAAAAGGGG + Intergenic
1083911824 11:65714281-65714303 TGAGACTCCATCTAAAAAATGGG + Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1086065024 11:82734532-82734554 TGAGAATCCTGGGAAAACTCAGG - Intergenic
1086415263 11:86582852-86582874 TCAGACTCGGTGGAAACAACTGG - Intronic
1086534368 11:87826524-87826546 TAACTCTCCTTGGAAAAGACAGG + Intergenic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1091790104 12:3267244-3267266 TCAAACTCCTTGGAAAATGCAGG - Intronic
1092803847 12:12200433-12200455 TCAGCCTCCTTGGAAGAAAAGGG - Intronic
1093410192 12:18856099-18856121 TGAAACTCCTAGAAGAAAACAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1096577944 12:52566231-52566253 TGAGCATCCTTGGAACAGACTGG - Exonic
1096913816 12:55010724-55010746 TGTTACTCCTTGGAGAAGACGGG + Intergenic
1097083271 12:56448950-56448972 TGAGACCTCCTGAAAAAAACCGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097897167 12:64836445-64836467 TAAGACTGCTTTGTAAAAACTGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099314258 12:81064942-81064964 ACAGACTACCTGGAAAAAACGGG + Intronic
1100930931 12:99608752-99608774 TGAGACCCCTTGAAAAACACAGG - Intronic
1101438686 12:104686276-104686298 TTAGACTCCTAGGAAAAGTCAGG - Intronic
1103594340 12:122014716-122014738 TGAGACTCTCTTAAAAAAACAGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107758120 13:43647811-43647833 TGAGTTTACTTGGAAAATACAGG - Intronic
1109838689 13:67893404-67893426 TGAGAGTCCTTTAAAAAAAATGG - Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110094458 13:71499048-71499070 TGAAATTTCTTGGAAAAAAATGG + Intronic
1111737578 13:92162115-92162137 TTAGACTTCAGGGAAAAAACAGG - Intronic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114788325 14:25626545-25626567 TGAGATTTCTGGGAGAAAACAGG - Intergenic
1115261930 14:31463218-31463240 TCAGTCTCCTTGGAAAGAAAAGG - Intergenic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1117386785 14:55222713-55222735 GGAGTTTCCTTGGAAAGAACAGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119930588 14:78542570-78542592 ACAGACTACCTGGAAAAAACGGG - Intronic
1120821345 14:88914531-88914553 TGAGACTACATGCAAAAAAGGGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1124044267 15:26134092-26134114 AAAGACTCCTTGGAAACAAATGG + Intergenic
1126692928 15:51301768-51301790 TTAGAATCCTCGGAAAATACTGG + Intronic
1128565075 15:68695734-68695756 TGTGGGTCCTTGGAAAAATCAGG - Intronic
1134288022 16:12879288-12879310 TGAGACTCCTTCTCAAAAAAGGG - Intergenic
1134388724 16:13798309-13798331 TGAGAAACCTTGAAAAAACCTGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136571328 16:31098933-31098955 TGAGACACCCTGGACAACACAGG + Intergenic
1137420702 16:48331290-48331312 TGATACTGCTTGGAATATACCGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139269905 16:65672142-65672164 TGAGACTACTTAGAAAAAGGGGG + Intergenic
1139723670 16:68878068-68878090 TCATATTCCTTGCAAAAAACTGG + Intronic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1147531810 17:41286122-41286144 GGGGAATGCTTGGAAAAAACTGG - Intergenic
1147949025 17:44096774-44096796 TGAGACTCCATCTAAAAAAAAGG - Intronic
1150925658 17:69529102-69529124 TGAGAATCATTGGATTAAACTGG - Intronic
1153831245 18:8925202-8925224 TGAGATTAGTTTGAAAAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1156197670 18:34793939-34793961 TGAGATACCTAGAAAAAAACAGG + Intronic
1156746949 18:40403718-40403740 TGAGACATTTTGGCAAAAACGGG - Intergenic
1156794049 18:41019037-41019059 TGAGACTGCTGGAAGAAAACAGG + Intergenic
1156882049 18:42092489-42092511 TGTGACTACCTGGATAAAACAGG + Intergenic
1157191544 18:45586309-45586331 TGAGGCTCCTTGGACAAGGCAGG - Intronic
1158027140 18:52913673-52913695 TGAGACTCTTGGGAAAAAACAGG - Intronic
1159168972 18:64737943-64737965 TGAAACTTATTGGAAAAAATTGG - Intergenic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1164383452 19:27754280-27754302 AGAGACACCTGGGTAAAAACAGG - Intergenic
1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166523457 19:43496369-43496391 TGAGACCCTTGGGAAAAAATGGG - Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167718758 19:51162816-51162838 TAAAACTCCTTGAAGAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168463442 19:56582064-56582086 TTAGAATCTTTGGAAAAATCAGG + Exonic
925769491 2:7268096-7268118 TAAGATTCCTTGGAAAAAGAAGG + Intergenic
926651501 2:15351663-15351685 TGAGACTCCATAGAAAAAAAAGG + Intronic
928110518 2:28505061-28505083 TGAGGCTCCCTAGAAAAACCAGG + Intronic
930047582 2:47186706-47186728 AGAGAAGCCTTGGAAAGAACAGG + Intergenic
930284152 2:49407048-49407070 TGAGACTACTAGAATAAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
937415125 2:121708595-121708617 CAAGACTCCTTCAAAAAAACAGG - Intergenic
938907882 2:135856071-135856093 TCAGTCACCTTGAAAAAAACTGG - Intronic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941663341 2:168217781-168217803 TGAAAATACTTGGAAAAAAATGG - Intronic
943948708 2:194101110-194101132 TGAGAGTCCTAGGAAAACATGGG + Intergenic
947393256 2:229661805-229661827 AGTGACCCCTTTGAAAAAACTGG + Intronic
947480492 2:230495078-230495100 TGAGACTCTTTGGCAAGGACAGG + Intronic
948160884 2:235823103-235823125 AGAAACTACTTGGAAAAAATAGG - Intronic
948651913 2:239451705-239451727 TGATATTCTTTGGAACAAACTGG + Intergenic
1170386128 20:15818722-15818744 TGAAACTCCTCTGAAAAGACTGG + Intronic
1174975972 20:55334530-55334552 TGAGACTCCTCAGAAGACACAGG - Intergenic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1178449063 21:32675716-32675738 TGAGATTCCTAGGAATAAATAGG + Intronic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1182070537 22:27460525-27460547 TGAGGCTGCTTGGAGAAAGCTGG - Intergenic
1182243611 22:28936848-28936870 TGAGACTCCTTGGACAGTGCAGG - Intronic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1184595553 22:45511979-45512001 TGAAACTCCTCCGAAACAACAGG + Intronic
949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950845700 3:16013832-16013854 TGAAACTCCTAGAAAATAACAGG - Intergenic
950958339 3:17079135-17079157 TGAGAGCCCTTGGAAACACCAGG - Intronic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
957327335 3:78713348-78713370 TAAGACTACTTAGAAAAAAAAGG - Intronic
958734198 3:97990048-97990070 TGAGATGCCTTGGAAGAAATAGG - Intronic
958744926 3:98121964-98121986 TGAAATTCCTTTCAAAAAACTGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964337453 3:155670919-155670941 TGATATTCCTTGGAATAAATGGG - Intronic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
965401471 3:168218039-168218061 TGAGAGTCCTGGGAAATAAAAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965637307 3:170796159-170796181 TAAAACTCCTTGAAAAAAATAGG - Intronic
969684393 4:8662386-8662408 TGAGACTCCGTCTCAAAAACAGG + Intergenic
970651002 4:18177808-18177830 TGAGAATTCTTGAAAGAAACTGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972312925 4:37898293-37898315 TAAAACACCTTGGAAAAAAGAGG + Intronic
972730138 4:41786737-41786759 AGAGACTCTTAGGACAAAACTGG - Intergenic
972805567 4:42526910-42526932 TGATAGTCCTTGGCATAAACTGG + Intronic
973839181 4:54843487-54843509 TGAGACTGCTTAGAAAAAGTAGG - Intergenic
974017418 4:56660859-56660881 TGGGACTCCGGGAAAAAAACAGG - Intronic
977961445 4:103089650-103089672 TGAGACTCATTTGCAAAACCAGG - Intronic
978052110 4:104214191-104214213 TGGGACTACTTTGAAAAGACTGG - Intergenic
979299326 4:119068500-119068522 TAGGATTCCTTAGAAAAAACAGG - Intergenic
980233615 4:130075365-130075387 AGAGACTGCTTTGAATAAACGGG + Intergenic
981827406 4:148959329-148959351 TGAAACTTCTGGGAAATAACTGG + Intergenic
982359803 4:154507224-154507246 TGATACTGCTTTGCAAAAACAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986224775 5:5802382-5802404 TGAGAATCCATGAAAAAAAGAGG + Intergenic
987349321 5:17007455-17007477 TGAGACTCCATCTAAAAAAAAGG + Intergenic
987570005 5:19644937-19644959 TGAAAGTCCCTGGAAAAACCTGG - Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989832731 5:45940498-45940520 TGAATATCCTAGGAAAAAACTGG + Intergenic
990322010 5:54639260-54639282 TGATACACCTTCAAAAAAACTGG - Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
990907256 5:60817959-60817981 TGAGACTTGTTTAAAAAAACTGG + Intronic
991552076 5:67849570-67849592 TTATACTCATTGGAAAAAATTGG + Intergenic
992519102 5:77531046-77531068 TAAAACTCTTAGGAAAAAACAGG + Intronic
1000778497 5:165449126-165449148 TGAGACAACATGGACAAAACTGG + Intergenic
1003035764 6:2639156-2639178 GGCGACACCCTGGAAAAAACAGG - Intergenic
1003705275 6:8521228-8521250 TGAAACTCCATTGAAAACACTGG + Intergenic
1004096757 6:12562562-12562584 TGAGACTCCATAAAAAAAAAAGG + Intergenic
1009562561 6:65267485-65267507 TGAAACCCCATGGAAAACACTGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010097347 6:72062475-72062497 TGAGATTCTTTAGAAAAAACGGG - Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010130661 6:72489600-72489622 TCAGACTCCTTGTAGAAAGCTGG + Intergenic
1010550316 6:77213889-77213911 CAAGACTGCTTGGAAAAAAAGGG + Intergenic
1010653623 6:78484777-78484799 TGTGACCACTTGGAAAAAAATGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010822975 6:80437377-80437399 TGAGGCTCTTTGCAAAAAAAAGG - Intergenic
1011009379 6:82686581-82686603 TTATAGTCCTTGGAAGAAACAGG + Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016795789 6:148115790-148115812 TGAGAGACCATGGAAAAATCTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018179814 6:161212995-161213017 AAAAACCCCTTGGAAAAAACTGG + Intronic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1018889655 6:167974587-167974609 TGTGACTTTTTGGAATAAACTGG + Intergenic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020415410 7:7940543-7940565 TGAGAATCCTTGGAAGACAGTGG - Intronic
1022611382 7:31877395-31877417 TGAGAGTCTTTGGAAAACAATGG + Intronic
1022995241 7:35748748-35748770 TGAGAAACATTGGATAAAACTGG - Intergenic
1023249008 7:38237535-38237557 TGAGACTCCTTCTCAAAAAAAGG + Intergenic
1024563734 7:50664820-50664842 TGTGACTCATTTGAAAAGACAGG - Intronic
1024812821 7:53234072-53234094 TGTCACTCCTTGGTCAAAACTGG - Intergenic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1024832391 7:53476405-53476427 TGAGAGTAATTGGAAAATACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026367523 7:69663790-69663812 TAAGCCTTCTTGGAAATAACAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032599806 7:133281371-133281393 AAAGACTCCATGGAAAAAATTGG + Intronic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1042015863 8:64310330-64310352 TGAAAATCCTTGAAGAAAACAGG + Intergenic
1043101007 8:76045705-76045727 TGAGAGTCAGTGGAAAGAACAGG + Intergenic
1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG + Intergenic
1046117400 8:109800759-109800781 TCAGACTCCATGGAGAAAATGGG - Intergenic
1046228605 8:111321607-111321629 TGAAACTACTAGGAGAAAACTGG + Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048505728 8:135019327-135019349 TGAGACTCCATCTTAAAAACAGG + Intergenic
1048880777 8:138870964-138870986 TGAGACTCCCTGGTAAACTCAGG - Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050948270 9:11553364-11553386 TGAAACTCCTAGGAGAAAATAGG - Intergenic
1051368445 9:16337958-16337980 TGAGATTCCTTTGAAATAACAGG + Intergenic
1051769409 9:20560045-20560067 TGAGACTGCTTGAAAAGTACAGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053230473 9:36403517-36403539 TGAGGCTCCCTTTAAAAAACTGG + Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056432199 9:86539081-86539103 TGAAACTCTTAGGAGAAAACAGG + Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056920495 9:90783893-90783915 TGAGGCTCCTTGGACAAAGAGGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058683738 9:107463049-107463071 TGAGACTCTTTGGAAATGATAGG - Intergenic
1060038931 9:120283168-120283190 TGGGACTCATTGGAAAAATTTGG - Intergenic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1060968677 9:127725609-127725631 TGAGACTCCATCTAAAAAAAAGG - Intronic
1186934840 X:14437265-14437287 TGAAACTGCTAGGAGAAAACAGG - Intergenic
1186977482 X:14923662-14923684 TGAGACTCTTTGGACATTACAGG - Intergenic
1187012182 X:15290972-15290994 TAAAACTACTTGGAAAATACAGG + Intronic
1187779687 X:22805494-22805516 TGAGACTTTGTGGAAAAAAAAGG + Intergenic
1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG + Intronic
1190801392 X:53792624-53792646 TAAAACTCCTAGAAAAAAACAGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191036790 X:56033318-56033340 TGCGACACCGTGGATAAAACTGG - Intergenic
1191246205 X:58230224-58230246 AGAGACTCCTGGCCAAAAACAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195090864 X:101457752-101457774 TGAGACTCCGTCTAAAAAAAGGG - Intronic
1197234382 X:124043001-124043023 TGAGACTCCATCAAAAAAAAAGG + Intronic
1197551277 X:127895711-127895733 TGAGAGTCCTGGAAAAAAACAGG + Intergenic
1197665729 X:129221276-129221298 GGAGCCTCCTTAGAAAAAAATGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198973228 X:142304634-142304656 TGAGACTTGATGCAAAAAACTGG - Intergenic
1202039935 Y:20671458-20671480 TGAGATTTTTTTGAAAAAACAGG - Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic