ID: 1098506688

View in Genome Browser
Species Human (GRCh38)
Location 12:71260658-71260680
Sequence AGAAGTAACCAGAAGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098506687_1098506688 -2 Left 1098506687 12:71260637-71260659 CCAGCAAGAGAAAATAAATGAAG 0: 1
1: 0
2: 6
3: 70
4: 571
Right 1098506688 12:71260658-71260680 AGAAGTAACCAGAAGAAGCTTGG 0: 1
1: 0
2: 1
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098506688 Original CRISPR AGAAGTAACCAGAAGAAGCT TGG Intronic
904167485 1:28567204-28567226 AGAAGTAAGGATAAGAAGGTGGG - Intronic
905393769 1:37654273-37654295 AGAAGTAACCAGGTGAGGATGGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906348306 1:45035310-45035332 ACAGGTCCCCAGAAGAAGCTGGG - Intronic
906383807 1:45349767-45349789 ACAGGTACCCAGAAGGAGCTTGG + Intronic
906391104 1:45417079-45417101 AGAAGTAGAGAGAAGAGGCTGGG - Intronic
907432542 1:54421679-54421701 AGAAGAAACCAGGAGAACCAAGG + Intergenic
908353849 1:63312494-63312516 AGAAATAACTAAAAGAGGCTGGG - Intergenic
908755275 1:67464032-67464054 AGAAGTCATCAGAAAAGGCTGGG - Intergenic
910628796 1:89336405-89336427 AGAAGTAGACAGAAAAATCTGGG + Intergenic
910633569 1:89382622-89382644 AGATGTCACCAGAAGAAACATGG - Intronic
911195283 1:94988235-94988257 AGAAAGAAAGAGAAGAAGCTTGG + Intronic
912663202 1:111553573-111553595 AGATGTAACCAGTAGAAATTAGG - Intronic
912668061 1:111600719-111600741 AGAAGAAACCAGAAGAAGCAAGG + Intronic
913512295 1:119572905-119572927 AGAGGTAACCCCAAAAAGCTGGG - Intergenic
913516573 1:119610414-119610436 AGAGGTAACCCAAAAAAGCTGGG - Intergenic
914784541 1:150816692-150816714 TGAAGTAACCAGAGAAAGCAAGG + Intronic
914886531 1:151589351-151589373 AGAAGAAATGAAAAGAAGCTGGG - Intergenic
915210605 1:154306130-154306152 AGAACTAACCATCAAAAGCTGGG - Intergenic
916053466 1:161051847-161051869 AGTAGTGATCAAAAGAAGCTGGG - Intronic
916873444 1:168942079-168942101 AGAAGGAATCAGAAGGACCTAGG + Intergenic
917500949 1:175584358-175584380 ACCAGAAACCAGAAGAAGCAAGG + Intronic
917886795 1:179394139-179394161 AAAAGGAAACAGAAGAACCTTGG - Intronic
917945878 1:179970055-179970077 AGAAATAACCAAAAGAAGGGGGG - Intronic
918689866 1:187466677-187466699 AGAACTCACAGGAAGAAGCTGGG - Intergenic
918877976 1:190074676-190074698 AAAAGTGAGCAAAAGAAGCTAGG + Intergenic
918957916 1:191235378-191235400 AGGAGGAACCTGATGAAGCTGGG + Intergenic
919112503 1:193238305-193238327 AAAAGGAAAAAGAAGAAGCTAGG - Intronic
919538724 1:198821759-198821781 AGATGTAAGCAGAAGAATCTTGG - Intergenic
920030909 1:203036838-203036860 AGAAGTAAAAAGTAGAAGCTTGG - Intronic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
920909582 1:210203193-210203215 AGAATTAACAAGAAGCAACTTGG + Intergenic
921964168 1:221070277-221070299 TGAAGTAAGCAGAAGGAGTTTGG + Intergenic
922165149 1:223109089-223109111 AGAAGTGGCCAAAAGAAGTTGGG + Intergenic
923466871 1:234256362-234256384 AGAGGACCCCAGAAGAAGCTTGG + Intronic
923755706 1:236789334-236789356 AGAAGTTACTAGAAGAAGGCTGG - Intergenic
924096943 1:240562084-240562106 TGAAGTAGCCAGAAGAAGCATGG - Intronic
1064665588 10:17647816-17647838 AGGAGTCACCAGAATACGCTAGG - Intronic
1065778480 10:29144392-29144414 AGAAACAACCAGTAGAAGCAGGG - Intergenic
1068107983 10:52643512-52643534 AGAAGTGTCCAGAATAAGTTAGG + Intergenic
1068266422 10:54656247-54656269 AGAACCCACAAGAAGAAGCTAGG + Intronic
1070666483 10:78348706-78348728 AGAAGTACAAAGTAGAAGCTGGG - Intergenic
1071378037 10:85030762-85030784 AGGAGGACCCTGAAGAAGCTTGG + Intergenic
1073645569 10:105298844-105298866 AGAAATAACAAGAAGAACTTTGG + Intergenic
1074212392 10:111348389-111348411 AGAAGCAGCAAGAAGAAACTAGG - Intergenic
1074558122 10:114510603-114510625 AGAAGGTAGCAGTAGAAGCTTGG - Intronic
1078206098 11:9230531-9230553 AGAAGAAAGCATAAGAGGCTGGG - Intronic
1078210656 11:9266835-9266857 AGAAGTACCCAGGAGAACCTAGG - Intergenic
1079167655 11:18061240-18061262 AAAAGTAACTATAAGACGCTGGG - Intergenic
1079789345 11:24716599-24716621 AATAGTAACCACTAGAAGCTGGG + Intronic
1080410015 11:32014481-32014503 AGAAATTACTAGAAGAAGGTGGG + Intronic
1080459360 11:32439515-32439537 TGAAATGATCAGAAGAAGCTGGG - Intergenic
1081013940 11:37852268-37852290 AGAAGTAAGCTGAGGAATCTAGG - Intergenic
1082683788 11:56212683-56212705 ATAAGTCACCAGTGGAAGCTAGG - Intergenic
1083034220 11:59621593-59621615 AGAAGAAAGCACAAGAATCTAGG - Intergenic
1083484622 11:62975525-62975547 AGAAGGAAGGAGGAGAAGCTGGG + Intronic
1083535587 11:63464011-63464033 AGAAGTCCTCTGAAGAAGCTTGG - Intronic
1083553665 11:63609317-63609339 AGAAAAACCCATAAGAAGCTAGG + Intronic
1084563676 11:69918029-69918051 AGATGTGACAAGAAGAAGCGGGG - Intergenic
1087738352 11:101859695-101859717 AGAAGTATACAGCAGGAGCTGGG - Intronic
1088069166 11:105760159-105760181 AAAATGAACCAGAAGAAGCAAGG - Intronic
1088634907 11:111810076-111810098 AGTAGTGAGCAGAAGAAGATAGG - Intronic
1088849801 11:113695453-113695475 AGAGGTACCAACAAGAAGCTGGG + Intronic
1089542487 11:119198093-119198115 AGAAATAGCCACAAGAGGCTGGG + Intergenic
1091497128 12:982401-982423 TAAAGCAACCAAAAGAAGCTAGG + Intronic
1091828539 12:3533266-3533288 AGAATAAACCAGAGCAAGCTGGG + Intronic
1092131888 12:6118688-6118710 AGAAGTGACCGGAAGAGGCCGGG - Intronic
1092475349 12:8814217-8814239 AGAAAGAACAAGCAGAAGCTGGG - Intergenic
1093050005 12:14493628-14493650 AGAAGCACCCTGATGAAGCTGGG - Intronic
1093207303 12:16265776-16265798 AGAAGTTCAGAGAAGAAGCTGGG - Intronic
1093354519 12:18149742-18149764 AGTAGTCAACACAAGAAGCTTGG + Intronic
1093694898 12:22147668-22147690 AGAAGTAGCCTTCAGAAGCTGGG + Intronic
1094364819 12:29669068-29669090 AGAAGCAACCAGCAGAAACAGGG + Intronic
1096831521 12:54318166-54318188 AGAAGTAACAGAAAGAGGCTGGG - Intronic
1098505584 12:71246731-71246753 AGATATTACCAGAAAAAGCTGGG + Intronic
1098506688 12:71260658-71260680 AGAAGTAACCAGAAGAAGCTTGG + Intronic
1099060822 12:77905972-77905994 AGAAGTGACCAGAGGGAGCAAGG - Intronic
1099441264 12:82702629-82702651 AGAACTAAACAGAAGAAGCCAGG + Intronic
1100170250 12:91967645-91967667 AAAAGTAACCAGAAAATGGTAGG + Intergenic
1100313806 12:93424274-93424296 AGAAGTAACCTGAAGAAAAAGGG - Intronic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1102962559 12:117102062-117102084 AGAAGTAATCAGGAGATCCTTGG + Intergenic
1104324079 12:127779481-127779503 AGATGTAAACAGAAGTTGCTGGG - Intergenic
1104438712 12:128777772-128777794 AGAAGAAACAAGAAGAAACATGG + Intergenic
1105793640 13:23829217-23829239 AGAAGAAAACTGAAGAGGCTGGG + Intronic
1106121062 13:26860413-26860435 AGAAGTAAAAGGATGAAGCTGGG + Intergenic
1107182105 13:37473031-37473053 AGAAGGAACCAGAGGGAGCAGGG - Intergenic
1107632846 13:42359975-42359997 AGAAATATGGAGAAGAAGCTGGG + Intergenic
1107718091 13:43220329-43220351 GGAAGCCACCAGAAGAAGCATGG + Intronic
1107923372 13:45233379-45233401 ATAATTAACCAGAAGAAACATGG + Intronic
1108072614 13:46643837-46643859 AGAAGTAACAACATGAAGCTTGG - Intronic
1108796898 13:54043238-54043260 AGAAGAAACCAGAAGCTTCTGGG + Intergenic
1108892607 13:55279480-55279502 AGAAGTAAAAAGTAGAGGCTGGG + Intergenic
1110804455 13:79737542-79737564 AGAAGAAACGAGAAAAAGCTAGG - Intergenic
1113748532 13:112762929-112762951 AGAAGTTACCAGAAAAGGATGGG - Intronic
1115226504 14:31108383-31108405 AGAAATAAGCAGAAGAGGCGAGG - Intronic
1115339216 14:32273862-32273884 AGAAGTAAGCTTCAGAAGCTGGG + Intergenic
1115997544 14:39210090-39210112 AGAAGTAAACAGAAGAGGCCAGG + Intergenic
1116351382 14:43868094-43868116 GGAAGTAACAAGAAGAAGTAGGG + Intergenic
1117197154 14:53352199-53352221 AGTAGCAACCAGAACAAGCGTGG - Intergenic
1119291528 14:73499183-73499205 AGAATGAACCAGAAACAGCTGGG + Intronic
1119581557 14:75787328-75787350 AGTACTAACCAGAAGAAAGTTGG + Intronic
1121953539 14:98193660-98193682 AGAATTCAGCAAAAGAAGCTTGG + Intergenic
1122101474 14:99413717-99413739 AGAAGTTATCAGGAGCAGCTTGG - Intronic
1122150393 14:99722402-99722424 AGAAGGAACCAGGACAAGTTTGG - Intronic
1124720330 15:32106019-32106041 AGGAGTCACCAGAGCAAGCTTGG + Intronic
1125392113 15:39204946-39204968 TGCAGACACCAGAAGAAGCTAGG + Intergenic
1125893297 15:43281836-43281858 ACAAGTACCCAGAAGGTGCTGGG - Exonic
1127420644 15:58801923-58801945 AGAAGTAAAAAAAAGAAGTTTGG - Intronic
1128499709 15:68219418-68219440 AGAAGGAGCCAGCAGAAGCAAGG + Intronic
1131744437 15:95431302-95431324 AAAAGTAATCAGCAGAAGCCTGG - Intergenic
1133525558 16:6602009-6602031 TGAAGTACCTAGAAGCAGCTTGG + Intronic
1135022155 16:18971858-18971880 TCAAGTAACCAGAAGAGACTGGG + Intergenic
1137909971 16:52367662-52367684 AGAAGTAACCAGTAGAACCAGGG + Intergenic
1138557165 16:57778117-57778139 ACAAGTAACCAAAATTAGCTGGG + Intronic
1138879134 16:60989398-60989420 AGAACTAAATAGAAGAATCTAGG + Intergenic
1139706491 16:68744501-68744523 AAGAGTAACAAGAACAAGCTGGG - Intronic
1139745584 16:69071897-69071919 AGAAAGGACCAGAAGAGGCTTGG - Intronic
1139759492 16:69173065-69173087 AGAAATAACCATAAAAGGCTGGG + Intronic
1141367999 16:83462056-83462078 AGAAGTCACCAGCAGAAACTTGG + Intronic
1149100422 17:52899712-52899734 AGAAGTAACAAATAGAATCTGGG - Intergenic
1149694074 17:58602650-58602672 AAAAGAAATCAGATGAAGCTGGG + Intronic
1150546936 17:66168875-66168897 AGAAGTAGCAAGGAGAAGCATGG - Intronic
1150582466 17:66487202-66487224 AGAGGTAACGAGTAGAGGCTGGG - Intronic
1150882951 17:69051969-69051991 ATAAGTAACCAAAACAAGATAGG + Intronic
1151061165 17:71096225-71096247 AGAAGTAAGCAGATGAATGTAGG + Intergenic
1151739095 17:75967173-75967195 AGAAGAAAACAGAAGAGGCCGGG + Intronic
1151991708 17:77579276-77579298 AGGAGTGACCAGAAGAAGCATGG - Intergenic
1152064311 17:78102090-78102112 TGTATTAACCAGAAGAACCTGGG + Intronic
1152116150 17:78388643-78388665 GGACGTAAGCAGAAGAAACTGGG - Intronic
1152987408 18:333421-333443 AGAAGCAACAACAAGAAGCAGGG + Intronic
1153105773 18:1524315-1524337 AAAATTAACCAGGATAAGCTAGG + Intergenic
1153259937 18:3214526-3214548 AGAAGTAACTGGGAGAGGCTGGG + Intronic
1155040342 18:22060062-22060084 AGAAATAACAAGAAAAATCTTGG + Intergenic
1156194830 18:34762642-34762664 GAAAGGGACCAGAAGAAGCTGGG - Intronic
1156244165 18:35282108-35282130 AGTAGTTTCCAAAAGAAGCTGGG - Intronic
1157670544 18:49524785-49524807 AGAAGGAACAAGAAGAGGCTAGG + Intergenic
1157943204 18:51951552-51951574 AGAAATACCCAGATGAAGGTTGG + Intergenic
1158830360 18:61270712-61270734 ATAAGTAAGAAGAAGAAACTAGG + Intergenic
1158938246 18:62384521-62384543 AGAAGTAAAGAGAAGAGGCGGGG - Intronic
1159734381 18:72075827-72075849 AAAATTAATCAGAAGAATCTTGG - Intergenic
1161614491 19:5262493-5262515 AGAAGTGCCCAGTAGCAGCTAGG + Intronic
1162310309 19:9902701-9902723 AAAAGAAACCAGAAAAGGCTGGG - Intronic
1162911789 19:13851533-13851555 AAAAGTCACCATAGGAAGCTGGG + Intergenic
1164983271 19:32630061-32630083 AAAAATAACAAGATGAAGCTGGG - Intronic
1165648004 19:37460592-37460614 ACAAGTAAAGAGATGAAGCTAGG + Intronic
1166053450 19:40274783-40274805 AGATGTAGCTAGAGGAAGCTGGG + Intronic
1167828545 19:51997936-51997958 AGAAGAATCCAGGAGAAACTGGG - Intronic
1168313672 19:55474279-55474301 ACAAGTAAACAGAATCAGCTGGG - Intergenic
1168678999 19:58300175-58300197 AAAAGTAACCAGCCCAAGCTAGG + Exonic
925433300 2:3815485-3815507 AAAAGTAACCAGAAGGGGCGGGG - Intronic
925738932 2:6988226-6988248 AGACGTTAACAGGAGAAGCTGGG - Intronic
926994776 2:18722547-18722569 AGGAGTAACCTGAACAACCTGGG - Intergenic
927392529 2:22611319-22611341 AGAAGGAAGCAGAGGAAGTTAGG + Intergenic
927591871 2:24363597-24363619 AGAAGTAAAGAAAAGATGCTGGG - Intergenic
928585081 2:32751645-32751667 AGAGGTAACCCTAAGAAGATGGG + Intronic
928595018 2:32851801-32851823 AGAATTTACCATAAGAAGCCTGG - Intergenic
929614097 2:43294763-43294785 AGAAGGAATCAGGAGAAGGTGGG + Intronic
929899033 2:45985711-45985733 TGTAGTGACCAGAAGCAGCTGGG + Intronic
930822808 2:55664125-55664147 AGAAGTAATAAGAAAAAGATAGG - Intronic
933748220 2:85585768-85585790 AGAAGAAACAGGAAGAGGCTAGG - Intronic
934943514 2:98519775-98519797 AGAAGTGACCAGAAGGGGCAGGG + Intronic
936711052 2:115131514-115131536 AAAAGTAACAAGAAGAAGAAGGG + Intronic
936822077 2:116534387-116534409 AGATGTAAGCAGAAGGAGTTAGG - Intergenic
937528449 2:122799658-122799680 GGAAACCACCAGAAGAAGCTAGG - Intergenic
937620511 2:123979933-123979955 AGAAGGAAACAGAAAAAGGTGGG + Intergenic
937842944 2:126544192-126544214 AAAAGTAACCAGAAGAAAGCTGG + Intergenic
940688955 2:156890524-156890546 AGAAGTAAAAAGATGAAGTTTGG + Intergenic
940748929 2:157601361-157601383 AAAAGGAACCAGGAGAAGCCAGG - Intronic
940764262 2:157772877-157772899 AGGAGTAACCAGCGGGAGCTTGG - Intronic
941023621 2:160436980-160437002 AAAAATAACCAGACGAACCTGGG + Intronic
941590891 2:167418830-167418852 AGAAGAAAGCGGAAGAGGCTGGG - Intergenic
942163368 2:173216017-173216039 AGAAGGATGCAGAAGAAGATGGG - Intronic
943366021 2:186968155-186968177 AGCAGTAACCAGAGGAAACTTGG - Intergenic
945235841 2:207630617-207630639 AGCAGTCACCAGCAGAAACTTGG + Intergenic
945323078 2:208449498-208449520 AGAAATAACCAGAATTAGGTAGG + Intronic
945905658 2:215589781-215589803 AGGAGTTGCCAGAAGAAGCAGGG - Intergenic
947477660 2:230465559-230465581 AGAAGGAAACAGCAGATGCTGGG + Intronic
947589044 2:231374346-231374368 AGAAGAAACCAGAAGATGTGAGG - Intronic
1169823247 20:9737322-9737344 AGAACTAACCAAAAGAAAGTTGG + Intronic
1170938177 20:20827579-20827601 GCAAGTGACAAGAAGAAGCTGGG - Intergenic
1172560280 20:35881868-35881890 ACAGGTGGCCAGAAGAAGCTGGG - Intronic
1173628481 20:44491651-44491673 AGATGGAACCAGAAGCAGCCAGG - Exonic
1174122412 20:48276190-48276212 AGGACTGACCAGAAGAGGCTAGG - Intergenic
1174669620 20:52294274-52294296 GGAAATACCCAGAAGAAGGTGGG + Intergenic
1175112155 20:56656086-56656108 AAAAGTAAACAAAATAAGCTGGG + Intergenic
1175197466 20:57254316-57254338 AGAAGAAACCAAAAGAGGCTGGG - Intronic
1181504638 22:23344126-23344148 AGAATTCACCAGAAGATCCTGGG - Intergenic
1181709634 22:24674356-24674378 AGAATTCACCAGAAGATCCTGGG - Intergenic
1181895356 22:26102511-26102533 AGAAGGAGCTAGAAGAATCTAGG - Intergenic
1183854834 22:40624566-40624588 ATAAGTACCCAGAAGAGGCAGGG + Intronic
1183927263 22:41215153-41215175 AGCAGTAAGCAGAAGGATCTGGG - Intronic
1184301182 22:43562029-43562051 AAAAGTCACCAGAAGCAGCCAGG - Intronic
1184505598 22:44899583-44899605 AGAAGAAAAAAGAAGAGGCTGGG - Intronic
949635153 3:5974418-5974440 AGAACTATCCAGCAGGAGCTGGG + Intergenic
950115440 3:10447703-10447725 ATAAGTGAGCACAAGAAGCTGGG + Intronic
952039850 3:29248975-29248997 AGAAATGGCCAGAAGGAGCTGGG - Intergenic
952180476 3:30911475-30911497 AGAAGTGACCAGAGGAAGAGAGG - Intergenic
952675590 3:36026585-36026607 AGCAGTGAGCAGAAGAACCTGGG - Intergenic
953631722 3:44623914-44623936 AGAAATAAACAGAATAAGCCTGG + Intronic
954361266 3:50124093-50124115 AGGAGTGTCCAGAAGCAGCTGGG + Intergenic
954906715 3:54069420-54069442 AGAAGTAAAAAGTAGAAGCTCGG - Intergenic
955434307 3:58885222-58885244 AGATGTTAACAGAGGAAGCTGGG - Intronic
956429798 3:69174857-69174879 AGAAGTAAACTGAAAAGGCTAGG + Intronic
959059846 3:101606093-101606115 AAAAGTAACCAGAAGAAATCTGG - Intergenic
962615327 3:137120773-137120795 AGAAGAAAACACAAGAAGTTTGG - Intergenic
963348823 3:144128236-144128258 AGAAGTAACCAAGAGATGCAGGG + Intergenic
963505431 3:146179075-146179097 AGAAGTCAACACAGGAAGCTTGG - Intergenic
963976914 3:151490708-151490730 ATAAATAACAAGAAGAATCTTGG + Intergenic
964434166 3:156634773-156634795 AGAAGTAGCCAGATGATGCTAGG - Intergenic
964485668 3:157183148-157183170 AGAAGTGACCAGAAGGAGAAGGG - Intergenic
964530130 3:157658512-157658534 AGGAGTAACCAGAAAAGGCATGG - Intronic
966092263 3:176154432-176154454 AAAGGAAACCAGAAAAAGCTGGG + Intergenic
966442133 3:179957394-179957416 AGAAGGAATCACAAGGAGCTGGG + Intronic
967216763 3:187217823-187217845 AGAAATAAACAGAATAAGCTGGG + Intronic
967470541 3:189856392-189856414 AGAAGTACCTAGAAGAAACTTGG + Intronic
972106055 4:35489081-35489103 AGAAATAACCAGAATAAAATAGG + Intergenic
972353834 4:38261928-38261950 AGAAGCAATCAGCAGAAGTTAGG + Intergenic
972443279 4:39117777-39117799 AAAAGTAAACAGAAGAGGCCAGG + Intronic
973817888 4:54634892-54634914 AGCAGTATCCCAAAGAAGCTGGG - Intergenic
974711653 4:65605152-65605174 AGGAGTAACCCTAAGAATCTGGG - Intronic
975268733 4:72403535-72403557 ATAAGTAACTAGGAGAACCTTGG - Intronic
976663913 4:87569827-87569849 AGAAGTAACAAGTAAATGCTTGG - Intergenic
977669324 4:99677668-99677690 AGAAATAAGCAGAGGAAGTTGGG - Intergenic
979927151 4:126582285-126582307 AGAACTCAAGAGAAGAAGCTAGG + Intergenic
981860366 4:149348284-149348306 GGAAGAAACTAGAAGAAACTAGG + Intergenic
982197123 4:152927791-152927813 AGAAATAACCTCAAGAAGGTTGG + Intergenic
983986361 4:174064838-174064860 AGAAGTAACCAGAACACCCTGGG - Intergenic
984585038 4:181553803-181553825 TGAAGCAACTAGATGAAGCTGGG + Intergenic
984947253 4:184979539-184979561 AGAAGGATCCAGAAGTAGCTTGG + Intergenic
986681301 5:10235253-10235275 AAAAGTAACCTGAACAAGGTGGG + Exonic
987339699 5:16928886-16928908 AGAAGGAAACAGAAGGCGCTTGG + Intronic
988326994 5:29782158-29782180 TTAAGTAACGAGAAAAAGCTAGG + Intergenic
989104850 5:37852412-37852434 AGAAGGAAGCAGAAGAAGGGAGG + Intergenic
989437503 5:41432109-41432131 GCAAGAAACCAGAAAAAGCTGGG - Intronic
991939532 5:71837327-71837349 AGAATTAAACAGAAAAAGCCTGG - Intergenic
992070010 5:73139547-73139569 AGAACAAAACAGCAGAAGCTAGG + Intergenic
992481469 5:77156356-77156378 AGAATAAACAAGAAGGAGCTTGG - Intergenic
992983690 5:82204619-82204641 AGAAGTAACCCAAACAAACTAGG + Intronic
993736728 5:91486220-91486242 AGAGGAAACATGAAGAAGCTGGG + Intergenic
993915439 5:93739304-93739326 GAAAGAAACCAGAAGAAACTAGG + Intronic
994206705 5:97043837-97043859 AGGAGTAACCAGGAACAGCTGGG + Intergenic
994362523 5:98869167-98869189 AGAAGGAACCAGAAGAAAAGAGG - Intronic
994910313 5:105896942-105896964 AGTAGTATCCAAAAGAAGCAAGG - Intergenic
995904122 5:117102972-117102994 AGAAGAAACCAGTAGAAGAGGGG + Intergenic
996223141 5:120957440-120957462 ATCAATAACCAGAAGAACCTTGG - Intergenic
996284114 5:121769007-121769029 AGCAGGAGCCAGAAGAAGTTGGG - Intergenic
997727930 5:136137682-136137704 AGAAGAAAACAGAAGAAGACTGG - Intronic
999432535 5:151536589-151536611 AGGAGTAGCCAGGAGAGGCTGGG - Intronic
999716285 5:154363162-154363184 AGAAATAAGCATAAGAAGATTGG + Intronic
999718832 5:154383520-154383542 AGCAGAAACCAGAACAGGCTGGG + Intronic
1002687357 5:181024224-181024246 AGTAGTAACCTGTAGAAGCTTGG - Intergenic
1002920667 6:1569135-1569157 AGAAGGAAGTAGAAGAAGCAAGG - Intergenic
1003349297 6:5301010-5301032 AGAAATAACCAGATGTGGCTGGG - Intronic
1005050923 6:21683316-21683338 AAAAATAACAAGAAGACGCTGGG - Intergenic
1005133288 6:22537481-22537503 AGAAGTAACTGGAAGAGGCCAGG + Intergenic
1006098605 6:31671667-31671689 AAAAAAAACCAGAAGAATCTTGG + Intronic
1006217998 6:32462227-32462249 ACATGTAACAAGTAGAAGCTAGG - Intergenic
1007821374 6:44562863-44562885 ATCAGGAACCAGAAGATGCTTGG + Intergenic
1008011128 6:46468960-46468982 AAAAGTAACCTGAAGCAGCTGGG - Intronic
1008831039 6:55762365-55762387 TGAAGTAACCATGAGAAGCAAGG - Intronic
1010456550 6:76063340-76063362 AGAACTCACCAGAAGAAACTAGG + Intronic
1011570975 6:88734641-88734663 AAAACTAACCAAAAGAAGGTTGG + Intronic
1012031310 6:94068666-94068688 AGCAGTAACCAGAAAAGGCCAGG - Intergenic
1013092566 6:106913321-106913343 AGAAGGAAGGAGAAGCAGCTGGG + Intergenic
1015956729 6:138606663-138606685 AGAAGTAGCCAGATGAAGGTGGG - Intronic
1016740552 6:147524201-147524223 AGAAGTGATCAGAAGAAGAGCGG - Intronic
1017112917 6:150949512-150949534 GGAAGTGAACAGAAGAAGGTGGG - Intronic
1017232227 6:152085356-152085378 AGCAGTAACCAGAACACACTTGG - Intronic
1017438459 6:154440235-154440257 AGAAACAACCAGAAAAAGCACGG + Intronic
1017640576 6:156490091-156490113 TGAAGTAATCAGAAGAAGACAGG + Intergenic
1017669341 6:156755224-156755246 AAAAGTAACGAAAGGAAGCTTGG + Intergenic
1019394967 7:813095-813117 AGAAGGAACCAGAAGCAGGCAGG + Intergenic
1019801078 7:3088882-3088904 AAAAGTAACCAAAAGAGGCCGGG - Intergenic
1019844151 7:3480183-3480205 AGAAGTAGGCAGAAGAAGAGTGG + Intronic
1020423226 7:8034694-8034716 AGAACTCACAGGAAGAAGCTAGG + Intronic
1020482400 7:8678488-8678510 AGCAACAACCAGAGGAAGCTAGG - Intronic
1020672583 7:11136090-11136112 AGAAGAAAGGACAAGAAGCTAGG - Intronic
1021802452 7:24320772-24320794 CAAAGTGACCAGAAGAGGCTGGG - Intergenic
1022657306 7:32331213-32331235 AGAAGGATCCAAAAGAGGCTGGG + Intergenic
1022789563 7:33673355-33673377 GGAAGTAGCCAGAAGCAGCAAGG - Intergenic
1023101348 7:36721606-36721628 AGAGTTAACCAGAAGAAGTTGGG + Intronic
1023186362 7:37537266-37537288 AGAACTACCCAGAGGAAGCGAGG - Intergenic
1023805071 7:43867090-43867112 AGAAGAAAAGAGAAGAGGCTGGG - Intronic
1024040236 7:45547352-45547374 AGGAGGACCCTGAAGAAGCTGGG - Intergenic
1024059125 7:45685354-45685376 AGCAGTAACAGGATGAAGCTGGG + Intronic
1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG + Intergenic
1026013143 7:66652663-66652685 AAAAGTAACCAAATGAGGCTGGG + Intronic
1026217709 7:68364332-68364354 AGAGGAAAGAAGAAGAAGCTAGG - Intergenic
1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG + Intronic
1028455340 7:91032259-91032281 TGAAGTAAACAGAAAAATCTGGG - Intronic
1028683071 7:93560802-93560824 AGGGATAACCAAAAGAAGCTTGG + Intronic
1028984675 7:97000355-97000377 GGAATTAAACAGAAGATGCTTGG + Intergenic
1030370194 7:108691077-108691099 ATAAGTAACCAGAGGAATTTTGG - Intergenic
1031252198 7:119399296-119399318 AGAAGAAAAGAGAAGAATCTAGG + Intergenic
1033470219 7:141640513-141640535 AGAATCAACCAGAAGAATATGGG + Intronic
1033861231 7:145630618-145630640 AGGAAGAATCAGAAGAAGCTGGG - Intergenic
1034063759 7:148117396-148117418 AGAAGTGACCAGACTAGGCTAGG - Intronic
1034430659 7:151039689-151039711 AGAAGAAAACAGAAGACACTGGG - Intronic
1037645781 8:20791553-20791575 ACAAGAAACCTGAAGAAGCATGG - Intergenic
1038922121 8:32096244-32096266 AGAAGATACCAGAAGAAGCAAGG + Intronic
1041265730 8:56062804-56062826 AGAAGAAACCACAAGAGGCCGGG + Intergenic
1045834862 8:106507964-106507986 AGAAGAAGCCAGAGGAGGCTGGG - Intronic
1046124676 8:109890335-109890357 AGAAGTAACCAGCAAAACATTGG + Intergenic
1046692229 8:117298822-117298844 AGAAGGAGGCAGAAGAATCTGGG + Intergenic
1048521383 8:135158564-135158586 AGTAGTAACCATAAGAAGAAGGG - Intergenic
1048912564 8:139150076-139150098 AGAAGTCACTAAAAGAAGTTAGG - Intergenic
1049941746 9:552578-552600 TGAATGAACCAGAAGAAACTTGG + Intronic
1050426114 9:5514578-5514600 AGAAATAAGCAGAATAAGCTGGG + Intronic
1050506950 9:6358475-6358497 AAAAGTAAGCATAGGAAGCTTGG - Intergenic
1051332919 9:16041456-16041478 AGAAGTCAGGCGAAGAAGCTGGG + Intronic
1052097710 9:24404294-24404316 AGAAATAATAAGCAGAAGCTTGG - Intergenic
1052589077 9:30467296-30467318 AGAAGGAACCAGGAGAAATTTGG + Intergenic
1053387942 9:37709742-37709764 AGAGGTAAACAGAAGCAACTGGG + Intronic
1054753644 9:68934376-68934398 AAAAGCAACCAGAAGTAACTTGG + Intronic
1055437057 9:76302284-76302306 AGAAATCACCCCAAGAAGCTGGG + Intronic
1055864840 9:80800694-80800716 AAAAGTATCCAGAAGAAGGATGG - Intergenic
1058329384 9:103740342-103740364 AGAGCTAACCAGACGAAACTTGG + Intergenic
1058466292 9:105231702-105231724 AAAAGTAAACAAAAGAGGCTGGG - Intergenic
1059135789 9:111804940-111804962 AGCAGTAGCCAGAAAAAGCTTGG - Intergenic
1060890824 9:127187025-127187047 AGAAGTTACCAGAAGAGACTTGG + Intronic
1061459922 9:130729340-130729362 AGAGGTAGGCAGAAGAAGGTGGG - Intronic
1061641738 9:131963432-131963454 AGCAGCAAGCAGAAGAAGATGGG + Intronic
1185724903 X:2411827-2411849 AAAAGTGACCAGAAAAAGCTGGG + Intronic
1186205523 X:7196213-7196235 AGAAGTAACCAGGAAAAGTATGG + Intergenic
1187326262 X:18293419-18293441 AGAAGTCCCCAGAAGAACTTTGG - Intronic
1188103253 X:26116885-26116907 AGAAGAAACCAGCAGAAAGTGGG - Intergenic
1188446294 X:30256406-30256428 AGAAGGAACCAGAAGGAGAGAGG + Intergenic
1189752231 X:44234055-44234077 GGAAGGAGCCAGAAGAGGCTGGG - Intronic
1190392686 X:49947684-49947706 AGAAGAAACCAGAAGAAAAGAGG - Intronic
1190730220 X:53220972-53220994 GGAAGTCACCAAAAGCAGCTCGG + Intronic
1191107965 X:56783958-56783980 AGAAGAATCCAGAAGAAGGAGGG - Intergenic
1191887492 X:65903724-65903746 AGAAGAAACCTGAGGAAACTTGG - Intergenic
1193739520 X:85201638-85201660 AGAAGGAAGCAGAAGACACTGGG - Intergenic
1193810085 X:86040650-86040672 AGAAGAGACCAGAGGCAGCTTGG - Intronic
1194552626 X:95320296-95320318 AGAAGCCATGAGAAGAAGCTGGG - Intergenic
1194592355 X:95815052-95815074 AGCAGCAACCATAAGAAGCTAGG - Intergenic
1194593460 X:95830040-95830062 AGAAGGAAACAGCAGACGCTGGG - Intergenic
1194973099 X:100365860-100365882 AGAACTAACAAGAAGGAGCTGGG - Intronic
1195484959 X:105393627-105393649 AGGAATAACCAAAAGCAGCTTGG + Intronic
1195929367 X:110058731-110058753 AGAAGTAATCCCAAGTAGCTGGG + Intronic
1196379474 X:115073669-115073691 AGAAGTGACCAGAAGACAGTGGG - Intergenic
1196864102 X:120055160-120055182 AGAAGGAAAAAGAAGAAGATGGG + Intergenic
1196878997 X:120181170-120181192 AGAAGGAAAAAGAAGAAGATGGG - Intergenic
1197941862 X:131798526-131798548 AAAAGTAACCAAAAGAAAATTGG - Intergenic
1198323298 X:135541090-135541112 AGCTGTAGTCAGAAGAAGCTAGG - Intronic
1199580978 X:149359404-149359426 ATTAATAACCAGAATAAGCTGGG - Intergenic
1202279528 Y:23166605-23166627 AGAAGTAACAACAAGAACTTTGG - Intronic
1202284904 Y:23230227-23230249 AGAAGTAACAACAAGAACTTTGG + Intronic
1202432660 Y:24802676-24802698 AGAAGTAACAACAAGAACTTTGG - Intronic
1202437307 Y:24855462-24855484 AGAAGTAACAACAAGAACTTTGG + Intronic