ID: 1098502563

View in Genome Browser
Species Human (GRCh38)
Location 12:71210505-71210527
Sequence GTGTCCTTCTAGAAGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098502563_1098502568 18 Left 1098502563 12:71210505-71210527 CCTTTATTCTTCTAGAAGGACAC 0: 1
1: 0
2: 2
3: 36
4: 193
Right 1098502568 12:71210546-71210568 TCCATGGTTTAAAATAAAAGAGG 0: 1
1: 20
2: 26
3: 67
4: 397
1098502563_1098502566 2 Left 1098502563 12:71210505-71210527 CCTTTATTCTTCTAGAAGGACAC 0: 1
1: 0
2: 2
3: 36
4: 193
Right 1098502566 12:71210530-71210552 TTTATTAGGTCCTTTTTCCATGG 0: 3
1: 41
2: 41
3: 47
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098502563 Original CRISPR GTGTCCTTCTAGAAGAATAA AGG (reversed) Intronic
900836744 1:5010717-5010739 GTGTCCTTAGAGAAGGAGAAGGG - Intergenic
905470735 1:38189833-38189855 GTTTCCTTCTAGAAGATCTAGGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
911412951 1:97533748-97533770 TTCTCCTTCTAGAAATATAAGGG - Intronic
912238408 1:107878443-107878465 ATGTCATTAAAGAAGAATAAAGG - Intronic
915273017 1:154768568-154768590 GTGTCCTACTAGAAGCAAACGGG + Intronic
916444038 1:164855473-164855495 GTGACTTTCTAGAAAAAAAATGG - Intronic
916483597 1:165236960-165236982 GTTTCCTTCTACAAGAATGTAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918673249 1:187247830-187247852 GTTTTCTTCTAGAAGTATTATGG - Intergenic
919085621 1:192917480-192917502 GTGTCCTTCTTGAGGTATGATGG - Intergenic
919106516 1:193158732-193158754 GTGTCCGCCTAGCAGTATAAAGG + Intronic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
919967219 1:202539811-202539833 GTGTCCTTTGAGGAGAATCAAGG + Intronic
921329255 1:214019360-214019382 GTGCCCTTCTAGCAGAAGACAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923610610 1:235489390-235489412 TTGTCTGACTAGAAGAATAAAGG - Intronic
1063053914 10:2483102-2483124 GTGTCCTTTAAGAAGATAAAAGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1065989974 10:30999465-30999487 GTGACCTACAAGAAGAAGAAGGG - Intronic
1070572303 10:77649641-77649663 TTTTCCTTCTAGAATTATAATGG - Intergenic
1071173966 10:82901575-82901597 GTGATCCTCCAGAAGAATAATGG + Intronic
1071805888 10:89120399-89120421 GTGTCCCTTGAGGAGAATAATGG - Intergenic
1073983027 10:109176429-109176451 GAGTTATTCTAGAAGAATGAGGG - Intergenic
1074470639 10:113723477-113723499 GCGTGCTTCGAGAAGTATAATGG + Intronic
1076594908 10:131619378-131619400 GTGTGCTCCTGGAAGAATAAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078587172 11:12601887-12601909 GTCTCCTTTTAGAAGTTTAATGG - Intergenic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1080681161 11:34477392-34477414 GTGTCCTTCTAAGAGACCAAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084277108 11:68058657-68058679 GTGTGCTTTTAAAATAATAAAGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085731974 11:79007724-79007746 CTATCCTTCAAGAAGAAAAAGGG - Intronic
1085953874 11:81367445-81367467 TTGTTCTTGTTGAAGAATAATGG - Intergenic
1087163201 11:94971585-94971607 TTGTCCTTCAAGCAGAAAAAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087230649 11:95658121-95658143 GAGGTCTTCTAGAAGAACAAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088327264 11:108613810-108613832 TTTTCATTCTAGAAGTATAAAGG - Intergenic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090990301 11:131811268-131811290 GTGTCCTCATAGCAGAACAAAGG + Intronic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1100127425 12:91445377-91445399 GTTTTCTTCTAGAAGATTCATGG - Intergenic
1101007425 12:100414763-100414785 GTGTACTAATAGAACAATAATGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101626681 12:106450267-106450289 GTTTCCTTCTTCAAGAGTAACGG - Intronic
1105987655 13:25584482-25584504 TTCTCCTTCTAGATGAAAAAAGG + Intronic
1111218587 13:85176755-85176777 GTGCCCTTCCATTAGAATAAAGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111632215 13:90856644-90856666 GTGTCTTTTTAAAAAAATAAGGG + Intergenic
1113506233 13:110818396-110818418 ATGTCCTTCCTGAAGAACAAGGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1120681151 14:87482078-87482100 TTGGATTTCTAGAAGAATAATGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1126891091 15:53205076-53205098 GTGATTTTCTAGAAGAATAATGG + Intergenic
1127346871 15:58109846-58109868 GAAACATTCTAGAAGAATAATGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1131193766 15:90338337-90338359 GTGGCCTTCTAGATGAAATAAGG + Intergenic
1131776768 15:95810602-95810624 GTATCCATTAAGAAGAATAAGGG - Intergenic
1132044796 15:98554566-98554588 GTGTCCTTACTGAAGAAGAAGGG + Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133986256 16:10670612-10670634 GTGTTATTCTAAAATAATAAAGG - Intronic
1135827526 16:25742565-25742587 GGGTGCTATTAGAAGAATAAGGG + Intronic
1136853956 16:33637826-33637848 GTGTCCTTATATAATAAAAAAGG + Intergenic
1138437089 16:57008462-57008484 GTGTTCTTTTAGAATAAAAATGG - Intronic
1139454408 16:67061179-67061201 GTGTTCTTCTGGAAAAGTAAGGG - Intronic
1139599370 16:67977344-67977366 TTATCCCTCTAGAAGAAGAACGG - Exonic
1140329048 16:74035237-74035259 TTGTGTTTCTAGAAGTATAATGG - Intergenic
1203115538 16_KI270728v1_random:1486270-1486292 GTGTCCTTATATAATAAAAAAGG + Intergenic
1148767795 17:50049381-50049403 GTGACCTCCTGGAAGAATAGAGG + Intergenic
1149615262 17:57992074-57992096 GTGTCCTTCAACAAGCATGAAGG - Intronic
1150277540 17:63909570-63909592 GTGTCCTTCTATAATATTATGGG - Intergenic
1150278831 17:63917166-63917188 GTGTCCTTCTATAATATTATGGG - Intronic
1150750396 17:67856696-67856718 GTGTCCTGCTTGAAGCATGAAGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1154935652 18:21053525-21053547 TTGTCCTTTTTGAAGCATAATGG - Intronic
1155341573 18:24819057-24819079 ATGTCCTGCAAGCAGAATAAGGG - Intergenic
1156098467 18:33564766-33564788 GACTCCTTCTAGAACAATTAAGG + Intergenic
1156662974 18:39369725-39369747 GTTTCCTTCTAGAAGTTTTATGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157461088 18:47894623-47894645 GTTTCCTTCTGGAGGAATACTGG - Intronic
1157482207 18:48062591-48062613 GTCTCCTTCTAGGAAAATGAGGG - Intronic
1159520889 18:69521621-69521643 GTTTTCTACTAGAAGAATTAAGG - Intronic
1159804746 18:72942557-72942579 TTATCCTTATAGAATAATAATGG - Intergenic
1168156833 19:54478376-54478398 GTCTCCTTCTGCAAGAATATAGG + Intergenic
924976170 2:177724-177746 ATTTCCTTCTAGTTGAATAAAGG + Intergenic
925003624 2:425654-425676 GTGTTCTTCTACAACAATCAGGG - Intergenic
925791628 2:7494390-7494412 GTCACCTTGTAGAAGAATATGGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928700711 2:33895963-33895985 GTGTCCTTATAAGAGGATAATGG + Intergenic
928819983 2:35349836-35349858 GTGTCCTTGTAGAAAAACAAAGG - Intergenic
928848979 2:35718679-35718701 GTTTCTCTCAAGAAGAATAAAGG + Intergenic
931181213 2:59902598-59902620 GTGTCCTCCTTGTAAAATAAGGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934723498 2:96598961-96598983 ATGTGATTCTAAAAGAATAATGG + Intronic
935936794 2:108194406-108194428 GTGTGCTTCTAATAAAATAATGG - Intergenic
936393938 2:112104127-112104149 TTATTCTTCTAGAAGAAAAAAGG + Intronic
936498080 2:113040030-113040052 TAGTCTTTCTTGAAGAATAAGGG + Intronic
938588901 2:132718627-132718649 GTGTCCTCAAAGAAGAAGAAAGG + Intronic
939318548 2:140584637-140584659 GTGTTCTTACAGAAGAATAATGG - Intronic
939510573 2:143099544-143099566 GGGTACTTCTAAAAGAATGAGGG + Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
946537307 2:220645746-220645768 GTGTACGTCAAGAAGAATAATGG + Intergenic
947059670 2:226149250-226149272 GTGTTCTTCTAAAAGAGAAAAGG - Intergenic
1171400860 20:24872394-24872416 GTGTCCTGCTGGAGGAATGAGGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173694391 20:44996205-44996227 GTCTCCTTCTAGAATGTTAAGGG + Intronic
1175759024 20:61548763-61548785 ATTTCTTTTTAGAAGAATAATGG - Intronic
1176298123 21:5085205-5085227 GTGTCCTTCGAGAAGAGAAGGGG + Intergenic
1179858906 21:44176744-44176766 GTGTCCTTCGAGAAGAGAAGGGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951285718 3:20810692-20810714 GAGTCATTCTAGAAGGAAAAAGG - Intergenic
953491397 3:43355026-43355048 GAGTCCTTGTAAAAGGATAAAGG - Intronic
955996489 3:64685383-64685405 GGGTGCTTCGGGAAGAATAAAGG + Intronic
959036589 3:101373310-101373332 GAATCATTCTTGAAGAATAAGGG + Intronic
960966087 3:123105687-123105709 GTGCCCTTCTATAATAGTAAGGG - Intronic
961940093 3:130628129-130628151 GAGGCCATCTGGAAGAATAAAGG + Intronic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
970155437 4:13136940-13136962 GTTTCCTTCTAGAAAACTAGGGG + Intergenic
970431406 4:15992420-15992442 GTGACATTCTTGGAGAATAAGGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973033831 4:45379871-45379893 CTCCCCTGCTAGAAGAATAATGG + Intergenic
975443712 4:74439447-74439469 GTGTCCTCCTGGAAGAATTTTGG + Intergenic
976279732 4:83315417-83315439 GTTTCCTCCTAGAAAAATGAGGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
981644502 4:146983513-146983535 GTGTGCTTCGAAAACAATAAAGG + Intergenic
981907357 4:149936916-149936938 GTTTCCTTCTAGAAGTTTTATGG + Intergenic
981949645 4:150390738-150390760 GTATCACTCAAGAAGAATAAAGG - Intronic
982732079 4:158966873-158966895 GTGACTTTCTAGAAGATTATTGG - Intronic
987535947 5:19187690-19187712 GTGTCTTTATAGAAGAATAATGG - Intergenic
988054071 5:26069883-26069905 CTATTATTCTAGAAGAATAATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
993523360 5:88933504-88933526 CTGTCCAGGTAGAAGAATAAAGG - Intergenic
995107369 5:108389728-108389750 GTGTCCTGCCAGAAGTTTAAGGG - Intergenic
996543354 5:124652346-124652368 GAGTGCTTCTGGAAAAATAAGGG - Intronic
1000309055 5:160023868-160023890 GAATCCTTCTAGAAAAAGAAAGG - Intronic
1000561763 5:162798302-162798324 GTGTCCTTCAAGAAGACTTGTGG + Intergenic
1001633385 5:173192960-173192982 CTGAGCTTCTAGAAGAATATGGG + Intergenic
1005170059 6:22973657-22973679 GTGTCTTTCTAGGGTAATAATGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008174715 6:48253163-48253185 GTGTCCTTGTATAAGAACTATGG + Intergenic
1009782783 6:68292444-68292466 GTGTCCTTGTGGATGAATGATGG - Intergenic
1010600387 6:77818341-77818363 GTGTCCCATTAGAAGTATAATGG + Intronic
1010632121 6:78210255-78210277 TTCTCCTGCTAGAAGCATAAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011497059 6:87947297-87947319 CTGTCCTTCACTAAGAATAAGGG - Intergenic
1011961073 6:93091001-93091023 GGATCCTTCTAGAAAACTAAGGG + Intergenic
1012648373 6:101718717-101718739 GTGTCTTCCTGTAAGAATAAAGG - Intronic
1013628070 6:111957355-111957377 GTGTTCTACTACAAGGATAAAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1016969361 6:149748504-149748526 GTTTCCTTCTAAAAGATTACTGG + Intronic
1017071393 6:150578089-150578111 GTGTCCTTCTGGTAGTATGAGGG - Intergenic
1017571949 6:155754541-155754563 TTTTCCTTTTAGAAGGATAATGG + Intergenic
1018832821 6:167458409-167458431 TTGTACTTCTACAAGAATAATGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021266239 7:18527023-18527045 GTGAGCTTTTACAAGAATAATGG + Intronic
1023598960 7:41862705-41862727 GTCCCCTTCTAGAATTATAAGGG - Intergenic
1027008290 7:74717660-74717682 TTTTCATTCTAGAAAAATAAGGG - Intronic
1027578168 7:79957568-79957590 GTGTCTTTCTGGGAGAAGAATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030291289 7:107874885-107874907 GTGTCTTGCCAGAAGTATAAAGG - Intergenic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032606467 7:133360065-133360087 CTGTCTTTCTAGAGAAATAATGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1038970034 8:32622915-32622937 GTTTCCTTCTCCAACAATAAGGG - Intronic
1039762408 8:40591576-40591598 TGGGCCTGCTAGAAGAATAAGGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041506378 8:58602981-58603003 GTGTCCTTCAAGAAGTATGGTGG + Intronic
1041516960 8:58711128-58711150 GGGTCCTTGTAATAGAATAAGGG + Intergenic
1045449858 8:102311467-102311489 ATTTCCATCTCGAAGAATAATGG + Exonic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1045835512 8:106516372-106516394 GTCTCCCTCCATAAGAATAAGGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1052748374 9:32463928-32463950 GTTTCATTCTGGAGGAATAAGGG - Intronic
1055895693 9:81172835-81172857 GTGTTCTTCTAGAAGTTTTATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1060094797 9:120778619-120778641 GTGTTCTTCAAGAACATTAACGG + Intronic
1060379007 9:123147745-123147767 GTTTGCATCTATAAGAATAAAGG + Intronic
1061385907 9:130289306-130289328 GTGTCCTTCTAAGACAGTAAGGG + Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185914555 X:4021757-4021779 GTGTCCTTCTAAAAGAAAAGAGG + Intergenic
1186345616 X:8689312-8689334 ATGTCCTTCTAGAGCAACAATGG + Intronic
1186373629 X:8972832-8972854 GTGTTTCTGTAGAAGAATAAAGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187862957 X:23699182-23699204 ATGTCCCTCTCAAAGAATAAAGG - Intergenic
1189703063 X:43731832-43731854 GAGGCCTTCTGGAAGAAGAAGGG + Exonic
1194258351 X:91662958-91662980 GTTTCTTTCTATAACAATAATGG + Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1194528988 X:95020547-95020569 GTTTCCTTCTAGAAGTTTTAAGG - Intergenic
1194949553 X:100109052-100109074 GTTTCCTAATAGAAGAAAAAGGG + Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1198121677 X:133599334-133599356 GTGTACTTGCAGAAAAATAAAGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199549835 X:149047172-149047194 GTATTCTTCTAGAAGCTTAAAGG + Intergenic
1200240907 X:154493085-154493107 GTGTCCTTCTTGAAGGAAAAGGG + Intergenic
1200271409 X:154688048-154688070 ATTTCCTTCTAAAAGAATTATGG - Intronic
1200577119 Y:4902454-4902476 GTTTCTTTCTATAACAATAATGG + Intergenic
1201504794 Y:14686274-14686296 GTGTCCCTCTAACAGAATACTGG + Intronic