ID: 1098508456

View in Genome Browser
Species Human (GRCh38)
Location 12:71282757-71282779
Sequence CCCAGACATCTCTGCAATCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 2, 2: 41, 3: 96, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098508456_1098508460 -2 Left 1098508456 12:71282757-71282779 CCGAGATTGCAGAGATGTCTGGG 0: 1
1: 2
2: 41
3: 96
4: 317
Right 1098508460 12:71282778-71282800 GGTCCAGAAGGCATGAGGTCTGG 0: 1
1: 0
2: 2
3: 17
4: 204
1098508456_1098508459 -7 Left 1098508456 12:71282757-71282779 CCGAGATTGCAGAGATGTCTGGG 0: 1
1: 2
2: 41
3: 96
4: 317
Right 1098508459 12:71282773-71282795 GTCTGGGTCCAGAAGGCATGAGG 0: 1
1: 0
2: 1
3: 20
4: 213
1098508456_1098508462 15 Left 1098508456 12:71282757-71282779 CCGAGATTGCAGAGATGTCTGGG 0: 1
1: 2
2: 41
3: 96
4: 317
Right 1098508462 12:71282795-71282817 GTCTGGAGCAACAAGCCCACTGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098508456 Original CRISPR CCCAGACATCTCTGCAATCT CGG (reversed) Exonic
900716123 1:4145509-4145531 GTCAGTCATCTCTGCACTCTGGG - Intergenic
900903051 1:5530058-5530080 TCCATACATCTCTGAAATCTTGG - Intergenic
901779979 1:11587502-11587524 CCCAGGAATCTCTGCTAGCTTGG - Intergenic
901936501 1:12630569-12630591 CCCAGGCATCCCCGCACTCTTGG + Intergenic
902125912 1:14211137-14211159 CAAAGACTTCTCTGCAATTTGGG - Intergenic
903311966 1:22465720-22465742 CTCAGGCATCCCTGCACTCTTGG - Intronic
903337621 1:22635473-22635495 CCCAGGCATCCCTGCAATCTTGG - Intergenic
903672218 1:25043224-25043246 CCCAGGCATCCTTGCATTCTTGG - Intergenic
904089597 1:27935456-27935478 CCCAGACCTCTTCGCAATGTCGG - Intronic
904369996 1:30042339-30042361 CCCAGATATCTCTGCATTCTTGG + Intergenic
904443690 1:30550718-30550740 CCCAGGCATCTCTGGATTCTTGG + Intergenic
904460935 1:30679502-30679524 CCCTGGCATCCCTGCACTCTTGG + Intergenic
904551678 1:31324482-31324504 CCCAGGCATCCCTGCACTCTTGG + Intronic
904815776 1:33197045-33197067 GCCAGACAACTCAGCAAGCTAGG - Intergenic
906132557 1:43469238-43469260 CCCAGGCATCTCTGTGCTCTTGG - Intergenic
906448366 1:45922673-45922695 CCCAGGCATCTCTGAACTCTCGG - Intronic
907052343 1:51338154-51338176 CCCTGACATCTATGCATTTTAGG + Intronic
907369740 1:53993017-53993039 CCCAGGCATCCCTGCACTTTGGG - Intergenic
907761715 1:57367961-57367983 CCCAGGCATCCCTGCCCTCTTGG + Intronic
908442345 1:64167947-64167969 CCCAGAAAGCTCTGCAACTTTGG + Intronic
909238401 1:73181200-73181222 CTCAGGCATCCCTGCACTCTTGG - Intergenic
909416872 1:75416386-75416408 TCCATACATCTTTGAAATCTAGG - Intronic
910428186 1:87136256-87136278 CACAGACACATCTGGAATCTTGG - Intronic
911244059 1:95497334-95497356 CCCAGACACAACTGCAATCAGGG + Intergenic
911474836 1:98361938-98361960 TCCATACATCTCTGTAATCTAGG + Intergenic
911814833 1:102334346-102334368 CACAGACATGTCTGCAATGAAGG + Intergenic
912008515 1:104932586-104932608 CCCAGGCATCCCTGTACTCTTGG + Intergenic
912132434 1:106619509-106619531 CCCAGGCATCTCTGCACTCTTGG + Intergenic
912405509 1:109434361-109434383 TCCATACATCTCTGAAATCTAGG + Intergenic
912975152 1:114323024-114323046 CCCAGAAATTGCTGCAATCCAGG + Intergenic
914392834 1:147237279-147237301 CCTGGGCATCTCTGCACTCTTGG - Intronic
915571088 1:156745356-156745378 CTCAGGCATCTCGTCAATCTGGG + Exonic
915751215 1:158212782-158212804 CCCAGGCATCTCTGCACTCTTGG + Intergenic
916650548 1:166830825-166830847 TCCATACATTTCTGAAATCTAGG - Intergenic
916776122 1:167966087-167966109 CCTGTTCATCTCTGCAATCTAGG + Intronic
919453894 1:197801052-197801074 CCCAGGAATCTCTGCACTCTTGG + Intergenic
920089239 1:203440677-203440699 TCCAGACATCTCTAAAATATGGG - Intergenic
920365594 1:205446747-205446769 GCCAGCCATCTCTGAACTCTGGG + Intronic
922132608 1:222794908-222794930 CCCAGACATCCCTGTGCTCTTGG + Intergenic
922141790 1:222894620-222894642 CCCAGGCATCTCTGCACTCTTGG - Intronic
922331443 1:224580373-224580395 CCCAGGCATGTCTTCAACCTTGG - Intronic
923626152 1:235615611-235615633 CCCAGACACCACTGCAGACTTGG - Intronic
924679833 1:246220470-246220492 TCCAGACATCCCTGCACTTTGGG + Intronic
1062770131 10:92510-92532 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1062771552 10:105168-105190 CCCAGGCATGTCTGCACTCTCGG - Intergenic
1063113715 10:3058025-3058047 GGCAGACAGCTCTGCATTCTTGG - Intergenic
1063261673 10:4396234-4396256 CTCATAGATTTCTGCAATCTCGG - Intergenic
1063338695 10:5242665-5242687 CCCAGTCATCTCTTCAGTCCTGG - Intergenic
1063364970 10:5485123-5485145 CCTGGGCAGCTCTGCAATCTAGG + Intergenic
1066188801 10:33036892-33036914 CCCAGGTATCCCTGCACTCTCGG + Intergenic
1067221075 10:44344888-44344910 CCCAGCCACCCCTGCATTCTCGG - Intergenic
1067760172 10:49039113-49039135 CCCCCACTTCTCTGGAATCTAGG - Intronic
1068348362 10:55813357-55813379 GTCAGACATCTCTACACTCTTGG + Intergenic
1068360599 10:55972292-55972314 ATCAGACATCTCTGAAATGTGGG - Intergenic
1069121706 10:64576541-64576563 CCCAGACATCTCTGAACTCTTGG + Intergenic
1069249189 10:66246259-66246281 CTTAGACATCCCTGCACTCTTGG - Intronic
1069358705 10:67616859-67616881 CCCAAACGTCTTTGCAATTTTGG - Intronic
1070096317 10:73340875-73340897 CCCAGGCATCTCTGCACTCTTGG - Intronic
1070685382 10:78476677-78476699 CCCAGACATCTCTGTATGCTGGG - Intergenic
1071295051 10:84213393-84213415 CTCAGACCTCTCTGCAACGTGGG + Intronic
1071449777 10:85783315-85783337 CCCAGCCCTCTCTGCACCCTTGG - Intronic
1072561328 10:96578046-96578068 CCCAAATCTCTCTGCACTCTAGG + Intronic
1072753213 10:97999261-97999283 CCTAGGCATCCCTGCACTCTTGG + Intronic
1073210534 10:101798107-101798129 TCCACACATCTCTTCAAACTTGG + Exonic
1073260846 10:102188973-102188995 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1073670310 10:105580095-105580117 CCCAGGCATCCCTGCATTCTTGG - Intergenic
1074721064 10:116265719-116265741 CCCACACAGCTCTGCCCTCTGGG + Intronic
1074991643 10:118713318-118713340 CTCAGGCATCCCTGCATTCTTGG - Intronic
1076655258 10:132019539-132019561 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1077426214 11:2479383-2479405 TCCATACATCTCTGAAATCTAGG + Intronic
1077893561 11:6437235-6437257 CCCAGCCATCTCTTCCACCTTGG - Intronic
1078135716 11:8650009-8650031 CCCAGACAGCTCTGCAGAATAGG - Intronic
1078303222 11:10156053-10156075 CCCGGGCATCCCTGCACTCTCGG + Intronic
1078836489 11:15035253-15035275 CTCAGGCATCCCTGCACTCTTGG - Intronic
1078857544 11:15219006-15219028 CCCTGCCATCTCTGCAAGCCTGG - Intronic
1079349620 11:19681429-19681451 CCCAGGTCTCTCTGCAATTTGGG + Intronic
1079472393 11:20790510-20790532 CCCACGCATCCCTGCACTCTTGG - Intronic
1079769735 11:24444449-24444471 TCCATACATCTCTGAAATCTAGG - Intergenic
1081164056 11:39786382-39786404 CCCAGGCATCCCTGCACTCTCGG - Intergenic
1081237076 11:40659049-40659071 CCCAGGCATTGCTGCACTCTTGG + Intronic
1082821995 11:57550306-57550328 CCCAGGAACCTCTGCACTCTGGG + Intergenic
1082959353 11:58904170-58904192 CTCCGACATCTTTGCAATCCTGG + Intronic
1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG + Intergenic
1086249221 11:84794600-84794622 CCCAGGTATCTCTGCACTGTTGG + Intronic
1087036154 11:93758471-93758493 CCCAGGCATTCCTGCATTCTTGG + Intronic
1087211165 11:95447275-95447297 ACCTGGCATCTCTGCACTCTTGG - Intergenic
1087777771 11:102272279-102272301 CCTAAACATCTCTGCCCTCTTGG + Intergenic
1088109708 11:106247330-106247352 CCCAGACATGTCTGAACCCTAGG - Intergenic
1089115646 11:116093083-116093105 TCCAGAAATCTCTGTAGTCTGGG + Intergenic
1089691752 11:120191233-120191255 ACCAGACATCTCAGCCCTCTGGG + Intergenic
1090137104 11:124209982-124210004 CCCAGGCATCTCTGCAGACTTGG - Intergenic
1091173024 11:133535128-133535150 CCCGGGCAGCTCTGCAATGTTGG - Intergenic
1091195398 11:133726679-133726701 CCCAGTCATCTCTGTGACCTGGG - Intergenic
1092825925 12:12398751-12398773 CCCAGATATCTGTGCGATATTGG + Intronic
1093281712 12:17203794-17203816 CCCAGGCATCCCTGCCCTCTTGG + Intergenic
1094038963 12:26102916-26102938 GACAGACATCTCTGCATTTTGGG + Intergenic
1094144408 12:27214028-27214050 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1094653211 12:32397958-32397980 CCCAGCCATCACTTCCATCTTGG - Intergenic
1095042213 12:37455608-37455630 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1095391638 12:41714267-41714289 CTCAGACAGCTTTGCAAACTTGG - Intergenic
1096112159 12:49035381-49035403 CCAAAACAGCTCTGGAATCTAGG - Intronic
1097130052 12:56805076-56805098 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1097130985 12:56810525-56810547 CCCAGACTACCCTGCACTCTTGG - Intergenic
1098290948 12:68956310-68956332 CCCTGGCATCCCTGCACTCTTGG - Intronic
1098508456 12:71282757-71282779 CCCAGACATCTCTGCAATCTCGG - Exonic
1099920715 12:88953805-88953827 TCCAATCATCTCTCCAATCTAGG + Intergenic
1101211005 12:102535044-102535066 CCCTGACATCTCTGTGATCCTGG + Intergenic
1101799496 12:108008504-108008526 CCCATACATCTCTTCCATGTGGG - Intergenic
1101812363 12:108119041-108119063 CCCAGATCTTTCTGCAATTTGGG - Intergenic
1102491541 12:113292435-113292457 CACAGAAAGCTGTGCAATCTGGG - Intronic
1104843836 12:131836982-131837004 CCCAGTCATCTCTGCTACCCTGG - Intronic
1104928284 12:132324999-132325021 CACAGCCATGTCTGCAAGCTGGG - Intronic
1106308804 13:28535147-28535169 CCCAGGCATTCCTGCACTCTTGG + Intergenic
1106522079 13:30506810-30506832 CCCACACAGCTGTGCAACCTGGG - Intronic
1106810428 13:33353251-33353273 CCCTGTCAACACTGCAATCTGGG + Intergenic
1108118701 13:47160200-47160222 CCCAGACATCCCTGCATTCTTGG + Intergenic
1108240429 13:48457924-48457946 CCCAGGCATCTCTGTATACTTGG - Intronic
1109345781 13:61113430-61113452 CCCAGGCATCTCTGTGTTCTTGG + Intergenic
1109426130 13:62168027-62168049 CCCAGGCATCCCCGCACTCTTGG + Intergenic
1109470552 13:62799094-62799116 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1109525146 13:63566087-63566109 CCCAGCCATCTCTGAACTCTCGG + Intergenic
1109762300 13:66845488-66845510 CCCAGGCATCTCTTCACTCTTGG - Intronic
1109966956 13:69712831-69712853 CCCAGACAGTGGTGCAATCTTGG + Intronic
1109982202 13:69923875-69923897 CCCAGGCATCTCTGCACTCTTGG + Intronic
1110587260 13:77208245-77208267 CCCAGGCATCTCCTCAACCTTGG + Intronic
1110777894 13:79432084-79432106 CCTGGGCATCTCTGCACTCTCGG + Intergenic
1110939392 13:81330570-81330592 CTCAGGCATCACTGCACTCTTGG + Intergenic
1111253679 13:85639112-85639134 CCCAGGCATCTCTGCACTCTCGG - Intergenic
1114280988 14:21192376-21192398 CTCAGACATCCCTGCACTCTTGG + Intergenic
1116541660 14:46108376-46108398 CCCAGGCATCTCCACACTCTTGG - Intergenic
1117659126 14:57985982-57986004 CACAGACATCTCTGTATTTTAGG + Intergenic
1118473208 14:66094079-66094101 CCCAGGCATCTCTGCACTCTCGG - Intergenic
1118522106 14:66596736-66596758 CCCGGGCATCTCTACACTCTTGG - Intronic
1118661217 14:68015038-68015060 TCCTGCCATCTGTGCAATCTTGG + Intronic
1119036067 14:71231359-71231381 CCCAGGCATCTGTGCACTCCTGG + Intergenic
1119739709 14:77006379-77006401 TCCAGCCTTCTCTGCAGTCTTGG - Intergenic
1119997609 14:79270916-79270938 CCCAGAAATCTTTGCAATATGGG - Intronic
1121528100 14:94633435-94633457 CCCAGGCATCTCTGTGCTCTTGG - Intergenic
1122055742 14:99097131-99097153 CCCAGACACCTCCGCGCTCTGGG + Intergenic
1123197866 14:106633888-106633910 CACAGACATCTCCACAATCAAGG + Intergenic
1202940736 14_KI270725v1_random:143333-143355 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1125718009 15:41830648-41830670 CCCAGGCATGTCTGCACTTTTGG + Intronic
1126215123 15:46145983-46146005 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1126292728 15:47099914-47099936 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1127526034 15:59792512-59792534 CCCAGACATCTCTTTACTCTTGG - Intergenic
1128847772 15:70916886-70916908 CCCAGGCATCTCTGCACTCTTGG + Intronic
1128935154 15:71739742-71739764 CCCAGGAATCTCTGCAAACTGGG + Intronic
1129183454 15:73891573-73891595 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1129377825 15:75145297-75145319 CCCAGGCCTCTCTGCACTTTTGG - Intergenic
1129971255 15:79780012-79780034 CCCATAAATCTCTGCAACCATGG + Intergenic
1131918701 15:97300339-97300361 CTCAAACATCTTTGCCATCTAGG - Intergenic
1132009970 15:98267228-98267250 CCCAGATCTCTTTGCAATCTCGG - Intergenic
1132305248 15:100807430-100807452 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1132971807 16:2692896-2692918 CTCAGGCATCCCTGCACTCTTGG - Intronic
1133135740 16:3710286-3710308 CCCAGCCACATCTGCAAACTAGG + Intronic
1133554331 16:6890441-6890463 CACCGAAATCTCTGCCATCTGGG - Intronic
1134078510 16:11308868-11308890 CCCAGGCATCCCTGCACTCTTGG - Intronic
1134591103 16:15454052-15454074 CTCACACATCTCTGCTCTCTAGG + Intronic
1135057251 16:19241369-19241391 CCCAGGCATCTATGCACTCTTGG - Intronic
1135862980 16:26074336-26074358 TCCAGCCATCTTTGCAAACTAGG + Intronic
1136418268 16:30116641-30116663 GACAGACATCTCTGCACCCTGGG - Exonic
1137334425 16:47533743-47533765 CCCAGGCATCTCTATACTCTTGG - Intronic
1137343797 16:47636468-47636490 CCCAGGCATCACTGCACTCTTGG + Intronic
1138072390 16:54005812-54005834 GCCAGAAAACTCTCCAATCTGGG - Intronic
1138878244 16:60979250-60979272 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1139432289 16:66917690-66917712 CACAGACAGCTCTGCAGGCTGGG + Exonic
1140263346 16:73399414-73399436 TCGAGACATCTCTCCAACCTTGG + Intergenic
1140522655 16:75595366-75595388 CAATCACATCTCTGCAATCTTGG - Intergenic
1140964406 16:79950919-79950941 CAGAGACATCTCTACAATGTTGG - Intergenic
1203099261 16_KI270728v1_random:1291386-1291408 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1144072125 17:11683828-11683850 ACCAAACATTTCTGCAATTTTGG + Intronic
1144227355 17:13162472-13162494 CCCAGCCATCTATGCAATAGGGG + Intergenic
1145217179 17:21061210-21061232 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1145368534 17:22286882-22286904 CCCAGGCACCTCTGCACTCTTGG + Intergenic
1146761443 17:35482583-35482605 TTCAGGCATCTCTGCACTCTTGG + Intronic
1149169369 17:53791798-53791820 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1149362592 17:55910960-55910982 CCCAGGCATCTCTGCACTCCTGG - Intergenic
1150008281 17:61483074-61483096 CCCAGACACCCCGGCAATCTCGG - Exonic
1150520929 17:65866104-65866126 CCCAGGCATCTCAGCACTCTCGG + Intronic
1150952709 17:69821367-69821389 CCCAGGTATCTTTGCACTCTTGG + Intergenic
1151020879 17:70616068-70616090 CTCAGACATCACTGCTTTCTTGG + Intergenic
1151395426 17:73819773-73819795 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1151485248 17:74394973-74394995 GCCAGACATCTTTGTAAACTAGG - Intergenic
1151725273 17:75880047-75880069 CCCAGAGATATCTGTAATTTTGG + Intergenic
1152642866 17:81456472-81456494 CCCAGACACCTTGGCACTCTTGG - Exonic
1153139478 18:1954920-1954942 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1153428888 18:4993443-4993465 CCCAAGCATCCCTGCACTCTTGG - Intergenic
1153608063 18:6854784-6854806 CCCGGGCATCTCTGTACTCTTGG + Intronic
1153940087 18:9969641-9969663 CAGAAACATCTCTGAAATCTCGG + Intergenic
1156244521 18:35284698-35284720 CCTGGATATCTCTGCACTCTAGG - Intronic
1157006526 18:43590075-43590097 CCCAGGCATCTTTGCACTCTTGG - Intergenic
1157420573 18:47544538-47544560 CCCCAACATCTCTGCCATATGGG - Intergenic
1158139574 18:54242182-54242204 CCCAGGGATCTCTGCACTCTTGG - Intergenic
1159767004 18:72502911-72502933 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1159779634 18:72646053-72646075 CACTGGCATCTCTGCCATCTGGG + Intergenic
1160037029 18:75310854-75310876 CCCAGACAGCACTGAACTCTAGG - Intergenic
1161781706 19:6297488-6297510 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1161851179 19:6738942-6738964 CCCAGACATCTGGGCCATCTGGG - Intronic
1162125438 19:8497383-8497405 CCCAGACTGGTCTGGAATCTTGG + Intronic
1162310938 19:9906931-9906953 CCCAGACAGCTGTTCCATCTTGG + Intronic
1163287221 19:16356219-16356241 CGCAGACAATTCTGCACTCTGGG + Intronic
1164214122 19:23129071-23129093 CCCATATAGCTCTGAAATCTAGG - Intronic
1168267998 19:55232655-55232677 CTCAGCCATCTCTGCCTTCTTGG - Intronic
925048096 2:789766-789788 CCCAGGCATCTCTGCACTCTTGG + Intergenic
925515207 2:4674326-4674348 CCTGGGCATCTCTGCACTCTCGG + Intergenic
925922601 2:8647368-8647390 CTCAGGCATCTCTGCACTCTTGG + Intergenic
926675804 2:15619019-15619041 CCCAGACATCTCTGCACTCGGGG - Intronic
927038164 2:19202547-19202569 CCCAGACCCCTCTGCAGCCTTGG - Intergenic
927768531 2:25836681-25836703 CCCAGAGTTCTTTACAATCTAGG + Intronic
927999058 2:27507230-27507252 CACGGACATCTCGGAAATCTGGG - Exonic
928015947 2:27657296-27657318 CACAGATGTCTGTGCAATCTCGG - Intronic
930162951 2:48176759-48176781 CCGATACATCTCTAAAATCTAGG + Intergenic
930379652 2:50611931-50611953 CTCTGACATCCCAGCAATCTAGG + Intronic
930728909 2:54709271-54709293 TCCAGGCATCTCCGCACTCTTGG + Intergenic
930946746 2:57084706-57084728 CCCAGGCATCTCTGCACTCTGGG - Intergenic
930957165 2:57217071-57217093 CCTGGGCATCTCTGCACTCTTGG + Intergenic
932482961 2:72059909-72059931 CCCAGACATGTGTGGAATTTAGG - Intergenic
932501699 2:72187994-72188016 CCCAGGCATCCCTTCACTCTTGG - Intronic
932963564 2:76443811-76443833 CCCAGATGTCTTTGCTATCTTGG - Intergenic
933801256 2:85961800-85961822 CCCAGGCATCACTGCACCCTTGG - Intergenic
934144232 2:89075749-89075771 CCCAGACAAGTCTGAAATCCAGG - Intergenic
934225010 2:90124799-90124821 CCCAGACAAGTCTGAAATCCAGG + Intergenic
934696630 2:96404932-96404954 CCTGGGCATCTCTGCACTCTTGG - Intergenic
934699771 2:96430221-96430243 CCTAGGCATCCCTGCACTCTTGG + Intergenic
937164144 2:119795667-119795689 CCCAGGCATCTCTGCAATCTTGG - Intronic
938180754 2:129179624-129179646 TCCAGGCATCTTTGCACTCTTGG - Intergenic
938722170 2:134076603-134076625 CCTGGGCATCTCTGCATTCTTGG - Intergenic
938732665 2:134158571-134158593 CCCGGGCATCCCTGCATTCTTGG - Intronic
940376759 2:152966614-152966636 ACCAGTCACCTCTGGAATCTGGG + Intergenic
941303160 2:163828837-163828859 TCCATAAATCTCTGAAATCTAGG + Intergenic
941404715 2:165074441-165074463 CCCAGGCATCCCTGCACTCCTGG + Intergenic
942585165 2:177466827-177466849 CCCAGGCATCTCTACACTCTTGG - Intronic
942868161 2:180700097-180700119 CCCAGGCATCTCTGCATTCTTGG - Intergenic
943190911 2:184679507-184679529 CCTGGACATCTCTGCACTCCCGG + Intronic
943191770 2:184686169-184686191 CCCAGGCATCCCTGCACTCTTGG - Intronic
943427091 2:187750360-187750382 CCTAGGCATCTCTGCACTCTCGG - Intergenic
943960132 2:194254024-194254046 CCCACACATCCCTGCGCTCTTGG + Intergenic
944200845 2:197105898-197105920 GGCAGACTTCTCTGCAGTCTGGG - Intronic
944483767 2:200182285-200182307 CTCAGGCATCCCTGCACTCTTGG + Intergenic
946450227 2:219773349-219773371 CCCAGACCTCTGTGCCCTCTTGG - Intergenic
948234942 2:236380396-236380418 CCCAGGCATCTTTCCAGTCTGGG + Intronic
948434432 2:237943705-237943727 CCCAGGCATCCGTGCACTCTTGG + Intergenic
948437315 2:237962327-237962349 CTCAGACATCTCCACAATCCAGG - Intergenic
948476173 2:238221297-238221319 CTCAGGCATCCCTGCACTCTTGG - Intergenic
948575519 2:238947134-238947156 CCTAGGCATCCCTGCACTCTTGG - Intergenic
948702504 2:239769027-239769049 CCCTGACATCTCTTGACTCTGGG + Intronic
1169685604 20:8267730-8267752 CCCAGAAAATTCTGTAATCTGGG - Intronic
1169923089 20:10756090-10756112 CCCAAATCTATCTGCAATCTCGG + Intergenic
1170043963 20:12066044-12066066 CCCAGGCATCCCTGCACTCCTGG - Intergenic
1170494914 20:16915164-16915186 CCCAGGCATTTCTGCATGCTTGG + Intergenic
1172011999 20:31850971-31850993 CCCAGACCTCTCTGCACTGGTGG - Intronic
1172346937 20:34209480-34209502 GCCAGGCATCTCTGCACTCTTGG + Intronic
1173207704 20:41007541-41007563 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1173465807 20:43280346-43280368 CCCAGAAATCTCTGTGCTCTGGG - Intergenic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1175001446 20:55633795-55633817 ACCAGCCATCTCTGTAATTTTGG - Intergenic
1175444610 20:59011416-59011438 CCCAGATATCTCTGCAGTGCAGG + Intergenic
1175690312 20:61060624-61060646 CTCAAAAATCTCTGCAGTCTGGG + Intergenic
1175960010 20:62631227-62631249 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1176104480 20:63379485-63379507 CCCAGGCATCTCTGCACTCTCGG + Intergenic
1178488718 21:33034411-33034433 CTCAGACACCTCTGCTTTCTAGG + Intergenic
1178937320 21:36874846-36874868 CCCAGGCATCCCTGCACTCTCGG + Intronic
1179457579 21:41509485-41509507 CCCAGACTGGTCTCCAATCTGGG + Intronic
1180179057 21:46109838-46109860 CCCAGGCATCGCTGCACTCTTGG - Intronic
1180258613 21:46651087-46651109 CCCAGGCCTCTCTGCATGCTGGG - Intronic
1181498295 22:23300739-23300761 CCCAGACTTCTCTGCCAGCCTGG - Intronic
1184054487 22:42035289-42035311 CCCAGGCATCCTTGCACTCTTGG - Intronic
1184560999 22:45262902-45262924 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1184686649 22:46099338-46099360 CCCGGACCCCTCTGCCATCTGGG + Intronic
950165551 3:10794739-10794761 CCCAGGCCTTTCTACAATCTTGG + Intergenic
950504977 3:13388978-13389000 CCCCGACATCTCCCCAAGCTGGG - Intronic
951266433 3:20573418-20573440 CCCACACATCTTTTCAAACTTGG - Intergenic
951281043 3:20750312-20750334 CCCAGCTATCTCTCCAATGTTGG - Intergenic
951508995 3:23480389-23480411 CCAAGGCATCCCTGCACTCTTGG - Intronic
952408437 3:33026143-33026165 CGGAAACATCTCTGCACTCTTGG + Intronic
953163680 3:40445246-40445268 CCCAGGCATCTCTGTGCTCTTGG + Intergenic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
953801940 3:46031255-46031277 TCCAGGCATCTCTGCACTGTCGG + Intergenic
954497929 3:50982919-50982941 CCTGGGCATCTCTGCACTCTTGG + Intronic
955303714 3:57809216-57809238 CCCAGGCATCCCTGCACTCTTGG + Intronic
956990078 3:74752226-74752248 CCCACACATACCTGCACTCTTGG - Intergenic
957136377 3:76294217-76294239 TCCAGGCATCTCTGCACTCTGGG - Intronic
957426927 3:80051334-80051356 CCCAGGCATCTCTGCACTCTCGG + Intergenic
957486611 3:80870571-80870593 CCCAGGCATCTCTGCACTCTTGG + Intergenic
957730233 3:84125345-84125367 CCCAGGCATCTCTGCACTCTCGG + Intergenic
957797506 3:85030726-85030748 CCCAGCCAGGTCTTCAATCTTGG + Intronic
959164924 3:102764770-102764792 CCCTGACATGTCTGATATCTGGG + Intergenic
959484168 3:106908544-106908566 CCCAGGCATTCCTGCACTCTTGG + Intergenic
959863765 3:111243239-111243261 CCATGGCATCTCTGCACTCTTGG - Intronic
960333758 3:116392267-116392289 CTCAGGCATCTCTGCACTCTAGG + Intronic
961525727 3:127496238-127496260 CCTAGGCATCTCTGCACTCTTGG + Intergenic
961535200 3:127566446-127566468 TTCAGACATCCCTGCAATCCTGG - Intergenic
961782125 3:129326480-129326502 CCCCGACATCTCCCCAAGCTGGG - Intergenic
961943060 3:130656992-130657014 CCCAGGCATTTCTGCACTCTTGG - Intronic
965051488 3:163655193-163655215 CCCAAGCATCCCTGCACTCTCGG - Intergenic
965117956 3:164515525-164515547 CCCGGGCATCCCTGCACTCTTGG - Intergenic
965229337 3:166029823-166029845 CCCAGTCATCCTTGCACTCTTGG - Intergenic
965261259 3:166489271-166489293 CCCAGGCATCCCTGCATTCTGGG + Intergenic
965272636 3:166638467-166638489 CCTAGGCATCTCTGCACTCTTGG + Intergenic
965289831 3:166865111-166865133 CCCAGGCATCTCTGCACTCTTGG + Intergenic
966012293 3:175095602-175095624 GCCATACATGTCTCCAATCTTGG - Intronic
966550603 3:181200094-181200116 CTCTGACATCTCTGAAATGTGGG + Intergenic
968378881 4:71510-71532 CCCAGACAGTTCTGAAACCTAGG - Intronic
968538769 4:1151579-1151601 CCCAGGCATCTCTGCACTCTAGG - Intergenic
969194086 4:5547041-5547063 CTCAGGAATCTCTGCACTCTTGG + Intronic
969968423 4:11021077-11021099 CCCAGGCATCTCTGTGGTCTAGG - Intergenic
972158918 4:36198800-36198822 GCCAGGCATCTCTGCACTCTTGG - Intronic
972358367 4:38303609-38303631 CCCAGGCATCCCTGTACTCTTGG - Intergenic
972645737 4:40966513-40966535 CCCAGGCATCTCTGTACTCTTGG + Intronic
974235716 4:59179405-59179427 CCCAGATATCCCTGCACTCTTGG + Intergenic
974524936 4:63038726-63038748 CCCAGGCATGTCCGCAACCTTGG - Intergenic
974607608 4:64173656-64173678 CCCAGGCATCCCTGCACTCTTGG + Intergenic
974683590 4:65195456-65195478 CCCAGGCATCTCCACATTCTGGG - Intergenic
975040961 4:69743889-69743911 CCCAGGCATTTCTGCAATCTAGG - Intronic
975692652 4:76981044-76981066 CCCAGACTTCTCAGCAAGATCGG - Intronic
976734568 4:88296754-88296776 CCCAGGCATCCCTGCACTCTTGG - Intergenic
977487411 4:97666011-97666033 CACAGACATCTCTGCACTCTTGG - Intronic
978663518 4:111155020-111155042 GCCAGGCGTCTCTGCACTCTTGG - Intergenic
978940988 4:114435423-114435445 GCCACACAGCTCTGAAATCTTGG - Intergenic
980180124 4:129392347-129392369 CCCAGGCCTCCCTGCACTCTTGG + Intergenic
980532575 4:134073702-134073724 TCCATATATCTCTGAAATCTAGG + Intergenic
980738180 4:136917799-136917821 CACAGGCATCCCTGCACTCTAGG + Intergenic
981138135 4:141236405-141236427 CCCAGCCACCTCTTCAGTCTGGG - Intergenic
981889306 4:149716456-149716478 CCTGGACATCTCTGCTCTCTTGG - Intergenic
982610956 4:157574428-157574450 CCTGGGCATCTCTGCATTCTTGG + Intergenic
982817801 4:159908079-159908101 TCCAGACAGCTCTGGCATCTGGG - Intergenic
982957604 4:161792037-161792059 CCCAGGCATCCCTGCACCCTTGG + Intronic
983298031 4:165890950-165890972 TCCATACATCTCTGAAATCTAGG + Intronic
983491791 4:168398098-168398120 CCCAGGCATCTCCACACTCTCGG + Intronic
984145264 4:176052807-176052829 GCCATACATCTCTGTGATCTTGG - Intergenic
985075034 4:186205811-186205833 CCCAGCCATCCCTACCATCTTGG + Intronic
988346278 5:30041855-30041877 CCCAGGTATCCCTGCACTCTAGG + Intergenic
988566016 5:32320565-32320587 CCCAGGCATCTCTGCACTTTTGG - Intergenic
988940306 5:36139098-36139120 CCCAGGCATCCCTGCACTTTCGG + Intronic
989339065 5:40354228-40354250 CCCAGCCATCTCTGCACTCCTGG + Intergenic
989520564 5:42396143-42396165 CTCGGACATCTCTGCACTCTTGG + Intergenic
992029763 5:72709390-72709412 TCCAGGCATCCCTGCACTCTAGG - Intergenic
994692471 5:103035111-103035133 CCTAGACATCTCTGCACTGTTGG - Intergenic
994851148 5:105056991-105057013 CCCAGCCATCCCTGCACTCTTGG + Intergenic
995745024 5:115394021-115394043 CTCAGGCATCCCTGCACTCTTGG - Intergenic
998745371 5:145252393-145252415 TCAAGCCATCTGTGCAATCTTGG + Intergenic
998801729 5:145875739-145875761 CCCAGACAACTCTGCATCCTGGG - Intergenic
1000552507 5:162684322-162684344 CCCAGAGATCTGTGAATTCTTGG - Intergenic
1001329610 5:170752861-170752883 CCCTGCCACCTCTGCAAGCTTGG + Intergenic
1002072463 5:176688345-176688367 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1002912011 6:1497729-1497751 ACCAGACACCCCTGCAATCTGGG - Intergenic
1002986105 6:2191488-2191510 CCCGGGCCTCTCTGCACTCTTGG + Intronic
1004720948 6:18266639-18266661 CCCAGCCATCCCTGCACTCTTGG - Intergenic
1005781834 6:29201159-29201181 CCCGGGCATCTCTGCACTCTTGG + Intergenic
1006143118 6:31942954-31942976 ACCAGACATCTATGCCATCGGGG + Exonic
1007242509 6:40437241-40437263 CCCCGCCAGCTCTGCATTCTGGG + Intronic
1007649847 6:43412667-43412689 CCCAGGCATCTCTGTGCTCTTGG + Intergenic
1008493102 6:52106402-52106424 CCCAGCCAGCTGTGGAATCTTGG - Intergenic
1009241797 6:61193859-61193881 CTCAGGCATCTCTGCACTCTCGG - Intergenic
1009534399 6:64861431-64861453 CCCGGGCATCTCTGCACTCTCGG - Intronic
1009891250 6:69685825-69685847 CACACACAACTTTGCAATCTCGG + Intronic
1010071923 6:71753248-71753270 GTCAGACATCTCTGAAATGTGGG + Intergenic
1010519612 6:76817566-76817588 CCTAGGCATCTCTGCATTCTCGG + Intergenic
1010559564 6:77333196-77333218 CCCAGGCATTCCTGCACTCTCGG + Intergenic
1011530225 6:88312853-88312875 CTCAGATATCCCTGCACTCTTGG - Intergenic
1011930249 6:92701811-92701833 CCCAGACATCCCTGCACTCTTGG - Intergenic
1012646584 6:101691389-101691411 CGCAAGAATCTCTGCAATCTGGG - Intronic
1012916646 6:105178629-105178651 CTCAGAGATATCTGGAATCTGGG + Intronic
1013644174 6:112119352-112119374 CACAGCCTTTTCTGCAATCTTGG - Intronic
1014227253 6:118862192-118862214 CCTAGGCATCCCTGCACTCTTGG - Intronic
1014770383 6:125452991-125453013 CCCAGGCATCTCTGCATTCTTGG + Intergenic
1015542657 6:134331531-134331553 CTCAGACTTCTCTGGAAACTAGG - Intergenic
1016199902 6:141394643-141394665 CCCAGGCATTTCTGCACTCCAGG + Intergenic
1016557928 6:145360585-145360607 CCCAGACACCTTAGGAATCTGGG + Intergenic
1017054396 6:150424508-150424530 CCCAGACATCTCTGTGCTCTTGG + Intergenic
1017266083 6:152448410-152448432 CCCAGTGATCTCTTCATTCTAGG + Intronic
1017420578 6:154268254-154268276 CTCAGGCATCACTGCACTCTTGG - Intronic
1017478303 6:154822857-154822879 CCCAGAAATCTCTGCCCTTTTGG + Intronic
1017522473 6:155214070-155214092 CCCAGACATCCCTGTGTTCTTGG - Intronic
1019786255 7:2979485-2979507 CCCCGAAATCTCTGCACTCAGGG + Intronic
1020394888 7:7703678-7703700 CGCAGACATCTCAGCACTTTGGG + Intronic
1020586666 7:10078613-10078635 CCTAGGCATCTCTGCACTCTTGG + Intergenic
1020761150 7:12269486-12269508 CCTAGGCACCTCTGCACTCTTGG + Intergenic
1021500872 7:21330453-21330475 CCCAGGCATATCTGCACTCTTGG - Intergenic
1021519275 7:21522960-21522982 CCCAGATATCTGAGCAATATTGG - Intergenic
1021630026 7:22635648-22635670 CCCAGTAAACTGTGCAATCTTGG - Intergenic
1022953527 7:35361375-35361397 CCCAGACATATCTTCCCTCTTGG - Intergenic
1024857129 7:53794923-53794945 CCCAGGCATCCCTGCATTCTTGG - Intergenic
1028527505 7:91801768-91801790 CCTGGGCATCTCTGCACTCTCGG - Intronic
1028816953 7:95157264-95157286 CCCAGGTATCCCTGCACTCTGGG - Intronic
1029327550 7:99823144-99823166 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1029899205 7:104022053-104022075 CCCAGGCATCTCTGCACTCTGGG + Intergenic
1030514159 7:110519832-110519854 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1030570190 7:111213086-111213108 CCCAGGCATTTCTACACTCTTGG + Intronic
1031837127 7:126691410-126691432 CTCAGGCATCTCTGCACTTTTGG - Intronic
1034904101 7:154928951-154928973 CCCAGGAATCTCGTCAATCTGGG - Exonic
1034999005 7:155596454-155596476 CCCAGGCATCTCTGCAATCAAGG - Intergenic
1035721056 8:1792179-1792201 CACAGACCTCTTTGCACTCTGGG + Intergenic
1039182415 8:34880883-34880905 CCCAGACATCTCTGTGCTCTCGG - Intergenic
1039383706 8:37111227-37111249 CCCAGAAAATTCTGTAATCTGGG - Intergenic
1040562656 8:48538195-48538217 CCCAAACAAATCAGCAATCTGGG + Intergenic
1041205594 8:55495298-55495320 CCCAGGCATCTCTGTGCTCTTGG - Intronic
1041357374 8:57014601-57014623 CCCAGGCATGCCTGCACTCTTGG - Intergenic
1042196901 8:66238569-66238591 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1042337132 8:67640532-67640554 CCCAGGCATCTCTACACTCCTGG - Intronic
1042358769 8:67858480-67858502 CTCAGACATAGCTGCAATTTTGG + Intergenic
1042631812 8:70825683-70825705 CACAGACATGACTGCAATTTGGG - Intergenic
1043082644 8:75785011-75785033 CCCAGTCAACTCTGCACTCTCGG - Intergenic
1043087264 8:75849882-75849904 CCCAGACATCTCTGCACTCTTGG - Intergenic
1043155420 8:76772599-76772621 ACCAGACTACTCTTCAATCTAGG + Intronic
1043195429 8:77287060-77287082 CCCAAGCATCTCTGCACTCTTGG + Intergenic
1043554915 8:81420246-81420268 TCCCGTCATCTCTGCACTCTTGG - Intergenic
1043756149 8:84005949-84005971 CCCAGGCATTCCTGCACTCTTGG - Intergenic
1044409441 8:91867763-91867785 ACCAGGCATCTCTGCACTCTCGG + Intergenic
1044525055 8:93242040-93242062 CCCAGGCATCTCTACAATCTTGG - Intergenic
1046407383 8:113791342-113791364 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1047947307 8:129894526-129894548 CCCAGACATCTTTGCCAGCTGGG + Intronic
1048238442 8:132716125-132716147 CCCAGGCATCCCTGCACTCTTGG + Intronic
1048421804 8:134284520-134284542 CTCAGGCATCTCTGCACTCTTGG - Intergenic
1049823933 8:144654956-144654978 CCCAAACATCCCTGCACTCTTGG + Intergenic
1049826949 8:144674989-144675011 CCCAGACATCCCTGCTCTCTCGG - Intergenic
1050182234 9:2934037-2934059 CCCAGGCATCTCTGCGCTCTTGG + Intergenic
1050483886 9:6114243-6114265 CCCAGGCATCCCTGCACTTTTGG + Intergenic
1050947860 9:11549372-11549394 CCCAGGCATCCATGCACTCTCGG + Intergenic
1051433167 9:17001608-17001630 CCCAGACATTTCTGGAACCAAGG + Intergenic
1052707465 9:32010711-32010733 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1053444974 9:38145920-38145942 CCCAGGCCTCTCTGCACTCTAGG + Intergenic
1053865599 9:42434986-42435008 GCCATGCATCTCTGCAATCCTGG + Intergenic
1053877393 9:42558324-42558346 CCCAGGAATCTCTGTACTCTTGG - Intergenic
1054234302 9:62543398-62543420 CCCAGGAATCTCTGTACTCTTGG + Intergenic
1054834434 9:69661555-69661577 CACCGACATCTCTCCATTCTTGG - Intronic
1054861891 9:69962508-69962530 CCCAAACTTATCTGCAATGTAGG - Intergenic
1056986041 9:91364390-91364412 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1057468436 9:95337262-95337284 ACCAGGCATCCCTGCACTCTTGG + Intergenic
1060180022 9:121527524-121527546 CCCAGGCATTTCTGTACTCTCGG + Intergenic
1061551725 9:131338782-131338804 CCCAGGCCTCTCTGCAGCCTCGG - Intergenic
1061677530 9:132226815-132226837 CTCTGACATCTCTGCCCTCTCGG + Intronic
1061957115 9:133969578-133969600 CCCAGACATCCCTGCAACCTTGG + Intronic
1062485521 9:136773061-136773083 CACAGACATCTCAGACATCTGGG + Intergenic
1203612433 Un_KI270749v1:21623-21645 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1188207681 X:27380458-27380480 CCCAGGCATCTCTGCATTCTTGG + Intergenic
1188756407 X:33969007-33969029 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1189003723 X:36973042-36973064 GCCAAACATCTCTGAAATGTGGG - Intergenic
1189045931 X:37590975-37590997 GCCAAACATCTCTGAAATGTGGG + Intronic
1189480003 X:41385214-41385236 CCCAGACATGTCCTCAACCTTGG - Intergenic
1189856464 X:45229447-45229469 GCCAGGCATCTCTGCACTCTCGG - Intergenic
1192244876 X:69363709-69363731 CCCAGGCATCTCTGCCCCCTGGG - Intergenic
1193108557 X:77704860-77704882 CCCAGGTGTCTCTGCACTCTTGG - Intronic
1193554055 X:82932152-82932174 CCCAGGCATCTCTTTATTCTTGG + Intergenic
1193911333 X:87310113-87310135 CCCAGAGATCTCTGGAACTTTGG - Intergenic
1194135019 X:90130565-90130587 CCTAGATTTCTCTGAAATCTAGG - Intergenic
1194511455 X:94801119-94801141 TCCAGGCACCTCTGCAAACTTGG + Intergenic
1195126380 X:101813302-101813324 CCTAGACATCTCTGAGCTCTTGG + Intergenic
1195126417 X:101813453-101813475 CGCAGGCATCTCTGCACTCTTGG + Intergenic
1195179163 X:102339883-102339905 CGCAGGCATCTCTGCACTCGGGG - Intergenic
1197342107 X:125287163-125287185 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1197406921 X:126065119-126065141 CCCAGGCATCCCTGCATTCCTGG + Intergenic
1197609641 X:128623654-128623676 CCTGGGCATCTCTGCACTCTTGG - Intergenic
1199103697 X:143837491-143837513 CCCAGACACCTCTGTGCTCTTGG + Intergenic
1199360093 X:146907470-146907492 CTCAGGCATCTCTGCACTCTTGG - Intergenic
1199861170 X:151801462-151801484 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1200480802 Y:3700656-3700678 CCTAGATTTCTCTGAAATCTAGG - Intergenic