ID: 1098508747

View in Genome Browser
Species Human (GRCh38)
Location 12:71285876-71285898
Sequence AACCTTTGAATACTGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1800
Summary {0: 1, 1: 4, 2: 32, 3: 304, 4: 1459}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098508747 Original CRISPR AACCTTTGAATACTGTTGAT GGG (reversed) Intronic
901984081 1:13060126-13060148 AACCTGAGAATAGTGTTGTTGGG - Intergenic
901997730 1:13166644-13166666 AACCTGAGAATAGTGTTGTTGGG + Intergenic
904218455 1:28943744-28943766 AACCCTTGTACACTGTTGGTGGG + Intronic
904816357 1:33203583-33203605 AACCCTTGTACACTGTTGGTGGG - Intergenic
905485719 1:38294810-38294832 AACCCTTGTACACTGTTGGTGGG - Intergenic
905496098 1:38388566-38388588 AACCTTTATACACTGCTGATGGG + Intergenic
905714659 1:40138259-40138281 AATCCTTGTGTACTGTTGATGGG + Intergenic
906570579 1:46834874-46834896 AACCCTTGTGCACTGTTGATGGG - Intergenic
906592347 1:47037896-47037918 AACTTTTAAATAATGGTGATGGG - Intronic
906816288 1:48883226-48883248 AACCCTTGTACACTGTTGGTAGG - Intronic
906872340 1:49496981-49497003 AACATTTGCATACTGTTGGTGGG - Intronic
906887874 1:49671866-49671888 AACCCTTATACACTGTTGATGGG + Intronic
906891780 1:49724278-49724300 AACCTCTTAATGCTGTTGTTTGG + Intronic
906903477 1:49863808-49863830 AACCCTTGTATACTGTTGGTGGG + Intronic
907209691 1:52809628-52809650 AACCCTTGGACACTGTTGGTGGG - Intronic
907215069 1:52856071-52856093 AACCCTTGGACACTGCTGATGGG - Intronic
907452473 1:54554888-54554910 AACCTTTTGACACTGTTCATGGG - Intronic
907767918 1:57428772-57428794 AACCTTTGTACGCTGTTGGTGGG - Intronic
907775880 1:57514296-57514318 AACCCTTGTATACTGTTGGTGGG - Intronic
907839902 1:58146981-58147003 AACCCTTGTATGCTGTTGGTGGG + Intronic
907935486 1:59037969-59037991 AACCCTTGTATATTGTTGATGGG + Intergenic
907963280 1:59303710-59303732 AACCATTGTACACTGTTGGTAGG - Intronic
908301936 1:62770674-62770696 AACCCTTGAACACTGTTGATGGG - Intergenic
908598680 1:65715506-65715528 AACCTTTGTACACTGTTGGTGGG - Intergenic
908838550 1:68254377-68254399 AACCTTTTAATATTCTTAATTGG - Intergenic
908977146 1:69911411-69911433 AACACTTAAACACTGTTGATGGG - Intronic
908998748 1:70192345-70192367 AACCCTTAAACACTGTTGGTAGG + Intronic
909182032 1:72436498-72436520 AACCCTTGTATACTGCTGCTGGG - Intergenic
909209318 1:72803187-72803209 AACCTTTGTATACTGTTTTGGGG - Intergenic
909385341 1:75048883-75048905 AACCCTTGTACACTGTTGGTGGG + Intergenic
909520328 1:76560714-76560736 AACCCTTGCACACTGTTGGTGGG + Intronic
909659490 1:78066415-78066437 AACATTTAAACACTGTTGGTGGG + Intronic
909720603 1:78764988-78765010 AACTCTTGTATACTGTTGGTGGG - Intergenic
909818997 1:80034835-80034857 AACCCTTGAGCACTGTTGGTGGG - Intergenic
909896886 1:81082337-81082359 AACCCTTGTAGACTGTTGCTGGG + Intergenic
910475785 1:87605085-87605107 AACCCTTGCATGCTGTTGGTGGG - Intergenic
910546203 1:88422253-88422275 AACCCTTACACACTGTTGATGGG + Intergenic
910705029 1:90119901-90119923 AACCCTCGAACACTGTTGGTGGG - Intergenic
911028422 1:93459602-93459624 AACCCTTGTACATTGTTGATGGG + Intronic
911267842 1:95763844-95763866 AACCCTTGTACACTGTTGGTGGG + Intergenic
911447568 1:98016949-98016971 AACTCTTGTATACTGTTGGTAGG + Intergenic
911546163 1:99219656-99219678 AATCCTTGTATACTGTTGGTGGG - Intergenic
911600187 1:99840186-99840208 AATCTTTGTGCACTGTTGATGGG + Intergenic
911737813 1:101356802-101356824 AACCATTGTATACTGTTAGTGGG - Intergenic
911771654 1:101750784-101750806 AAACTTTTTATACTGTTGATGGG - Intergenic
911852937 1:102841357-102841379 AACCCTTATATACTGTTGGTAGG - Intergenic
911961379 1:104307472-104307494 AACCCTTGTGCACTGTTGATGGG + Intergenic
912127876 1:106562688-106562710 AACCCTTGTACACTGTTGATAGG + Intergenic
912129125 1:106579700-106579722 AACACTTTTATACTGTTGATGGG - Intergenic
912243037 1:107931485-107931507 AACCGTTGAATCCAGGTGATGGG + Intronic
912748904 1:112269162-112269184 AACCTATTAATACTGTCAATTGG - Intergenic
912877960 1:113381613-113381635 AACCCTTGTATACTGTTGATAGG - Intergenic
913035186 1:114957814-114957836 AACCCTTGTTTACTGTTGCTGGG + Intronic
913281961 1:117194400-117194422 AACATTTGTATACTATTGGTGGG + Intronic
913428544 1:118762390-118762412 AACCTTTGTATATTGTTGGTGGG + Intergenic
913458098 1:119054433-119054455 AACTCTTGTATACTGTTGATAGG + Intronic
913477802 1:119255608-119255630 CACATTTGTATACTGTTGGTGGG + Intergenic
913532948 1:119745911-119745933 AAACTTTCTAGACTGTTGATGGG - Intergenic
913975882 1:143454813-143454835 AACCTTTGTACATGGTTGATAGG + Intergenic
914070277 1:144280434-144280456 AACCTTTGTACATGGTTGATAGG + Intergenic
914108878 1:144685920-144685942 AACCTTTGTACATGGTTGATAGG - Intergenic
914324077 1:146594203-146594225 AACCCTTGTACACTGTTGGTGGG + Intergenic
914439215 1:147688822-147688844 AACCCTTGTACACTGTTGGTGGG + Intergenic
914560693 1:148816393-148816415 AACCCTTGTACACTGTTGATGGG - Intronic
914612141 1:149313822-149313844 AACCCTTGTACACTGTTGATGGG + Intergenic
915153152 1:153851401-153851423 AACCCTTGCACACTGTTGGTGGG - Intronic
915177928 1:154032314-154032336 AACCCTCATATACTGTTGATGGG - Intronic
915382003 1:155450579-155450601 AACATTTGTACACTGTTGATGGG + Intronic
915843923 1:159241968-159241990 AACCCTAGCATGCTGTTGATGGG - Intergenic
916714353 1:167436857-167436879 AACCCTTGAACACTCTTGGTGGG + Intronic
916729772 1:167555555-167555577 AACCCTTGTACACTGTTGGTGGG - Intergenic
917044875 1:170848399-170848421 AACCCTTAAACACTGTTGGTGGG - Intergenic
917069355 1:171133053-171133075 AATCCTTGAATGCTGTTGATGGG + Intergenic
917794554 1:178523408-178523430 AATCTTTGTACACTGTTGGTGGG - Intronic
917919318 1:179736878-179736900 AACCTTTGTACACTGTTGGTTGG + Intergenic
918189024 1:182154316-182154338 AACGCTTTTATACTGTTGATGGG + Intergenic
918306814 1:183254197-183254219 AACCCTTGTACACTGTTGGTGGG - Intronic
918320281 1:183357613-183357635 AACGCTTGTACACTGTTGATAGG - Intronic
918412892 1:184279038-184279060 AATCCTTGTATACTGTTGGTGGG - Intergenic
918493860 1:185112193-185112215 AACCCTTGTACACTGTTGGTGGG + Intergenic
918610359 1:186483206-186483228 AGCATTTGAACACTGTTGTTAGG + Intergenic
918665742 1:187148407-187148429 AACCCTTGTACACTGTTGCTTGG - Intergenic
918733516 1:188029189-188029211 AACCTTTGCAAACTGTTGGTGGG - Intergenic
918738263 1:188094432-188094454 AACCTTTGAATATTATTGCAGGG + Intergenic
918994259 1:191735881-191735903 AACGCTTGAACACTGTTGGTAGG - Intergenic
919059626 1:192615173-192615195 AACCCTTGTACACTCTTGATGGG - Intergenic
919191325 1:194223767-194223789 AACCCTTGTACACTGTTGGTGGG + Intergenic
919207950 1:194441367-194441389 AACATTTAAATAATGTTGGTGGG + Intergenic
919337193 1:196251001-196251023 AACCCTTGTACACTGTTGGTGGG + Intronic
919444944 1:197691495-197691517 CACCCTTGTATACTGTTGGTGGG + Intronic
919541653 1:198854028-198854050 AGCCCTTGTATACTGTTGAGGGG + Intergenic
919563775 1:199158168-199158190 AACCCTTATATGCTGTTGATGGG + Intergenic
919595584 1:199557572-199557594 AACCCTTGTACACTGTTGGTGGG + Intergenic
920851505 1:209631121-209631143 AATCTATGAATACAGTTGTTTGG + Intronic
921003108 1:211065014-211065036 AGCCTTTGCACACTGTTGGTGGG + Intronic
921207712 1:212862792-212862814 AACCCTTGAATACGGCTGGTGGG - Intronic
921455121 1:215361884-215361906 AACCCTTGCACACTGTTGATGGG - Intergenic
921507339 1:215988616-215988638 AACCCTTAAATACTGTTGGTGGG - Intronic
921547020 1:216485061-216485083 AACCTTTGCACAATGTTGGTGGG + Intergenic
921920997 1:220669306-220669328 AACTTTTGTACACTGTTGGTGGG + Intergenic
921979980 1:221246031-221246053 AACATTTATATACTGTTGGTGGG - Intergenic
922361349 1:224824719-224824741 AACATTTTTATACTGTTGCTGGG - Intergenic
922369151 1:224892122-224892144 AACCTTTCACTACTATTCATGGG - Intergenic
922686502 1:227642722-227642744 GTCCTGTGAAGACTGTTGATGGG + Intronic
922985509 1:229863342-229863364 AACCTTTGTACCCTGTTGGTGGG - Intergenic
923128534 1:231054637-231054659 AACCTGTGAATACTGAGGATGGG - Intergenic
923175450 1:231459714-231459736 AATCTTTGTACACTGTTGATGGG + Intergenic
923177543 1:231481720-231481742 AACCCTTGTGTACTGTTGATGGG - Intergenic
923345793 1:233051223-233051245 AACATTTATACACTGTTGATGGG + Intronic
923421504 1:233820471-233820493 AACCTTTGTGCACTGTTGGTAGG - Intergenic
923440592 1:234016177-234016199 AACCCTTGTGCACTGTTGATGGG + Intronic
923449443 1:234102975-234102997 GAACTTTGCATAATGTTGATTGG - Intronic
923556901 1:235008204-235008226 AACCCTTGTACACTGTTGGTGGG + Intergenic
923859504 1:237879082-237879104 AACCCTTGAACCCTGTAGATGGG - Intronic
923909606 1:238426525-238426547 AACCCTTGTATACTGTCGGTGGG - Intergenic
923910976 1:238443310-238443332 AACAGTTGACTACTTTTGATTGG + Intergenic
923930291 1:238686762-238686784 AACACTTAAATACTGTTGGTAGG + Intergenic
924116041 1:240748209-240748231 AACCCTTGTACACTGTTAATGGG + Intergenic
924488046 1:244506505-244506527 AACCTTTGTGTACTGTTAATGGG - Intronic
924649065 1:245906522-245906544 AACCCTTGTACACTGTTGATGGG + Intronic
924769749 1:247068540-247068562 AACCCTTGTACACTGTTGGTGGG + Intronic
924832428 1:247611647-247611669 AGCCTTTGTACACTGTTGGTGGG + Intergenic
924894626 1:248322783-248322805 AACCCTTTTACACTGTTGATGGG + Intergenic
924955189 1:248919699-248919721 AACCCTTGAACACTGCTGGTGGG - Intronic
1062771275 10:103707-103729 AACCTCTGTACCCTGTTGATTGG + Intergenic
1062869354 10:886339-886361 AACCTTTGCACACTGTTGGTGGG + Intronic
1063248703 10:4250659-4250681 AAACCTTGCATACTGTTGGTAGG - Intergenic
1063466561 10:6249217-6249239 AACCCTTGTACACTGTTGGTGGG + Intergenic
1063699902 10:8374207-8374229 AACCCTTGTGTACTGTTGGTGGG - Intergenic
1063921121 10:10934053-10934075 AACCCTTGTATACTGTTTGTGGG - Intergenic
1064510753 10:16088192-16088214 AACTTTTGTATACTGTTGGTGGG + Intergenic
1064597176 10:16957608-16957630 AACCTTTACACACTATTGATGGG + Intronic
1065051451 10:21796555-21796577 AACCCTTGTACACTGTTGCTGGG - Intronic
1065090066 10:22222930-22222952 AACCTTTGTGCACTGTTGATGGG - Intergenic
1065158849 10:22898060-22898082 AACACTTTAACACTGTTGATGGG + Intergenic
1065194144 10:23245734-23245756 AACCCTTGCACACTGTTGATGGG + Intergenic
1065200247 10:23305707-23305729 AACCCTTGTGCACTGTTGATGGG + Intronic
1066012517 10:31207924-31207946 AACGTTTACACACTGTTGATAGG + Intergenic
1066013104 10:31212279-31212301 AAGCCTTGTGTACTGTTGATGGG + Intergenic
1066153202 10:32647192-32647214 AACATTTAAACACTGTTGGTAGG - Intronic
1066248123 10:33604526-33604548 AACCTTGGTACACTGTTGGTGGG + Intergenic
1066524998 10:36267706-36267728 AACCCCTGTATACTCTTGATGGG - Intergenic
1066748649 10:38629857-38629879 AGCCTTTGTATACTGTTGGCGGG + Intergenic
1066968025 10:42287920-42287942 AGCCTTTGTATACTGTTGGTGGG - Intergenic
1067016774 10:42762558-42762580 AACCCTTGCATACTGTTGGTGGG - Intergenic
1067032476 10:42887562-42887584 AACCCTTGTCTACTTTTGATGGG - Intergenic
1067132603 10:43578327-43578349 AATCATTGTACACTGTTGATGGG - Intergenic
1067161605 10:43830069-43830091 AACCTTTGTAAACTGTTGGTGGG + Intergenic
1067265338 10:44737016-44737038 AACCCTTGTATATTGTTGGTGGG - Intergenic
1067959467 10:50831944-50831966 AATACTTGCATACTGTTGATGGG + Intronic
1068041933 10:51835847-51835869 AACCCTTGTATACTGTTGGCAGG - Intronic
1068127748 10:52862369-52862391 AACATTTTTATACTGTTGGTTGG - Intergenic
1068168442 10:53361022-53361044 AACCCTTGTACACTGTTGGTGGG - Intergenic
1068268506 10:54687185-54687207 AACTCTTGAAAACTGTTGGTGGG + Intronic
1068413767 10:56690289-56690311 AACTTTTGTACACTGTGGATGGG - Intergenic
1068697796 10:59986851-59986873 AACCCTTGTACACTGTTGATGGG - Intergenic
1068725956 10:60303619-60303641 AACCCTGGTACACTGTTGATTGG + Intronic
1068830576 10:61490341-61490363 AACTTTTGCATACTTTTGGTGGG + Intergenic
1068858126 10:61818372-61818394 AACGTTTTTATACTGTTGGTGGG + Intergenic
1069249461 10:66249660-66249682 AACTTTTGTACACTGTTGGTGGG + Intronic
1070024011 10:72614254-72614276 AACCCTTGTACACTGCTGATAGG + Intronic
1070097614 10:73353258-73353280 AACCTTTGGCTGTTGTTGATGGG - Intronic
1070365867 10:75736507-75736529 ATACTGTGAATACTGTTTATTGG + Intronic
1070422849 10:76254464-76254486 AATATATGAATACTCTTGATTGG - Intronic
1070508184 10:77135371-77135393 AACCCTTGCATACTGTTGATGGG + Intronic
1070575638 10:77676043-77676065 CACCTTCAAATACTGTTGGTGGG + Intergenic
1070871077 10:79753855-79753877 AACATTTATATGCTGTTGATAGG + Intergenic
1071406250 10:85335760-85335782 AACCTTTGTACACAGTTGGTGGG + Intergenic
1071605835 10:86988097-86988119 AACCCTTGCATACTGTTGGTGGG - Intergenic
1072084043 10:92060894-92060916 AACCCTTGTACACTGTTGGTTGG + Intronic
1072366230 10:94712799-94712821 AACACTTGTGTACTGTTGATGGG - Intronic
1072494423 10:95941724-95941746 AACCCTTGTACACTGTTGGTGGG + Intergenic
1072678348 10:97485855-97485877 AACCTTTGTACACTGTTGGTGGG + Intronic
1072741039 10:97909584-97909606 TACCCTTGTATACTGTTGGTGGG + Intronic
1072776024 10:98194848-98194870 AACCCTTGCACACTGTTGGTGGG + Intronic
1072824673 10:98594914-98594936 ATCCTTTGCACACTGTTGGTGGG - Intronic
1072860795 10:99003452-99003474 AACCCTTGCATGCTGTTGGTGGG - Intronic
1073132468 10:101198483-101198505 AACCCTTGTATGCTGTTGGTTGG + Intergenic
1073198335 10:101713810-101713832 AATCTTTGTACACTGTTGGTGGG - Intergenic
1073314968 10:102573365-102573387 CACCCTTGTACACTGTTGATAGG + Intronic
1073534077 10:104259028-104259050 AACCTTTGCACACTGTTGGCGGG + Intronic
1073579736 10:104654414-104654436 AACCCTTGTACACTGTTGGTGGG - Intronic
1073702089 10:105938505-105938527 AACCCTTGAACACTGTTGGTGGG + Intergenic
1073823749 10:107295734-107295756 AACATTTGTACACTATTGATGGG + Intergenic
1073835733 10:107439106-107439128 AGCCTTTTAATACTGTTACTAGG - Intergenic
1073846301 10:107559069-107559091 AACCCTTGCACACTGTTGGTAGG + Intergenic
1073872890 10:107886460-107886482 AACCCTTGTACACTGTTGGTGGG + Intergenic
1074017955 10:109553827-109553849 AACCCTTGTACACTGTTGGTGGG - Intergenic
1074304086 10:112260504-112260526 AACCTTTGTACACTGTTGGTGGG + Intergenic
1074408933 10:113207205-113207227 AACCCTTGTACACTGTTGGTAGG + Intergenic
1074494333 10:113966355-113966377 AATCTTTGTGCACTGTTGATGGG - Intergenic
1074565155 10:114570971-114570993 AGCCCTTGAACACTGTTGGTAGG - Intronic
1074645997 10:115453307-115453329 AACTCTTGTATACTGTTTATGGG - Intronic
1075216092 10:120537070-120537092 AACCCTTGTACACTGTTGGTGGG + Intronic
1075353742 10:121751424-121751446 AACCTTTGTATACTGCTGGTGGG - Intronic
1075753968 10:124796112-124796134 AACCCTTGTACACTGTTGGTAGG - Intergenic
1075893555 10:125975453-125975475 AACCTTTATACACTGTTGGTGGG - Intronic
1075968642 10:126634010-126634032 AACCTTTGCACACTGTTGGTGGG + Intronic
1076050633 10:127330463-127330485 AACCCTTGTGTACTGTTGCTGGG + Intronic
1076320560 10:129578064-129578086 AACACTTTAATACTGTTGGTGGG + Intronic
1076333377 10:129688300-129688322 AACACTTTAATACTGTTGGTGGG - Intronic
1076419466 10:130319816-130319838 AACGTTTGTACACTGTTGGTGGG - Intergenic
1077707263 11:4498687-4498709 AACATTTGCACACTGTTGGTGGG - Intergenic
1077952532 11:6975959-6975981 AACCCTTGTATACTGTTGATGGG - Intronic
1078260957 11:9708252-9708274 AACCCTTGCACACTGTTGGTGGG - Intronic
1078311260 11:10245527-10245549 ACCCTTTGTATACTGTTGGTGGG + Intronic
1078394490 11:10967908-10967930 AACTTTTGTACACTGTTGGTGGG + Intergenic
1078429059 11:11273573-11273595 AACCTTTGTACATTGTTGGTGGG + Intronic
1078490782 11:11766344-11766366 AACCCTTGTGTACTATTGATGGG + Intergenic
1078625728 11:12955883-12955905 AACACTTGTACACTGTTGATGGG + Intergenic
1078813001 11:14789576-14789598 TACCTTTGGATACTATTCATTGG - Intronic
1078903174 11:15660602-15660624 AACCTGTGAAAACTCTTGGTCGG + Intergenic
1079166517 11:18049028-18049050 AACCCTTGTACACTGTTGGTGGG + Intergenic
1079253565 11:18806831-18806853 AACTCTTATATACTGTTGATGGG - Intergenic
1079254371 11:18814298-18814320 AATCTTTGTACACTGTTGGTGGG - Intergenic
1079277030 11:19050169-19050191 AACCCTCGCATACTGTTGGTGGG + Intergenic
1079420832 11:20286122-20286144 AACCCTTGTACACTGTTGGTGGG - Intergenic
1079625518 11:22612248-22612270 AACCCTTGTACACTGTTGGTGGG - Intergenic
1079687319 11:23376040-23376062 AACCCTTGAACACTCTTGGTGGG + Intergenic
1079736469 11:24003023-24003045 AACCCTTGTGTACTGTTGCTGGG + Intergenic
1079804820 11:24916943-24916965 AACACTTTAACACTGTTGATGGG - Intronic
1079838841 11:25368584-25368606 AACCCTTGTACACTGTTGGTGGG + Intergenic
1079961023 11:26923416-26923438 AACCCTTGTACACTGTTGGTGGG - Intergenic
1080067339 11:28033239-28033261 AACACTTGTATACTGTTCATGGG + Intronic
1080191161 11:29550899-29550921 AATTTTTGAATACTGTTATTTGG - Intergenic
1080216569 11:29849313-29849335 AACCCTTGTAGACTGTTGGTGGG + Intergenic
1080721358 11:34852297-34852319 AACACTTGAACACTGTTGGTGGG + Intergenic
1080888996 11:36392427-36392449 AACCTTCATATACTGTTGGTGGG - Intronic
1080899521 11:36475209-36475231 AACCCTTGTATATTGTTGGTTGG + Intergenic
1080982634 11:37426697-37426719 AACCCTTGTACACTGTTGACGGG + Intergenic
1081120684 11:39261903-39261925 AACCCTGGTATACTGTTGATGGG + Intergenic
1081216795 11:40409761-40409783 AATCCTTGAACACTGTTGATGGG + Intronic
1081337392 11:41883482-41883504 AAGCCTTGTATACTGTTGGTGGG + Intergenic
1081358926 11:42147715-42147737 AACCCTTATACACTGTTGATGGG - Intergenic
1081402532 11:42659737-42659759 AACCCTTGTACAGTGTTGATGGG - Intergenic
1081722059 11:45297179-45297201 AACCCTTCTACACTGTTGATGGG - Intergenic
1081945335 11:46988092-46988114 AACCCTTCTACACTGTTGATGGG + Intronic
1082190657 11:49239332-49239354 AACCCTTGTATACTGCTGGTGGG + Intergenic
1082745101 11:56952426-56952448 AACCCTTGTGTACTGTTGGTGGG + Intergenic
1082926814 11:58557074-58557096 AACCTTTATACACTGTTGGTGGG + Intronic
1082971706 11:59029823-59029845 AACCCTTGTGTACTGTTGGTGGG - Intronic
1083030532 11:59587708-59587730 AACCTTTGTGCACTGTTGGTGGG + Intronic
1083127575 11:60586984-60587006 AACCTTTGTACACTGTTCATGGG + Intergenic
1083345775 11:61990807-61990829 AACGCTTTTATACTGTTGATGGG + Intergenic
1083387208 11:62320345-62320367 AACCCTTGTACACTGTTGGTGGG - Intergenic
1083790460 11:64981742-64981764 AACCCTTGAACACTGTTGGTGGG - Intergenic
1083916969 11:65752989-65753011 AACCCTTGTACACTGTTGGTGGG - Intergenic
1084454876 11:69262703-69262725 AACCCTTGTACACTGTTGGTGGG + Intergenic
1084989292 11:72908492-72908514 AGCCCTTGTATACTGTTGCTGGG - Intronic
1085106922 11:73852627-73852649 AACCTTTATACACTGTTGATGGG + Intronic
1085179010 11:74517504-74517526 AACCCTTGTACACTGTTGGTAGG + Intronic
1085842839 11:80032810-80032832 AAACTTTGTACACTGTTGGTAGG + Intergenic
1086007377 11:82053539-82053561 AACCCTTGTACACTGTTGGTGGG + Intergenic
1086066234 11:82748235-82748257 AACCCTTGTACACTGTTGGTGGG + Intergenic
1086141197 11:83502530-83502552 CACCACTGAATACTTTTGATGGG + Intronic
1086415391 11:86584346-86584368 AACCCTTGTACACTGCTGATGGG + Intronic
1086473622 11:87145541-87145563 AACCTTTATATACTCTTGGTGGG - Intronic
1086474318 11:87154586-87154608 AACCCTTGTACACTGCTGATAGG - Intronic
1086675467 11:89601586-89601608 AACCCTTGTATACTGCTGGTGGG - Intergenic
1086737460 11:90323638-90323660 AACCGTTGTACACTGTTGGTGGG - Intergenic
1086791872 11:91049988-91050010 AACCCTTGACTATTGTTGGTGGG + Intergenic
1086847112 11:91764718-91764740 AACCCTTGTACACTGTTGGTGGG - Intergenic
1087517941 11:99189495-99189517 AACCTTTGCATAGTGTTGGTAGG - Intronic
1087617396 11:100503863-100503885 AACCCTTGTACACTTTTGATTGG + Intergenic
1087988357 11:104713631-104713653 AACATTTGTACACTGTTGGTAGG - Intergenic
1088062209 11:105668613-105668635 AACCTTTGTATACTGATGGGTGG - Intronic
1088089948 11:106025882-106025904 AACCCTTGTACACTGTTGGTGGG - Intergenic
1088584456 11:111349532-111349554 AACCCTTGTACACTGTTGGTGGG + Intergenic
1088643289 11:111894783-111894805 AACCCTTGTACACTGTTGGTGGG + Intergenic
1088766440 11:112984506-112984528 AACCCTTGTACACTGTTGGTGGG - Intronic
1088943630 11:114486103-114486125 AACCCTTGTACACTGTTGGTGGG - Intergenic
1088988789 11:114932716-114932738 AACACTTACATACTGTTGATGGG - Intergenic
1089106725 11:116013862-116013884 AACCCTTGAATACTGTTGGCAGG - Intergenic
1089578389 11:119463149-119463171 AACCCTTGTACACTGTTGGTGGG - Intergenic
1089827077 11:121287773-121287795 AGCCCTTGTATACTGTTGGTGGG + Intergenic
1090046453 11:123339288-123339310 AACCTTTATACACTGTTGGTGGG + Intergenic
1090321868 11:125852138-125852160 AACCCTTGTACACTGTTCATGGG - Intergenic
1090484401 11:127099584-127099606 AATCTTTGCACACTGTTGGTGGG + Intergenic
1090520880 11:127477784-127477806 AAACTGTTAATATTGTTGATTGG - Intergenic
1090761805 11:129843825-129843847 AACCTTTACATACTGTTGGTGGG + Intronic
1090962371 11:131568527-131568549 GACCTTTGCATAGTTTTGATTGG + Intronic
1091547478 12:1511609-1511631 AACCCTTGTACACTGTCGATGGG - Intergenic
1091594562 12:1867995-1868017 AACCTTTGTACACTGTTGGTGGG + Intronic
1091606801 12:1959615-1959637 AATCCTTGTATACTGTTGGTGGG + Intronic
1091709495 12:2728132-2728154 AATCTTTATACACTGTTGATGGG - Intergenic
1092404842 12:8213243-8213265 AACCTTTGTATACTGGTGGTGGG - Intergenic
1092452613 12:8617110-8617132 AACCTTTGTACACTGTTGGTGGG - Intergenic
1092465738 12:8729816-8729838 AACCCTTGTACACTCTTGATGGG - Intronic
1092838858 12:12518544-12518566 TACCTTGGAATCCTGTTAATGGG - Intronic
1093060109 12:14593377-14593399 AACGTTTATATACTGTTGGTGGG - Intergenic
1093064060 12:14638247-14638269 AACCCTTACACACTGTTGATGGG + Intronic
1093115328 12:15202909-15202931 AATCCTTGTATACTGTTGATGGG - Intronic
1093135758 12:15448555-15448577 AAACCTTGCACACTGTTGATGGG + Intronic
1093410255 12:18856747-18856769 AACCCTTGTGTACTGCTGATGGG + Intergenic
1093734535 12:22605646-22605668 AACCCTTTTACACTGTTGATGGG + Intergenic
1093782869 12:23156721-23156743 AACATTTTTACACTGTTGATGGG - Intergenic
1093850510 12:24031073-24031095 AACCCTTGCATACTGTTGGTGGG + Intergenic
1093857026 12:24117340-24117362 AACCCTTGTACACTGTTGGTGGG + Intergenic
1093891264 12:24524697-24524719 AACTTTTGTACACTGTTGATGGG + Intergenic
1094036723 12:26079793-26079815 AATTTTTGTATACTGTTGGTGGG + Intronic
1094136733 12:27135629-27135651 AACCCTTGTACACTGTTGGTGGG + Intergenic
1094140241 12:27173288-27173310 CACCTTTGTACACTGTTGGTGGG - Intergenic
1094186464 12:27648379-27648401 AACCCTTGTACACTGTTGGTGGG + Intronic
1094211671 12:27899905-27899927 AACGTTTATATACTGTTGGTGGG + Intergenic
1094215484 12:27936755-27936777 AACCTTTGTACATTGTTGGTGGG + Intergenic
1094355795 12:29575855-29575877 AACCTTTGTACATTGTTGGTGGG - Intronic
1094446739 12:30539238-30539260 AACCTTTGTACATTGTTGGTGGG - Intergenic
1094785359 12:33842305-33842327 ACCCTTTGCATGCTGTTGGTAGG - Intergenic
1095108676 12:38266675-38266697 AACACTTTTATACTGTTGATGGG + Intergenic
1095149342 12:38772646-38772668 AACCCTTGTACACTGTTGCTAGG + Intronic
1095408770 12:41898918-41898940 AACCCTTGTACACTGTTGGTGGG + Intergenic
1095437283 12:42204184-42204206 AACCTTTGTACACTGCTGGTGGG + Intronic
1095517137 12:43018802-43018824 AACCCTTGTACACTGTTGGTGGG + Intergenic
1095628898 12:44350974-44350996 AACCCTTGTACACTGTTGGTGGG - Intronic
1095680285 12:44966756-44966778 AACTTTTGCACACTGTTGGTGGG + Intergenic
1095823869 12:46510710-46510732 AACCTTTACACACTGTTGATGGG - Intergenic
1095854693 12:46847478-46847500 AAGCTTTGTACACTGTTGACGGG - Intergenic
1095902515 12:47342751-47342773 AACCCTTTTATACTGTTGGTGGG + Intergenic
1096026660 12:48370534-48370556 AACCTTTGTATGCCCTTGATGGG + Intergenic
1096040786 12:48514735-48514757 AACCTTTGTACATTGTTGATGGG - Intronic
1096163011 12:49396317-49396339 AACCCTTGTACACTGTTGGTGGG - Intronic
1096303470 12:50452543-50452565 AACTTTTGTACACTGTTGCTGGG - Intronic
1096752813 12:53773097-53773119 AACCTTTGTGTACTGCTGGTTGG + Intergenic
1096897819 12:54841453-54841475 AACATTTGTATACTGTTTGTAGG - Intronic
1096968223 12:55645714-55645736 AACACTTGTATACTGCTGATGGG - Intergenic
1097509983 12:60527415-60527437 AACCCTTGTATACTGTTGCTGGG - Intergenic
1097610738 12:61816632-61816654 AACGCTTAAATACTGTTGGTGGG - Intronic
1097637933 12:62145018-62145040 CACCTTTGATTATTGTTGAAGGG - Intronic
1097660801 12:62428969-62428991 AACCCTTGTACACTGTTGGTAGG - Intergenic
1097742145 12:63255706-63255728 AACCCTTGTTCACTGTTGATGGG + Intergenic
1097763694 12:63498743-63498765 AACCCTTGTATACTGTTGTTGGG - Intergenic
1097819914 12:64118203-64118225 AACCTTTGTACACTGCTGGTGGG - Intronic
1097898021 12:64845229-64845251 AACCCTTGTACACTGTTGGTGGG - Intronic
1098047682 12:66418824-66418846 AACCCTGGTACACTGTTGATGGG + Intronic
1098317139 12:69204717-69204739 AGGCTTTGAATAATTTTGATAGG - Intergenic
1098332881 12:69373249-69373271 AACCCTTATATACTGTTGGTGGG - Intronic
1098429599 12:70405516-70405538 AACCCTTGCATACCGTTGGTGGG + Intronic
1098506556 12:71258514-71258536 AACCCTTGCACATTGTTGATGGG + Intronic
1098508747 12:71285876-71285898 AACCTTTGAATACTGTTGATGGG - Intronic
1098556158 12:71821478-71821500 AATCTTTGTACACTGTTGGTGGG - Intergenic
1098582406 12:72115659-72115681 AACCATTGTACACTGTTGGTGGG - Intronic
1098648280 12:72932904-72932926 AATCTTTGTACACTGTTGGTGGG - Intergenic
1098656270 12:73034080-73034102 AACCCTTTTATACTGTTGGTGGG + Intergenic
1098786691 12:74767367-74767389 AACCTGTGTACACTGTTGGTGGG + Intergenic
1098798948 12:74928479-74928501 AAACCTTGAATACTGTTGATGGG + Intergenic
1098823661 12:75266452-75266474 AACCTTTGCACACTGTTGGTGGG + Intergenic
1098984337 12:76994971-76994993 AACCCTTGTACACTGTTGGTAGG + Intergenic
1099092931 12:78336805-78336827 AACCCTTGTACACTGTTGGTGGG + Intergenic
1099159179 12:79218973-79218995 AACCCTTGCACACTGTTGGTGGG - Intronic
1099271637 12:80518093-80518115 AACCCTTGTACACTGTTGGTGGG - Intronic
1099310447 12:81014209-81014231 AACATTTATATACTGTTGGTGGG - Intronic
1099391368 12:82083665-82083687 AACCCTTGTATACTTTTGATGGG - Intergenic
1099502886 12:83435508-83435530 AAGCTTTGAATCCAGGTGATAGG + Intergenic
1099696723 12:86032373-86032395 AACGCTTGTATACTGTTGGTAGG - Intronic
1099921056 12:88957644-88957666 AACAATGGAATTCTGTTGATTGG - Intergenic
1099941200 12:89191333-89191355 AACCCTTGAACATTGTTGGTGGG + Intergenic
1100428713 12:94511227-94511249 AACCCTTGTACACTGTTGGTGGG - Intergenic
1100499519 12:95160409-95160431 AACCTTTATATATTGTTGGTGGG + Intronic
1100651892 12:96599618-96599640 AACGTTTTTACACTGTTGATGGG - Intronic
1100710901 12:97255836-97255858 AAACTTTGAATAAAGTGGATTGG - Intergenic
1100755309 12:97744909-97744931 AACCTTTGTACACTGTTGGTGGG + Intergenic
1100879643 12:99002261-99002283 AACCCTTGCATACTGTTTGTGGG - Intronic
1100958156 12:99932384-99932406 AACATTTGTATGCTGTTGGTGGG - Intronic
1100996819 12:100309872-100309894 AATCTTTGTGTACTGTTGGTGGG - Intronic
1101167961 12:102058583-102058605 AACCTCTGTACACTGTTGGTGGG + Intronic
1101414272 12:104495430-104495452 AACCCTTGTGTACTGTTGGTAGG - Intronic
1101527158 12:105541678-105541700 AACCCTTGTATACTATTGATAGG - Intergenic
1101716396 12:107317065-107317087 AACCTTTGTACACTGATGGTGGG - Intergenic
1101938061 12:109075293-109075315 AACTCTTGCATACTGTTGGTGGG - Intronic
1102659777 12:114515825-114515847 AACCTTTGTACACTGTTGGTGGG + Intergenic
1103047323 12:117747832-117747854 AACCCTTGTACACTGTTGGTGGG + Intronic
1103796638 12:123507617-123507639 AACCTTTATACACTGCTGATGGG + Intronic
1104524788 12:129510080-129510102 AGCCCTTGTACACTGTTGATGGG - Intronic
1104552283 12:129768327-129768349 AAACCTTGCATAATGTTGATGGG - Intronic
1105223356 13:18354921-18354943 AACCTTTGTACATGGTTGATAGG - Intergenic
1105347019 13:19582805-19582827 AACCCTTGTACACTGTTGGTGGG - Intergenic
1105388203 13:19951766-19951788 AACCCTTGCACACTGTTGCTAGG + Intergenic
1105592598 13:21808286-21808308 AACCCTTGTACACTGTTGGTAGG + Intergenic
1105677255 13:22684866-22684888 AACGTTTTTACACTGTTGATGGG - Intergenic
1105772283 13:23623559-23623581 AACCCTTGTATACTGCTGACGGG - Intronic
1105972462 13:25442356-25442378 AACCTTTGAGCACTGTTGGTGGG - Intronic
1106031033 13:26003137-26003159 AACCCCTGTACACTGTTGATGGG - Intronic
1106056646 13:26244204-26244226 AATCCTTGAACACTGTTGGTGGG + Intergenic
1106279069 13:28247031-28247053 AACATTGGTATGCTGTTGATGGG - Intronic
1106306954 13:28521006-28521028 GACCCTTGCATACTGTTGGTGGG - Intergenic
1106381918 13:29247780-29247802 AACACTTGAATACTGCTGGTGGG + Intronic
1106626852 13:31429453-31429475 AACCTTTGCACACTGTTGATGGG - Intergenic
1106733853 13:32569524-32569546 AACCCTTGTATGCTGTTGGTAGG - Intergenic
1106974303 13:35188840-35188862 AACCCTTGCACACTGTTGATAGG - Intronic
1107044651 13:35981900-35981922 AACTCTTGTACACTGTTGATGGG - Intronic
1107085748 13:36426379-36426401 AACCCTTGTACACTGTTGGTGGG + Intergenic
1107101955 13:36602894-36602916 AACCCTTGAATACTCTTGGTAGG + Intergenic
1107523589 13:41207366-41207388 AACCCTTGTACACTGTTGGTGGG - Intergenic
1108016049 13:46077455-46077477 AACCCTTGTACACTGTTGGTAGG + Intronic
1108135614 13:47354670-47354692 AACCCTTGCATACTGTTGGTGGG - Intergenic
1108175554 13:47789081-47789103 AACCTTTGCACACTATTGGTGGG + Intergenic
1108421665 13:50256813-50256835 AACGTTTTTACACTGTTGATGGG + Intronic
1108896662 13:55336925-55336947 AACTTTTGTTTACTGTTGATGGG - Intergenic
1108956269 13:56162039-56162061 AACCCTTATATACTCTTGATGGG + Intergenic
1108994418 13:56709471-56709493 GACCTTTATATAGTGTTGATGGG + Intergenic
1109040918 13:57335120-57335142 AACCCTTGTACACTGTTGGTGGG - Intergenic
1109080928 13:57900143-57900165 AAACTTTAAATACAGTTTATAGG - Intergenic
1109100276 13:58175014-58175036 AATCCTTGAACACTGTTGGTGGG - Intergenic
1109127728 13:58538931-58538953 AACCCTTTTACACTGTTGATGGG + Intergenic
1109214840 13:59577906-59577928 AATCCTTGTATACTGTTGGTAGG + Intergenic
1109271707 13:60262976-60262998 AACCCTTGCATACTATTGTTGGG - Intergenic
1109308652 13:60666347-60666369 AACCTTTATATGCTGTTGGTGGG - Intergenic
1109336038 13:60995223-60995245 CATCTTTAAATACTGTTTATGGG - Intergenic
1109438710 13:62341275-62341297 AACATTTGTACACTGTTGGTAGG - Intergenic
1109454114 13:62560898-62560920 AACCCCTGAACACTGTTGGTGGG + Intergenic
1109713646 13:66191492-66191514 AACCATTGTACACTGTTGGTGGG + Intergenic
1109744109 13:66598114-66598136 AACCTTTTTACACTGTTGGTGGG + Intronic
1109824833 13:67705051-67705073 AACCTCTGTATGCTGTTGGTGGG + Intergenic
1110493587 13:76138180-76138202 AACACTTACATACTGTTGATGGG - Intergenic
1110556578 13:76866554-76866576 AACCCTTGTACACTGTTGGTGGG - Intergenic
1110557142 13:76872721-76872743 AACCCTTGTACACTGTTGGTGGG + Intergenic
1110597176 13:77331994-77332016 AACACTTGAACACTGTTGGTGGG - Intergenic
1110679303 13:78289489-78289511 AACACTTGTACACTGTTGATGGG - Intergenic
1110734141 13:78914999-78915021 AACTCTTGCATACTGTTGGTGGG - Intergenic
1110759221 13:79212110-79212132 AACCCTTGCACACTGTTGGTGGG - Intergenic
1110877670 13:80529834-80529856 AACCTTTTAACAAAGTTGATAGG - Intergenic
1110899696 13:80805637-80805659 AACCTTTGTACACTGTTAGTGGG + Intergenic
1111155811 13:84323129-84323151 AACCCTTGTACACTGTTGGTGGG + Intergenic
1111380962 13:87451456-87451478 AACCCTTGAACAATGTTGGTGGG + Intergenic
1111383129 13:87485569-87485591 AACCTTTTTATACAGTTGGTGGG + Intergenic
1111424135 13:88057561-88057583 ACCCTTTGTATACTGTTGGTGGG - Intergenic
1111519588 13:89383357-89383379 AACTTTTGTATACAGTTGGTGGG - Intergenic
1111565635 13:90011475-90011497 AACACTTACATACTGTTGATGGG - Intergenic
1111595811 13:90408561-90408583 AACCATTTTACACTGTTGATGGG - Intergenic
1112136655 13:96586020-96586042 AACCCTTATATACTTTTGATGGG - Intronic
1112137420 13:96596713-96596735 AACATTTATATACTGTTGGTTGG + Intronic
1112564459 13:100541241-100541263 AACCTCAGAATTCTGTAGATGGG + Intronic
1112696528 13:101955087-101955109 AACTCTTGAATAGTGTGGATGGG + Intronic
1112747155 13:102539403-102539425 AACCCTTGCACACTGTTGGTGGG - Intergenic
1112815877 13:103272490-103272512 AACCTTTGCATACTGTTGGTGGG + Intergenic
1113042184 13:106116412-106116434 AACATTTTTATACTGTTGGTAGG + Intergenic
1113353901 13:109559296-109559318 AACTCTTGTGTACTGTTGATGGG + Intergenic
1113394599 13:109934969-109934991 AACCCTTATATACTGTTGGTGGG - Intergenic
1114068464 14:19087555-19087577 AACCCTTGCATACTGTTGGTGGG + Intergenic
1114093799 14:19312459-19312481 AACCCTTGCATACTGTTGGTGGG - Intergenic
1114147784 14:19997208-19997230 AACTTTTGTATCCTGTTAATTGG - Intergenic
1114369285 14:22067981-22068003 AACCCTTGTACACTGTTGGTAGG + Intergenic
1114747355 14:25164064-25164086 AACCCTTGTACACTGTTGGTGGG - Intergenic
1114925658 14:27394577-27394599 AACCCTTGCACACTGTTGGTGGG + Intergenic
1114984723 14:28211705-28211727 AACCTTTGTACACTGTTAGTGGG - Intergenic
1115196089 14:30801077-30801099 AACTTTTATATACTGTTGGTGGG - Intergenic
1115362782 14:32522721-32522743 AACATTTTTATACTGTTGGTGGG + Intronic
1115382200 14:32753157-32753179 AACCCTTGTACACTGTTGTTGGG - Intronic
1115656976 14:35452665-35452687 AACCCTTGTACACTGTTGGTGGG - Intergenic
1116021188 14:39463098-39463120 AACCCTTATATACTGTTGGTGGG - Intergenic
1116074778 14:40097246-40097268 AACCTTTATATATTGTTGATAGG - Intergenic
1116264968 14:42676234-42676256 AACCCTAGTATACTGTTAATGGG + Intergenic
1116269643 14:42745118-42745140 AACCCTTGTACACTGTTGGTGGG + Intergenic
1116276577 14:42841088-42841110 AAACCTTGTACACTGTTGATGGG - Intergenic
1116340599 14:43718275-43718297 CACCTTTGCACACTGTTGGTGGG + Intergenic
1116379635 14:44249574-44249596 AACCTTTGATTAATGTAGCTAGG - Intergenic
1116481690 14:45398634-45398656 AACCTTTGCACACTGTTGGTGGG + Intergenic
1116548691 14:46206016-46206038 AACCCTTGTACACTGTTGGTGGG + Intergenic
1116553943 14:46279220-46279242 AACCCTTGCACACTGTTGGTGGG - Intergenic
1116555623 14:46301659-46301681 CACCTTTGGAAAATGTTGATTGG + Intergenic
1116571192 14:46517813-46517835 AACCCTTGTACACTGTTGGTAGG + Intergenic
1116633307 14:47360603-47360625 AACCTTTGTATACTGTTGGTGGG + Intronic
1116775183 14:49171376-49171398 AACCCTTGCACACTGTTGGTGGG + Intergenic
1116844699 14:49854156-49854178 AACTTTTGTATGCTGTTGATGGG + Intergenic
1116906134 14:50405392-50405414 AACCCTTGTATACTGTTGGTGGG - Intronic
1116907102 14:50414880-50414902 AACCCTTGTACACTGTTGGTAGG - Intronic
1117033182 14:51697044-51697066 AACCCTTGTACACTGTTGCTGGG + Intronic
1117232339 14:53733489-53733511 AACCCTTGTACACTGTTGATGGG + Intergenic
1117381762 14:55171500-55171522 AACCCTTGTATGCTGTTGATGGG + Intronic
1117418712 14:55522721-55522743 AACCCTTGTATACTCTTGGTGGG + Intergenic
1117586910 14:57217138-57217160 GACATTTGTACACTGTTGATGGG + Intronic
1117589530 14:57252665-57252687 AACCCTTGCACACTGTTGGTGGG + Intronic
1117794881 14:59382168-59382190 AACCCTCGTATACTGTTGGTGGG - Intergenic
1117856049 14:60034951-60034973 AACCTGTGTACACTGTTGGTGGG - Intronic
1117914953 14:60668084-60668106 AACCCTTGTACACTGTTGGTGGG + Intergenic
1117994281 14:61464177-61464199 AACCCTTGTACACTGTTGGTGGG - Intronic
1118104643 14:62643808-62643830 AACTCTTGCATACTGTTGGTGGG + Intergenic
1118114245 14:62757322-62757344 AACCCTTGTATACTGTTGGTCGG + Intronic
1118141015 14:63082681-63082703 AACCTTTATACACTGTTGGTGGG + Intronic
1118244956 14:64101235-64101257 AACCCCTGAATACTGTCGGTGGG - Intronic
1118521863 14:66595176-66595198 AACCCTTGAAGACTGTTGGTTGG + Intronic
1118526162 14:66646352-66646374 AACCTTTGTGTATTGTTGGTGGG + Intronic
1119058651 14:71450783-71450805 AACCCTTGCATACTGTTGGTGGG + Intronic
1119342864 14:73895297-73895319 AACCTTTGTACACTGTTGGTGGG + Exonic
1119976611 14:79031129-79031151 AACCTTTTACTTCTGTTGAATGG + Intronic
1120017492 14:79490194-79490216 AACCACTGAACACTGTTGGTTGG + Intronic
1120182726 14:81362021-81362043 AACCCTTGTATAATGTTGGTGGG + Intronic
1120304757 14:82755058-82755080 AACATTGGTATACTGTTGATGGG + Intergenic
1120526534 14:85583453-85583475 CACATTTGAATTCTGTTCATGGG - Intronic
1120736575 14:88059728-88059750 AACCCTTGTACACTGTTCATGGG + Intergenic
1121153278 14:91657900-91657922 AACCCTTGTACACTGTTGGTGGG + Intronic
1121373628 14:93384309-93384331 AACCCTTGTACACTGTTGGTGGG - Intronic
1121464549 14:94106427-94106449 AACCATTGCACACTGTTGGTGGG - Intronic
1121487958 14:94333384-94333406 AATCTTTGTACACTGTTGGTAGG - Intergenic
1121597693 14:95178401-95178423 AACCCTTGTATGCTGTTGTTGGG - Intergenic
1122351734 14:101099108-101099130 AACCCTTGCACACTGTTGGTGGG - Intergenic
1122431209 14:101647122-101647144 AGCCTTTGTACACTGTTGGTGGG + Intergenic
1122755591 14:103976786-103976808 AACTCTTGTATACTGTTGGTAGG - Intronic
1123164410 14:106312805-106312827 AACATTTTTATACTGTTGGTGGG + Intergenic
1202846155 14_GL000009v2_random:178441-178463 AACACTTTTATACTGTTGATGGG - Intergenic
1202915614 14_GL000194v1_random:169046-169068 AACACTTTTATACTGTTGATGGG - Intergenic
1123839310 15:24230699-24230721 AACCCTTGTACACTGTTGGTGGG - Intergenic
1123917582 15:25048284-25048306 AACCTTTGCATGCTGTTGATGGG - Intergenic
1124034371 15:26040637-26040659 AACCCTTGTATACTGTTGGTGGG - Intergenic
1124056693 15:26246935-26246957 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1124091599 15:26608828-26608850 AACCCTTGTACACTGTTGGTAGG + Intronic
1124199263 15:27663264-27663286 AACCTTTGCATACTGTTGGTGGG + Intergenic
1124450764 15:29787928-29787950 AACCTTTGTACATTGCTGATAGG - Intronic
1124843461 15:33266465-33266487 AACCTTTGTACACTGTTGGTAGG - Intergenic
1125060952 15:35423171-35423193 AACCCTTGTATACTGTTGGTGGG - Intronic
1125103944 15:35949111-35949133 AACTTTTGAATGCTGCTGAGAGG + Intergenic
1125170996 15:36766517-36766539 AACCTTTGTATGCTGTTGGAGGG - Intronic
1125207596 15:37172021-37172043 AACCTCTGAATAGCGTTGACAGG - Intergenic
1125456018 15:39859547-39859569 AACCTTTGTGCACTGTTGGTGGG + Intronic
1125564929 15:40669756-40669778 AACCCTTGTACACTGTTGGTGGG - Intergenic
1125776370 15:42219021-42219043 AACCCTTGTACTCTGTTGATAGG - Intronic
1126011702 15:44309169-44309191 AACCCTTGAACATTGTTGGTGGG + Intronic
1126177325 15:45748806-45748828 TACCTCTGTATACTGTTGGTGGG - Intergenic
1126207882 15:46066852-46066874 AACCTTTTTACACTGTTGGTGGG + Intergenic
1126213130 15:46122460-46122482 AATCTTTGTACACTGTTGGTGGG - Intergenic
1126287688 15:47032896-47032918 AAACTTTGTACCCTGTTGATGGG - Intergenic
1126392510 15:48174817-48174839 AACCTTTAGATACTGCTGGTGGG + Intronic
1126437643 15:48652398-48652420 AACCTTTGCATTTTGTGGATGGG + Intergenic
1126708897 15:51434767-51434789 AACCATTGTATGCTGTTGGTGGG - Intergenic
1126874547 15:53026056-53026078 AACCCTCATATACTGTTGATGGG - Intergenic
1127024344 15:54786383-54786405 AACATTTGTAGACTGTTGGTAGG + Intergenic
1127316598 15:57800812-57800834 AACCCTTGCGTACTGTTGATGGG - Intergenic
1127410526 15:58701516-58701538 AACTCTTCTATACTGTTGATAGG + Intronic
1127424878 15:58845577-58845599 AACCCTTATACACTGTTGATGGG + Intronic
1128048979 15:64645912-64645934 AACCCTTGAGAACTGTTGGTTGG + Intronic
1128126841 15:65199169-65199191 AACCATAGAATACTGTAGAGAGG - Intronic
1128884376 15:71272924-71272946 AACCTTTGTCTACCGTTGGTGGG + Intronic
1128996153 15:72296829-72296851 AACTCTTGCACACTGTTGATAGG + Intronic
1129133195 15:73519508-73519530 AACCCTTATACACTGTTGATGGG + Intronic
1129541719 15:76355285-76355307 AGCCTTTAGAGACTGTTGATAGG + Intronic
1129548996 15:76428155-76428177 AACACTTGAACACTGTTGGTGGG + Intronic
1129576786 15:76757718-76757740 AACCCTTGTATGCTGTTGGTAGG - Intronic
1129957939 15:79656273-79656295 AATCTCTCAATACTGTTGATTGG - Intergenic
1129962571 15:79700848-79700870 AACCTTTGAACACTGCTGGTGGG + Intergenic
1131288681 15:91085154-91085176 AAGCTTTGTATACTGTTGTTTGG - Intergenic
1131607856 15:93927889-93927911 AACCCTTGTAAACTGTTGGTGGG - Intergenic
1131631346 15:94179920-94179942 AACCCCTGTATACTGTTGGTGGG + Intergenic
1132152166 15:99469972-99469994 AACCCTTGCATATTGTTGGTGGG - Intergenic
1133238233 16:4399017-4399039 AACCCTTGCACACTGTTGATGGG + Intronic
1133543439 16:6779625-6779647 AACCCTTGTATACTATTGGTGGG - Intronic
1133642415 16:7730115-7730137 AACCTTTGTATACTGTTGGTGGG + Intergenic
1133716687 16:8457084-8457106 AACCTTCAAAAACTGTTGGTGGG + Intergenic
1133822984 16:9253364-9253386 AACCCTTGTAAACTGTTGGTGGG - Intergenic
1134193986 16:12144423-12144445 CACCTTTTTATACTGTTGCTTGG - Intronic
1134225159 16:12384330-12384352 AAGCCTTGTACACTGTTGATGGG - Intronic
1134289730 16:12894203-12894225 ATCCTCTGAATATTGTTGGTTGG + Intergenic
1134432929 16:14228160-14228182 AACTCTTGTATACTGTTGGTGGG + Intronic
1134779019 16:16878637-16878659 AACCTCTGAAAAGGGTTGATAGG + Intergenic
1134796701 16:17045453-17045475 AACCCTTGTATACTGTTGATGGG - Intergenic
1134864680 16:17594451-17594473 AACCCTTGGGTACTGTTGGTGGG - Intergenic
1136734109 16:32447442-32447464 AGCCTTTGTATACTGTTGGCAGG - Intergenic
1137281676 16:46982245-46982267 AACCCTTGCACACTGTTGGTAGG - Intergenic
1137341209 16:47607790-47607812 AACCCTCAAATAGTGTTGATGGG - Intronic
1137667025 16:50256739-50256761 AACCCTTGAGCACTGTTGGTGGG + Intronic
1139182063 16:64760216-64760238 AACTCTTGTATACTGTCGATGGG - Intergenic
1140009484 16:71116640-71116662 AACCCTTGTACACTGTTGGTGGG - Intronic
1140333957 16:74085870-74085892 AACCTTTGCACACTGTTGATGGG - Intergenic
1140446391 16:75031953-75031975 AACCCTTATATACTGTTGGTGGG - Intronic
1140546322 16:75813327-75813349 AACCCTTGTACACTGTTGGTAGG - Intergenic
1140570502 16:76100616-76100638 AACCCTTGCACACTGTTGGTGGG - Intergenic
1140576149 16:76171600-76171622 AACCTTTGTTCACTGTTGTTGGG - Intergenic
1140668715 16:77252824-77252846 AACTGTTGCATACTGTTGGTGGG - Intronic
1141011107 16:80400526-80400548 AACCCTTGTATACTGTTGGTGGG + Intergenic
1141221894 16:82078415-82078437 AACCCTTGTACACTGTTCATGGG + Intronic
1141226869 16:82125593-82125615 AACCATTGTACACTGTTGGTGGG + Intergenic
1141350927 16:83295703-83295725 AACCCTTGCCCACTGTTGATGGG + Intronic
1141494779 16:84400685-84400707 AACCCTTGTACACTGTTGGTAGG - Intronic
1203018970 16_KI270728v1_random:382153-382175 AGCCTTTGTATACTGTTGGCAGG + Intergenic
1203037305 16_KI270728v1_random:655311-655333 AGCCTTTGTATACTGTTGGCAGG + Intergenic
1143430811 17:6882042-6882064 AACCCTTGTACACTGTTGGTGGG - Intronic
1143436304 17:6929868-6929890 AACCCTTGTACACTGTTGGTGGG + Intronic
1144009393 17:11131945-11131967 AACCCTTGTATACTGTTGGTGGG - Intergenic
1144597102 17:16579458-16579480 AACCCTTGTACACTGTTGGTGGG - Intergenic
1145295239 17:21585955-21585977 AACCCTTGAACACTCTTGGTGGG + Intergenic
1146090948 17:29877253-29877275 AACCCTTGTAAACTGTTGATCGG + Intronic
1146303791 17:31713933-31713955 AACCCTCGAACACTGTTGGTGGG + Intergenic
1146606431 17:34262244-34262266 AATCTTTGTTTACTGTTGGTGGG - Intergenic
1146841475 17:36158919-36158941 AACCCTTGTACACTGTTGGTTGG - Intergenic
1146853727 17:36246559-36246581 AACCCTTGTACACTGTTGGTTGG - Intronic
1146869634 17:36370451-36370473 AACCCTTGTACACTGTTGGTTGG - Intronic
1147072511 17:37971075-37971097 AACCCTTGTACACTGTTGGTTGG - Intergenic
1147084034 17:38050612-38050634 AACCCTTGTACACTGTTGGTTGG - Intronic
1147099981 17:38174579-38174601 AACCCTTGTACACTGTTGGTTGG - Intergenic
1148361083 17:47012757-47012779 AACCTTCATATACTGTTGATGGG + Intronic
1148986169 17:51623612-51623634 AACCTTTGTACACTGTTGATGGG + Intergenic
1148993931 17:51691180-51691202 AACCCTGAAACACTGTTGATGGG - Intronic
1149079346 17:52634986-52635008 AACAATTATATACTGTTGATGGG + Intergenic
1149142938 17:53456198-53456220 AACCTATGTATGCTATTGATGGG - Intergenic
1149156653 17:53638903-53638925 AACCCTTGCACACTGTTGGTGGG - Intergenic
1149663451 17:58349086-58349108 AACCTTTGGGCACTGTTGGTGGG + Intronic
1149857829 17:60098430-60098452 AACCCTTGTACACTGTTGGTTGG + Intergenic
1150035811 17:61795865-61795887 AACCCTCGTATACTGTTGGTGGG - Intronic
1150082984 17:62257869-62257891 AACCCTTGTACACTGTTGGTTGG - Intergenic
1150483097 17:65525621-65525643 AACTCTTGTATACTGTTGGTGGG + Intergenic
1150541790 17:66108644-66108666 AACCTTTGTACAGTGTTAATAGG + Intronic
1150846965 17:68668817-68668839 AACCTTTATATACTGCTGGTGGG + Intergenic
1150986183 17:70199702-70199724 AACATTTGTATACTGTTGGTGGG - Intergenic
1150993270 17:70285961-70285983 AACTTTTGCACACTGTTGGTGGG + Intergenic
1151071499 17:71218059-71218081 AACCCTTGTATACTATTGGTGGG + Intergenic
1151240780 17:72756079-72756101 AACCCTTGAGCACTGTTGGTAGG + Intronic
1151324895 17:73373472-73373494 AACCTTTGCACGCTGTTGGTGGG - Intronic
1151633706 17:75329015-75329037 AAGGTTTAAATACCGTTGATTGG - Intronic
1153056137 18:948588-948610 AACATTTGTACACTGTTGGTGGG - Intergenic
1153074848 18:1150173-1150195 AACCCTTGTACACTGTTGGTAGG - Intergenic
1153397040 18:4635108-4635130 AACCTTTGTACACTGTTGGTGGG + Intergenic
1153397121 18:4636280-4636302 AACTTTTGTATACTGCTGGTGGG + Intergenic
1153430548 18:5011717-5011739 AACCCTTGTACACTGTTGATGGG + Intergenic
1153540826 18:6152342-6152364 AACCCTTGTACACTGTTAATAGG - Intronic
1153821184 18:8833405-8833427 AACCCTTGAGCACTGTTGGTGGG + Intergenic
1154235728 18:12603871-12603893 AATCATTGACTACTGGTGATAGG - Intronic
1154295950 18:13148366-13148388 AACCTTTGTACACTATTGGTGGG - Intergenic
1154396139 18:13991113-13991135 AACCTTTGTATACTTTTGCTGGG + Intergenic
1155113096 18:22735940-22735962 AACCCTTGAACACTGTTGGTGGG + Intergenic
1155262278 18:24055345-24055367 AACCTTTGCATACCGTTGGTGGG - Intronic
1155631076 18:27893520-27893542 AACCTTTATATAGTGTTGGTGGG + Intergenic
1155669889 18:28357283-28357305 GACCTTTTAAAAATGTTGATTGG - Intergenic
1155701856 18:28754863-28754885 AACCCTTGTGTACTGTTGGTGGG + Intergenic
1155765930 18:29632581-29632603 AAACTTTGTACACTGTTGATGGG - Intergenic
1155926798 18:31664416-31664438 AAACTTTGAAAACTTTTCATAGG - Intronic
1156007610 18:32462241-32462263 AACCTTTACATACTGTTGGTGGG - Intronic
1156124373 18:33885701-33885723 AACCCTTGTACACTGTTGGTGGG + Intronic
1156146904 18:34193616-34193638 AACCTTTGCACACTGTTGATAGG + Intronic
1156180578 18:34598955-34598977 AAACATTGAATATAGTTGATGGG + Intronic
1156218866 18:35030607-35030629 AATATTTGAATACTTTTTATGGG - Intronic
1156292354 18:35759002-35759024 AACCCTTGTACACTGTTGGTGGG + Intergenic
1156972910 18:43179064-43179086 AACCCTTGTACACTGTTGGTAGG + Intergenic
1157879857 18:51311089-51311111 AACCCTTGTACACTGTTGGTGGG + Intergenic
1157881695 18:51327125-51327147 AACCGTTGTGTACTGTTGGTGGG - Intergenic
1157917745 18:51684703-51684725 GACCCTTGTATACTGTTGGTGGG + Intergenic
1157967707 18:52227015-52227037 AACCTTTGAAAAGTGTTTATTGG + Intergenic
1158173649 18:54628269-54628291 AACCCTTGTACACTGTTGATGGG + Intergenic
1158737673 18:60102561-60102583 AACGTTTTTATACTGTTGGTGGG + Intergenic
1158753526 18:60294743-60294765 AACCCTTGTGTACTGTTGGTGGG - Intergenic
1158765134 18:60441625-60441647 AACATTTTTATACTGTTGGTGGG - Intergenic
1158775272 18:60571200-60571222 AACATTTTTATACTGTTGGTGGG - Intergenic
1158913921 18:62100347-62100369 AACCTTTGTACATTGTTGGTGGG + Intronic
1158925938 18:62260419-62260441 AACCTTCGTACACTGTTGGTAGG + Intronic
1159074971 18:63670210-63670232 AACCCTTGTACACTGTTGGTGGG - Intronic
1159169306 18:64743445-64743467 AACCCTTGCATACTTTTGGTGGG - Intergenic
1159216980 18:65405162-65405184 AACACTTGTACACTGTTGATAGG + Intergenic
1159224511 18:65514882-65514904 AACCCTTGTACACTGTTGATGGG + Intergenic
1159321664 18:66858890-66858912 AAACTCTGGATACTGTTGGTGGG + Intergenic
1159394308 18:67836367-67836389 AATCCTTGTACACTGTTGATGGG - Intergenic
1159456700 18:68668601-68668623 AACACTTAAATACTGTTCATGGG + Intergenic
1159710840 18:71757648-71757670 AACCCTTGTATACTGTTGATGGG + Intronic
1159739310 18:72145870-72145892 TAACTTTGTATACTGTTGGTGGG + Intergenic
1159957313 18:74528736-74528758 AACCCTTGCACACTGTTGGTGGG + Intergenic
1160181721 18:76642494-76642516 AACCCCTGTACACTGTTGATGGG - Intergenic
1160284191 18:77524616-77524638 AAACCTTGTACACTGTTGATAGG + Intergenic
1160305630 18:77732977-77732999 AACCCTTGAACACTGTTGGTGGG - Intergenic
1160467289 18:79090383-79090405 AACCCTTGTACACTGTTGGTGGG - Intronic
1162664404 19:12197372-12197394 AACCTTTGTATACTGTTGATGGG - Intergenic
1162669554 19:12243779-12243801 AAGCTTTGTATACTGTTGGTGGG - Intronic
1162698246 19:12494136-12494158 AACCTTTGTACACTGTTGGTGGG + Intronic
1163015753 19:14453189-14453211 AACCTTTGTGCACTGTTGGTGGG + Intronic
1163224880 19:15952327-15952349 AACCCTTGTACACTGTTGTTGGG - Intergenic
1164196320 19:22966025-22966047 AATCTTTCTACACTGTTGATGGG - Intergenic
1164443212 19:28295461-28295483 AACATTTGTACACTGTTGGTGGG - Intergenic
1164467266 19:28498003-28498025 AACCCTTGTACACTGTTGATAGG + Intergenic
1164569593 19:29363077-29363099 AACCCTTGTACACTGTTGGTGGG + Intergenic
1164877717 19:31703773-31703795 AATCTTTGTACACTGTTGGTAGG - Intergenic
1164901346 19:31928048-31928070 AACATTTATATACTGTTGGTGGG + Intergenic
1165553812 19:36611755-36611777 AACCCTTGTACACTGTTGGTGGG - Intronic
1166407937 19:42535580-42535602 AACCCTTGTACACTGTTGGTGGG - Intronic
1166577930 19:43861834-43861856 AACTCTTATATACTGTTGATGGG + Intergenic
1168199096 19:54800981-54801003 AACATTTGTATGCAGTTGATGGG + Intronic
1168464687 19:56592645-56592667 AACCCTTGTTTACTGTTGGTGGG + Intergenic
925488377 2:4362939-4362961 AACACTTGAACACTGTTGGTAGG - Intergenic
926602290 2:14858191-14858213 AACCCTTGTACACTGTTGGTGGG + Intergenic
926867814 2:17378854-17378876 AACCCTTGTACACTGTTGGTGGG - Intergenic
927309338 2:21611580-21611602 AACCCTTGTACACTGTTGATAGG - Intergenic
927547092 2:23963675-23963697 AACCCTTGAACACTGTTGATGGG + Intronic
927609880 2:24527777-24527799 AACCTTTGTACATTGTTGGTAGG - Intronic
927610175 2:24531119-24531141 AACCTTTGTACACTGTTGGTAGG + Intronic
927803670 2:26125213-26125235 CACCTTTGTGTACTGTTGGTAGG - Intronic
927839017 2:26425533-26425555 AACCCTTGTGTACTGTTGGTGGG - Intronic
928598059 2:32875557-32875579 AACCCTTGTACACTGTTGGTGGG + Intergenic
928851524 2:35753285-35753307 AACCCTTGTATACTGTTGGTAGG - Intergenic
928934956 2:36666468-36666490 AGCCTTTGTACACTGTTGACGGG + Intergenic
929186430 2:39100197-39100219 AACCCTTGTAGACTGTGGATGGG + Intronic
929229933 2:39548999-39549021 AACCCTTGTGTACTATTGATGGG - Intergenic
929621150 2:43355344-43355366 AACCTTTGTACACTGTTGGTGGG - Intronic
930060025 2:47280590-47280612 AACCTTTGTGTACTGTTGGTGGG - Intergenic
930461610 2:51686008-51686030 AACATTTGTACACTGATGATGGG - Intergenic
930497192 2:52160687-52160709 AACCCTTGTATACTGTTGGTGGG - Intergenic
930528941 2:52567443-52567465 AACATTTATATACTGTTGTTGGG - Intergenic
930598441 2:53415765-53415787 ACCCTTTACACACTGTTGATGGG - Intergenic
930635973 2:53805758-53805780 AACCCTTGTATACTGTTGGTGGG - Intronic
930674882 2:54189818-54189840 AACCCTTGTACACTGTTGGTGGG - Intronic
930700396 2:54454831-54454853 AACCTATGTTTACTTTTGATAGG - Intergenic
930779009 2:55204496-55204518 AACCCTTGTACACTGTTGGTGGG + Intronic
931406091 2:61979667-61979689 AACCCTTGTACACTGTTGGTGGG - Intronic
931453910 2:62391920-62391942 AACCCTTGTATACTGTTGGTGGG - Intergenic
931457368 2:62422622-62422644 AACCCTTGTACACTGTTGGTGGG + Intergenic
931535190 2:63267856-63267878 AACCTGTGTATACTGCTGCTGGG + Intronic
931596183 2:63946783-63946805 AACATTTGTCTACTGCTGATGGG + Intronic
931927637 2:67091493-67091515 AACCCTTGTACACTGTTGGTGGG + Intergenic
932011803 2:67985656-67985678 AACCCTTGCACACTGTTGGTGGG + Intergenic
932064730 2:68542688-68542710 AACCTTTGTGCATTGTTGATGGG + Intronic
932179735 2:69635324-69635346 AACCTTTGTGCACTGTTGATGGG + Intronic
932645684 2:73499055-73499077 AACCCTTGTATACTATTGCTTGG - Intronic
932858508 2:75264299-75264321 AACCCTTGTATACTGTTGGTGGG - Intergenic
932882966 2:75521214-75521236 AACCCTTGTGCACTGTTGATGGG + Intronic
932992383 2:76803476-76803498 AACCCTTGTACGCTGTTGATGGG + Intronic
933029140 2:77304067-77304089 AACCCTTGCACACTGTTGGTGGG - Intronic
933144865 2:78839599-78839621 AACCGTTTAATATTGTCGATAGG + Intergenic
933146403 2:78859181-78859203 AACCATTGTATACTGCTGGTGGG + Intergenic
933254631 2:80066617-80066639 AACCCTTTAACACTGTTGGTGGG + Intronic
933447033 2:82393921-82393943 AACCTTTACATATTGTTCATGGG - Intergenic
933546931 2:83726204-83726226 AATCCTTGTACACTGTTGATGGG - Intergenic
933849425 2:86353613-86353635 AACTTTTGAACATTGTTGATGGG + Intergenic
934020275 2:87943212-87943234 AACCCTCGTATACTGTTGGTGGG - Intergenic
934180579 2:89615793-89615815 AACCTTTGTACATGGTTGATAGG + Intergenic
934290880 2:91690053-91690075 AACCTTTGTACATGGTTGATAGG + Intergenic
934311627 2:91871982-91872004 AGCCTTTGTATACTGTTGGCAGG + Intergenic
934612195 2:95748541-95748563 AAACTTTGTACACTGTTGGTGGG + Intergenic
934680762 2:96282360-96282382 TACGTTTTAATACTGTTTATTGG - Intronic
934841957 2:97630914-97630936 AAACTTTGTACACTGTTGGTGGG - Intergenic
935018122 2:99203552-99203574 AACCCTTGTACACTGTTGGTGGG - Intronic
936793650 2:116182248-116182270 AACCCTTGTAAACTGTTGGTGGG - Intergenic
937194469 2:120139709-120139731 AACCCTTGTACACTGTTGGTGGG + Intronic
937432168 2:121848216-121848238 AACCCTGGAACACTGTTGATGGG - Intergenic
937645151 2:124258256-124258278 AATCTTTGAAAACTGTTGGCTGG - Intronic
937699562 2:124848610-124848632 AACCCTTGTACACTGTTGGTGGG - Intronic
937760651 2:125598580-125598602 AATGTTTTTATACTGTTGATGGG - Intergenic
937793420 2:125987349-125987371 AACCCTTGTAAACTGTTGATGGG - Intergenic
937817350 2:126266291-126266313 AACCTTTGTGCACTGTTGGTTGG - Intergenic
938106249 2:128532136-128532158 AACCCTTGTTCACTGTTGATGGG + Intergenic
938410350 2:131058631-131058653 AACTTTTTAATACTGGTGCTTGG + Intronic
938619759 2:133037997-133038019 AACCCTTGTAAACTGTTGGTGGG + Intronic
939080035 2:137648878-137648900 AACCCTTGAACACTGTTGGTGGG - Intronic
939244343 2:139603949-139603971 AACCCTTGCACACTGTTGGTGGG - Intergenic
939256717 2:139753159-139753181 AACCCTTGTACACTGTTGGTGGG - Intergenic
939263661 2:139843246-139843268 AACCATGGTACACTGTTGATGGG + Intergenic
939418806 2:141938469-141938491 AACCTTTGTACACTGTTGGTGGG + Intronic
939746065 2:145969556-145969578 AACACTTAGATACTGTTGATGGG + Intergenic
939800896 2:146706603-146706625 AACCCTTGTACACTGTGGATGGG + Intergenic
939838672 2:147159934-147159956 AACTCTTGTACACTGTTGATGGG - Intergenic
940059135 2:149545697-149545719 AACATTTTTACACTGTTGATGGG - Intergenic
940394974 2:153178318-153178340 AACCATTGTACACTGTTGGTGGG - Intergenic
940409085 2:153339230-153339252 AACCCTTGTACACTGCTGATGGG - Intergenic
940630856 2:156236627-156236649 AACCTTTGTGTATTGCTGATGGG + Intergenic
940716609 2:157232563-157232585 AACACTTGCACACTGTTGATGGG - Intergenic
940750592 2:157623138-157623160 AACATTTGTACACTGTTGGTAGG + Intronic
940751773 2:157634010-157634032 AGCCTGTTAATACTATTGATAGG + Intergenic
940801049 2:158132903-158132925 AACCCTTGAATACTGTTGATGGG + Intronic
941228143 2:162874897-162874919 AACTGTTGTATACTGTTGGTGGG + Intergenic
941238185 2:163002075-163002097 AACCCTTGAACACTGTTGGTGGG + Intergenic
941271062 2:163429635-163429657 AGCCTTTGAAGGCTGTTGACTGG - Intergenic
941525432 2:166600920-166600942 AACCCTCAAACACTGTTGATGGG + Intergenic
941699534 2:168589153-168589175 AACCCTTGTTTACTGTTGCTGGG - Intronic
941739671 2:169020849-169020871 AACCATTGAATACTTTACATAGG + Intronic
941958110 2:171225500-171225522 AACCTTTGTACACTGCTGGTAGG + Intronic
942165910 2:173240712-173240734 AACCTTCGTACACTGTTGGTGGG + Intronic
942243110 2:173982322-173982344 AACCCTTGTATACTATTGGTGGG - Intergenic
942669523 2:178359429-178359451 AACCTTTGTACACTGTTGTTGGG + Intronic
942750534 2:179281892-179281914 AACCCTCGTATACTGTTGGTGGG + Intergenic
942762725 2:179418716-179418738 AACACTTGCATACTGTTGGTGGG + Intergenic
942929255 2:181470113-181470135 AACCCTTGCCCACTGTTGATGGG + Intronic
943076320 2:183199886-183199908 AACCTTTGTACACTGTTGGTGGG + Intergenic
943281294 2:185936854-185936876 AACCCTTGTACATTGTTGATGGG - Intergenic
943489009 2:188526290-188526312 TTCCTTTGAATACTTTTTATTGG + Intronic
943502592 2:188710730-188710752 AACCCTTGTACACTGTTGGTTGG + Intergenic
943881217 2:193146885-193146907 AACCCTTGCATACTGTTGGCAGG + Intergenic
943922852 2:193731695-193731717 AATCTTTGTACACTGTTGGTAGG + Intergenic
943962582 2:194285614-194285636 AACTCTTGTACACTGTTGATGGG - Intergenic
944004915 2:194892642-194892664 AACCCTTGTACACTGTTGGTGGG - Intergenic
944045329 2:195404412-195404434 AAACTTTGTACACTGTTGATGGG + Intergenic
944347124 2:198682816-198682838 AACCCTTGTAAACTGTTGGTAGG + Intergenic
944372784 2:199005708-199005730 ATCCTTTGAGTGCTGTTGGTAGG - Intergenic
944390520 2:199214045-199214067 AACCCTTGTAAACTGTTGGTAGG + Intergenic
944485281 2:200199164-200199186 AACCCTTATATACTGTTGGTGGG + Intergenic
944935915 2:204567822-204567844 AACCTTTGCTCACTGATGATGGG - Intronic
945112379 2:206372863-206372885 AACCCTTGTACACTGTTAATGGG - Intergenic
945149635 2:206775834-206775856 AACCCTTGCACAATGTTGATAGG - Intronic
945306356 2:208263116-208263138 AACCCTTGCACACTGTTGGTAGG + Intronic
945364420 2:208934002-208934024 AACACTTGTACACTGTTGATGGG - Intergenic
945372743 2:209040119-209040141 AACCTTTGAATACTACTCATGGG - Intergenic
945446788 2:209948285-209948307 AACATTTACATACTGTTGGTGGG - Intronic
945479389 2:210326653-210326675 AACTCTTAAACACTGTTGATGGG - Intergenic
945789326 2:214285085-214285107 AACCTTTGTACACAGTTGGTGGG - Intronic
945795316 2:214355554-214355576 AACACTTGTATACTGTTGGTGGG + Intronic
946623527 2:221585575-221585597 AACCTTTTTACACTGTTGGTGGG - Intergenic
946680279 2:222207121-222207143 AACATTTGAACATTTTTGATTGG - Intronic
947039682 2:225902798-225902820 AACCCTTGTACACTGTTGGTGGG + Intergenic
947061972 2:226177121-226177143 CACCTTTGTACACTGTTGGTGGG + Intergenic
947368463 2:229420799-229420821 AACCTTTGTGCACTGTTGGTAGG + Intronic
947476337 2:230451249-230451271 AACCTTTGTACACTGTTGGTGGG - Intronic
947510004 2:230743743-230743765 GACATTTGAAAACTGCTGATTGG + Intronic
947838493 2:233191828-233191850 AACCTTTGAATACTGCTCGGTGG + Intronic
948745608 2:240090930-240090952 AACATTTATATACTGTTGCTGGG + Intergenic
948929293 2:241120703-241120725 AACCCTTGTACACTGCTGATGGG + Intronic
1168740056 20:180251-180273 AACCCTTGCACACTGTTGGTGGG - Intergenic
1169513284 20:6289078-6289100 AACCCTTGTACACTGTTGATGGG + Intergenic
1169587509 20:7102543-7102565 AACTCTTGTACACTGTTGATGGG + Intergenic
1169629133 20:7606585-7606607 AACCCTTGCACACTGTTGGTGGG + Intergenic
1169904535 20:10588382-10588404 AACCCTTGCATGCTTTTGATGGG + Intronic
1169975257 20:11318458-11318480 AACTCTTGTATACTGTTGATAGG + Intergenic
1170001039 20:11614401-11614423 AACCTTTGTACATTGTTGGTGGG + Intergenic
1170236521 20:14111740-14111762 AACCTTTGTACACTGTTGATGGG + Intronic
1170263432 20:14438522-14438544 AACCTTTGTAAACTGTTGGTGGG - Intronic
1170490557 20:16869362-16869384 AACCCTTGTATACTGTTAGTGGG + Intergenic
1170501219 20:16976370-16976392 AACATTTATACACTGTTGATAGG - Intergenic
1170608512 20:17892748-17892770 AACCCTTGTACACTGTTGGTGGG + Intergenic
1170721511 20:18883983-18884005 AACCCTTGTACACTGTCGATGGG - Intergenic
1170818168 20:19732692-19732714 AACCTTCATACACTGTTGATGGG - Intergenic
1171024892 20:21621137-21621159 AACCCTTGTACACTGTTGTTGGG + Intergenic
1171402702 20:24888466-24888488 AACCCTTGTACACTGTTGATAGG + Intergenic
1171776943 20:29377643-29377665 AACCCTTGTACACTGTTGTTGGG - Intergenic
1171856762 20:30351913-30351935 AACCATTAAACACTATTGATGGG - Intergenic
1172419790 20:34806050-34806072 AACTATTATATACTGTTGATTGG - Intronic
1173065998 20:39712223-39712245 AACCTTTGTACACTGGTGGTGGG - Intergenic
1173326670 20:42040047-42040069 AACTTTTGCACACTGTTGGTGGG - Intergenic
1173913828 20:46691345-46691367 AACCGTTGCACCCTGTTGATAGG - Intergenic
1174974161 20:55311975-55311997 AACCCTTGTACACTATTGATGGG - Intergenic
1174989785 20:55497385-55497407 AACACTTTAATACTGTTGGTGGG - Intergenic
1174995742 20:55566504-55566526 GACCTTTGAACACTATTGTTAGG - Intergenic
1175173939 20:57098663-57098685 AACCCTCGGATACTGTTGGTGGG + Intergenic
1175554926 20:59844194-59844216 AACTTTTATATACTGTTGATGGG + Intronic
1176731905 21:10507355-10507377 AACCTTTGTACATGGTTGATAGG - Intergenic
1176890203 21:14307322-14307344 AACCCTTGTGTACTGTTGGTGGG + Intergenic
1177490745 21:21822908-21822930 AACACTTATATACTGTTGATGGG - Intergenic
1177577049 21:22971613-22971635 CACCTTTGAACACGGTTGATGGG - Intergenic
1177595683 21:23239362-23239384 ACCTTTTGGGTACTGTTGATTGG - Intergenic
1177628285 21:23693388-23693410 AATCCTTGTATACTGTTGGTGGG - Intergenic
1177876495 21:26638507-26638529 AACATTTTTACACTGTTGATAGG - Intergenic
1177980493 21:27908527-27908549 AACTTTTCTGTACTGTTGATGGG - Intergenic
1178098877 21:29244382-29244404 AACCCTTGCATGCTGTTGGTGGG - Intronic
1178162253 21:29932078-29932100 AAATTTTCAATACAGTTGATAGG + Intronic
1178230918 21:30783547-30783569 AACCCTTTTACACTGTTGATGGG - Intergenic
1178364594 21:31978938-31978960 AACCTTTGCACACTGTCGGTGGG - Intronic
1178388057 21:32172171-32172193 AACCCTTGTACTCTGTTGATAGG + Intergenic
1178825361 21:36011474-36011496 ACCCCTTGTACACTGTTGATGGG - Intergenic
1179158067 21:38868080-38868102 AACCCTTGTACACTGTTGGTGGG + Intergenic
1179158293 21:38870557-38870579 AACCCTTGTACACTGTTGATGGG - Intergenic
1179375050 21:40842538-40842560 GACCTGTGAACACTGTAGATTGG - Intronic
1180486936 22:15810116-15810138 AACCCTTGCATACTGTTGGTGGG + Intergenic
1180538376 22:16417794-16417816 AGCCTTTGTATACTGTTGGCAGG + Intergenic
1180685828 22:17665692-17665714 AACCTCTGTACACTGGTGATAGG - Intronic
1181445035 22:22963908-22963930 AACCCTTGTACACTGTTGGTGGG - Intergenic
1181970655 22:26687326-26687348 CACCTGTGGACACTGTTGATTGG + Intergenic
1182173456 22:28257131-28257153 AACCTTTGTACACTGTTGGTGGG + Intronic
1182755163 22:32673335-32673357 AACCCTTGACTCCTGTTGCTGGG - Intronic
1183878334 22:40803758-40803780 AACTCTTGCACACTGTTGATGGG - Intronic
1184926660 22:47646139-47646161 AACCCTTGCACACTGTTGGTAGG - Intergenic
949266790 3:2166178-2166200 AGCCCTTAAACACTGTTGATGGG - Intronic
949429138 3:3954067-3954089 AACCCTTGTATACTGTTGGTGGG - Intronic
949821239 3:8117661-8117683 AACGCTTGCATACTGTTGGTGGG - Intergenic
949907560 3:8871420-8871442 AACCCTTGTGCACTGTTGATGGG + Intronic
950061055 3:10071221-10071243 AACCTTTGTACACTGTTGGTGGG + Intronic
950302069 3:11889110-11889132 AACCTTTGTACACTGTTGGTGGG + Intergenic
950753217 3:15148082-15148104 AACCTTTGTCCACTGTTGGTGGG + Intergenic
950827624 3:15841807-15841829 AACCCTTGTACACTGTTGGTAGG + Intronic
951177377 3:19617780-19617802 AACCTTTGTACATTGTTGGTGGG - Intergenic
951184562 3:19697621-19697643 AACCCTTGTACACTGTTGGTAGG + Intergenic
951222983 3:20088368-20088390 AACCCTTGCACACTGTTGGTGGG - Intronic
951291158 3:20873615-20873637 AACCTTTGAATCCTGGCTATGGG + Intergenic
951417106 3:22438190-22438212 AACCCTTGCACACTGTTGGTGGG - Intergenic
951570099 3:24053403-24053425 AACATTTTTACACTGTTGATGGG - Intergenic
951691601 3:25402333-25402355 AACCCTTGTACACTGTTGATGGG + Intronic
951796424 3:26543778-26543800 AACCCTTGTACACTGTTGGTGGG - Intergenic
951854717 3:27182475-27182497 AACCCTTGCAGACTGTTGGTGGG + Intronic
952026151 3:29085179-29085201 AACATTTAAACACTGTTGGTAGG - Intergenic
952065970 3:29570934-29570956 AACCCTTGTATACTGTTGGAGGG - Intronic
952135932 3:30419616-30419638 AACCTTTGAATACTGTTGGTGGG + Intergenic
952492169 3:33883091-33883113 ATCCTTTGAATTCTGTTCCTGGG - Intergenic
952768951 3:36979749-36979771 AACCCTTGTACACTGTTGGTGGG - Intergenic
952906826 3:38144918-38144940 AACCTTTGATCACTTTTGATGGG + Intergenic
953156441 3:40379159-40379181 ACTCTTTATATACTGTTGATGGG + Intergenic
953166761 3:40472006-40472028 AACCCTTGTACACTGTTGATGGG - Intergenic
953202435 3:40789464-40789486 GACCTTTGAATATCGTTGATAGG + Intergenic
953231299 3:41067036-41067058 AACCCTGGTACACTGTTGATGGG + Intergenic
953712088 3:45282228-45282250 AACCCTTGTGTGCTGTTGATTGG + Intergenic
953817583 3:46172904-46172926 AACCTTTGTACACTGTTTGTGGG - Intronic
954049839 3:47965508-47965530 AACCCTTGTGTACTGCTGATAGG - Intronic
954487372 3:50865762-50865784 AACCCTTGCATGCTGTTGGTGGG - Intronic
954741695 3:52757131-52757153 AACCTTTGTGTACTGCTGATAGG + Intronic
954856094 3:53644934-53644956 AAGCTTTGTACACTGTTGATAGG - Intronic
954951279 3:54476517-54476539 GACCCTTGTATACTGTTGGTGGG - Intronic
955249438 3:57264000-57264022 AACCCTTGTACACTGTTGGTGGG - Intronic
955385752 3:58478417-58478439 AACAGTTGTATACTGTTGGTGGG - Intergenic
955441262 3:58957382-58957404 AACCCTTGTACACTGTTGGTGGG + Intronic
955658718 3:61273485-61273507 AACCTGTATATACTGTTGGTGGG - Intergenic
955873907 3:63470305-63470327 AACCCTTGCATAATATTGATTGG + Intronic
956237411 3:67089562-67089584 AACCCTTGTACACTGTTGGTGGG + Intergenic
957075292 3:75597809-75597831 AACATTTGTATGGTGTTGATGGG + Intergenic
957088140 3:75702014-75702036 AACCCTTGTACACTGTTGTTGGG + Intergenic
957429451 3:80083242-80083264 TACCTTTTAATACTGTTCACTGG + Intergenic
957574752 3:81992723-81992745 AACTTTTGTGTACTGTTGGTGGG + Intergenic
957678408 3:83400703-83400725 AACCCTTTAACACTGTTGGTGGG - Intergenic
957797830 3:85034704-85034726 AATCCTTGTATACTGTTGGTGGG - Intronic
957907311 3:86574267-86574289 AACCCTTGTACACAGTTGATGGG + Intergenic
958186331 3:90124868-90124890 AACACTTTTATACTGTTGATGGG - Intergenic
958210303 3:90466240-90466262 AACATTTTTACACTGTTGATGGG - Intergenic
958599130 3:96271481-96271503 AACTTTTATATACTGTTGATGGG - Intergenic
958602541 3:96315878-96315900 AACTCTTGTACACTGTTGATAGG - Intergenic
958745023 3:98123586-98123608 AAGCTTTGTATACTGTTGCTGGG + Intergenic
958910797 3:99992280-99992302 AACACTTATATACTGTTGATGGG - Intronic
959119392 3:102214643-102214665 AACCTTTGAGCATTCTTGATGGG - Intronic
959182318 3:102997263-102997285 AACCCTTGTACACTGTTGGTTGG + Intergenic
959414321 3:106065384-106065406 AACCCTTGTACACTGTTGGTGGG + Intergenic
959479891 3:106858593-106858615 AACGTTTTTACACTGTTGATGGG + Intergenic
959603516 3:108216505-108216527 AACCCTTGAACACTATTGGTAGG + Intronic
959625876 3:108450086-108450108 AACCCTTGTACACTGTTGATGGG + Intronic
959667016 3:108933711-108933733 AACATTTATATACTGTTGGTGGG + Intronic
959987249 3:112588126-112588148 AACCCTTGTATACTGTTGGTGGG + Intergenic
959987265 3:112588347-112588369 AACCCTTGTATACTGTTGGAGGG - Intergenic
960046308 3:113201708-113201730 AACCCTTGCACACTGTTGATGGG - Intergenic
960235554 3:115278047-115278069 AACCCTTGCATATTGTTGGTAGG - Intergenic
960242073 3:115356100-115356122 AACCTTTGTACACAGTTGGTGGG + Intergenic
960427662 3:117528785-117528807 AACCTTTGTACACTGTTGGTGGG - Intergenic
960468319 3:118026945-118026967 AACCCTTGTACACTGTTGATGGG - Intergenic
960469587 3:118046120-118046142 AACCCTTGTATACTGTTGGTGGG + Intergenic
960566294 3:119135594-119135616 AACGTTTTTATACTGTTGGTGGG + Intronic
960706450 3:120486732-120486754 AACCCTTGTATACTGTTGTTGGG - Intergenic
961070852 3:123924784-123924806 AACCCTTGTATACTGTTGGTAGG + Intronic
961331568 3:126145239-126145261 AACCTTTGTGCACTGTTGGTGGG + Intronic
961500944 3:127335327-127335349 AACCCTTGTACACTGTTGATGGG + Intergenic
961543153 3:127614039-127614061 CACCTTTTAATACTGTTAAATGG + Intronic
961587325 3:127943300-127943322 AACCCTTGTACACTGTTGATGGG - Intronic
962050610 3:131810565-131810587 AACCCTTGTACACTGTTGGTGGG + Intronic
962058515 3:131900372-131900394 AACCCTTGTACACTGTTGGTGGG + Intronic
962135746 3:132730300-132730322 AACCTTTGCACACTGTTTGTAGG - Intergenic
962182068 3:133217040-133217062 AACTCTTGCACACTGTTGATCGG - Intronic
962467241 3:135672238-135672260 AACCCTTGCACACTGTTGGTGGG - Intergenic
962565604 3:136655804-136655826 AACCCTTATATACTGTTGGTGGG + Intronic
962838548 3:139212623-139212645 AAGCTTTGCATGCTGTTGGTAGG + Intronic
962974677 3:140435679-140435701 AACCCTTGTACACTGTTGGTGGG - Intronic
963160254 3:142143782-142143804 AACCTTCTCAAACTGTTGATGGG + Intronic
963438036 3:145296990-145297012 AACCTTTGTACACTGTTTATAGG + Intergenic
963455497 3:145541596-145541618 AACCCTTGTATACTCTTGGTGGG - Intergenic
963858658 3:150283417-150283439 AACCCTTGTACACTGTTGGTAGG + Intergenic
963877223 3:150490137-150490159 AACCCTTGTACACTGTTGGTGGG + Intergenic
964150262 3:153516288-153516310 AACCTTTCTACACTGTTGGTGGG - Intergenic
964319276 3:155477777-155477799 AACCATTGTACACTGTTGGTGGG + Intronic
964759268 3:160118370-160118392 AACCCTTGTACACTGTTGGTGGG + Intergenic
964947324 3:162241945-162241967 AACCCTTGAACACTGATGATGGG + Intergenic
965014265 3:163136327-163136349 AACCCTTGCACACTGTTGTTTGG - Intergenic
965257415 3:166432112-166432134 AAACTTTGTACACTGTTGTTGGG + Intergenic
965289123 3:166854368-166854390 AACACTTAAACACTGTTGATGGG + Intergenic
965321479 3:167257083-167257105 AACCCTTGTACACTGTTGGTGGG - Intronic
965334261 3:167416724-167416746 AACACTTACATACTGTTGATAGG - Intergenic
965452135 3:168851205-168851227 AACCCTTGTACACTGTTGCTAGG - Intergenic
965833640 3:172827164-172827186 GACCCTTGTATATTGTTGATGGG + Intergenic
965861070 3:173151168-173151190 AACCCTTGTACACTGTTCATGGG + Intergenic
966049358 3:175594615-175594637 AACGCTTATATACTGTTGATGGG - Intronic
966075225 3:175927741-175927763 AACTCTTGTATACTGTTGATTGG + Intergenic
966148337 3:176837889-176837911 AATCTTTGCACACTGTTGATGGG + Intergenic
966517934 3:180839916-180839938 AACCGTTGTATACTGTTGGTGGG - Intronic
966566536 3:181388586-181388608 AACTTTTGCATACTACTGATAGG - Intergenic
966963737 3:184968490-184968512 AACCCTTGTGTACTGTTGGTGGG - Intronic
967076239 3:186005166-186005188 AACACTTATATACTGTTGATAGG - Intergenic
967626980 3:191698340-191698362 AACTCTTGTATATTGTTGATGGG - Intergenic
967630214 3:191736989-191737011 AACTCTTGTATACTGTTAATGGG - Intergenic
967750595 3:193110645-193110667 AACACTTGTACACTGTTGATGGG - Intergenic
968378495 4:66118-66140 AACCCTTGTACACTGTTGGTGGG - Intronic
968475736 4:806858-806880 AACACTTTTATACTGTTGATGGG + Intronic
969078537 4:4600079-4600101 AACCTTTGCACATTGTTGACAGG - Intergenic
969761285 4:9184750-9184772 AATCTTTGTATACTGGTGGTGGG + Intergenic
970062942 4:12055581-12055603 AACCCTTGTACACTGTTGGTGGG - Intergenic
970413146 4:15830202-15830224 AACCCTTGTACACTGTTGGTGGG - Intronic
970653754 4:18207440-18207462 AACCATTGTAGACTGTTGGTAGG + Intergenic
971628023 4:28949350-28949372 AATCGTTGAATACTGTTGGTGGG + Intergenic
971656425 4:29351981-29352003 AACACTTAAACACTGTTGATGGG - Intergenic
971690888 4:29834704-29834726 GACCATTACATACTGTTGATAGG - Intergenic
971936578 4:33157094-33157116 AACCCTTGTACACTGTTGGTGGG + Intergenic
972127481 4:35787849-35787871 AATTTTTGTATACTGTTGGTGGG + Intergenic
972180107 4:36454000-36454022 AACCTTTGTGCACTGTTGATAGG - Intergenic
972309953 4:37871402-37871424 AACCCTTGTACACTGTTGGTGGG + Intergenic
972668588 4:41192169-41192191 AACGTTTGTACACTGTTGGTGGG + Intronic
972857857 4:43129673-43129695 AACCTCTGTACACTGTTGGTGGG + Intergenic
972996681 4:44887877-44887899 AACCCTTGTACACTGTTGGTGGG - Intergenic
973159508 4:46998034-46998056 AACCCTTGTACACTGTTGGTGGG - Intronic
973224735 4:47770404-47770426 AGCATTTGCACACTGTTGATAGG + Intronic
973227661 4:47804236-47804258 AAGCATTGTACACTGTTGATGGG + Intronic
973307647 4:48671059-48671081 AACCCTTGTACACTATTGATGGG - Intronic
973535944 4:51882035-51882057 AGCATTTCAATAATGTTGATTGG + Intronic
973724483 4:53761439-53761461 AACCCTTGTACACTGTTGGTGGG + Intronic
973729256 4:53807704-53807726 AACCCTTGTACACTGTTGGTGGG - Intronic
973730673 4:53819414-53819436 AACCCTTGTACACTGTTGATGGG + Intronic
973881539 4:55277592-55277614 AACCCTTGTATACTCTTGGTGGG - Intergenic
974086963 4:57271904-57271926 AAACTTTGCACACTGTTGGTGGG - Intergenic
974292747 4:59954708-59954730 AACCCTTGTATGCTGTTGGTGGG + Intergenic
974337169 4:60564273-60564295 AACCATTTTATACTGTTGGTAGG - Intergenic
974470082 4:62308311-62308333 AACCCTTGTACACTGTTGGTGGG + Intergenic
974801109 4:66819243-66819265 AACCCTTGTACACTGTTGATGGG + Intergenic
974824996 4:67116977-67116999 AACCCTTTTATACTGTTGGTGGG + Intergenic
974881469 4:67763290-67763312 AACCCTTGTACACTGTTGGTAGG - Intergenic
974883834 4:67792062-67792084 AACTCTTGCACACTGTTGATGGG + Intergenic
974953751 4:68614237-68614259 AACATTTAAACACTGTTGGTGGG + Intronic
975069200 4:70112028-70112050 AACACTTTTATACTGTTGATGGG - Intergenic
975079986 4:70265575-70265597 AACCCTTGTACACTGTTCATGGG + Intergenic
975153253 4:71043967-71043989 AACCTTTGTAAACGGTTGATGGG + Intergenic
975288731 4:72651260-72651282 AACATTTGCACACTGTTGGTGGG + Intergenic
975599611 4:76085689-76085711 AACCCTGGAACACTGTTGGTAGG + Intronic
975707400 4:77124812-77124834 AACCCTTGAACACTGTTGGCAGG - Intergenic
975708004 4:77129795-77129817 AACCATTGTACACTGTTGGTGGG - Intergenic
975761726 4:77626804-77626826 AACCCTTGTATATTGTTGGTGGG - Intergenic
976056492 4:81074883-81074905 AACCTTTGTATACTGTTGTTGGG + Intergenic
976082393 4:81369988-81370010 AACCCTTGTACACTGTTGGTGGG - Intergenic
976138867 4:81968678-81968700 AACCTTTGTACACTGTTGGTGGG + Intronic
976428477 4:84934132-84934154 AACCCTCGTACACTGTTGATAGG - Intronic
976459694 4:85295389-85295411 AACCTTTGCGCACTGTTGGTGGG + Intergenic
976459768 4:85296399-85296421 AACCTTTGTATACTGTTGATGGG + Intergenic
976574086 4:86648840-86648862 AACCCTTGTATACTGTTGGTGGG - Intronic
977089789 4:92656149-92656171 AACCCTTGTATACTCTTGCTAGG - Intronic
977192380 4:94017075-94017097 AACCCTGGAACACTGTTGATGGG - Intergenic
977236403 4:94512386-94512408 AACCCTTGTACACTGTTGGTGGG - Intronic
977496984 4:97788685-97788707 AACCCTTGTACACTGTTGGTGGG - Intronic
977650592 4:99464298-99464320 AACCCTTGTACACTGTTGATGGG - Intergenic
977773211 4:100883969-100883991 AATCCTTGTACACTGTTGATGGG - Intergenic
978019734 4:103792783-103792805 AACGTTTTTATACTGTTGGTGGG + Intergenic
978032920 4:103957984-103958006 AACCCTTGTACACTGTTGGTGGG + Intergenic
978064172 4:104375868-104375890 AACCTTTGTATACTGTTGGTAGG + Intergenic
978111347 4:104967436-104967458 AAACTTTGTACACTGTTGGTGGG + Intergenic
978267223 4:106840752-106840774 AACCCTAGTACACTGTTGATGGG - Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978587119 4:110285245-110285267 AACCTTTGTCCACTGTTGATAGG + Intergenic
978661469 4:111132000-111132022 ACCCCTTGTATACTGTTGGTGGG - Intergenic
978677388 4:111335722-111335744 AACTCTTGTATAATGTTGATGGG + Intergenic
979007920 4:115326445-115326467 AATACTTGAATACTGTTGGTTGG - Intergenic
979041959 4:115809650-115809672 AATCTTTGTATACTGTTGGTGGG + Intergenic
979117741 4:116849012-116849034 AACATTTTAACACTGTTGGTGGG - Intergenic
979490230 4:121318196-121318218 AACCCTTGTACACTGTTGGTGGG + Intergenic
979638228 4:122980607-122980629 AACCCTTGTACACTGTTGGTGGG - Intronic
979722826 4:123922146-123922168 AACATTTTCACACTGTTGATAGG - Intergenic
979726683 4:123970856-123970878 AACCTTTTTACACTGTTGGTGGG - Intergenic
979774820 4:124577030-124577052 AACCCTTATACACTGTTGATGGG - Intergenic
979838487 4:125405344-125405366 AACCCTTGTACACTGTTGGTGGG - Intronic
979879425 4:125936458-125936480 AACCCTTGTACACTGTTGGTGGG + Intergenic
979916202 4:126437195-126437217 AACCTTTGCACACTATTGGTGGG - Intergenic
979946344 4:126836709-126836731 AACCCTGGTACACTGTTGATGGG + Intergenic
980040045 4:127928622-127928644 AACCCTTGTATACTGTTGGTGGG + Intronic
980159868 4:129147803-129147825 AACCCTTGTATACTGTTTGTGGG + Intergenic
980323642 4:131311235-131311257 ATCCTTTGAACACTTTTGGTGGG + Intergenic
980328913 4:131385904-131385926 AACCCTTACATACTGTTGGTGGG - Intergenic
980443630 4:132879964-132879986 AATCTTTGCACACTGTTGGTTGG + Intergenic
980477714 4:133340070-133340092 AACTTTTGTACACTGTTGATGGG - Intergenic
980514535 4:133837789-133837811 TACCCTTGCACACTGTTGATAGG - Intergenic
980558072 4:134435020-134435042 AACACTTACATACTGTTGATTGG + Intergenic
980683226 4:136191006-136191028 AACCCTTGTACACTGTTGATGGG + Intergenic
980741932 4:136962500-136962522 AACCCTTGTACACTGTTGGTAGG - Intergenic
980829880 4:138117712-138117734 AACCCTTGTACACTGTTGTTGGG - Intergenic
980850709 4:138378001-138378023 AACCCTTGTACACTGTTGATGGG + Intergenic
980912392 4:139005582-139005604 AACCCTCCTATACTGTTGATAGG + Intergenic
981083933 4:140663424-140663446 AACCCTTGTACACTGTTGGTGGG + Intronic
981169064 4:141599950-141599972 AACATTCGTATACTGCTGATGGG - Intergenic
981234083 4:142394096-142394118 AACTTTTGAACACTGTTGGTGGG - Intronic
981448052 4:144863665-144863687 AACCCTTAAACACTGCTGATGGG + Intergenic
981453326 4:144924698-144924720 AACCCTTAAACACTGTTGGTGGG - Intergenic
981683984 4:147432420-147432442 AACCCTTGTACACTGTTGGTGGG - Intergenic
981837401 4:149070853-149070875 AACTCTTGTACACTGTTGATGGG + Intergenic
981983263 4:150823034-150823056 AACCTTCATATACTGTTGGTGGG - Intronic
982315944 4:154032017-154032039 AACCTTTGTACACTGTTGGTGGG - Intergenic
982339576 4:154282554-154282576 AACCTTTGTGCACTGTTGCTGGG + Intronic
982342699 4:154319716-154319738 AACCCTTGTATACTGTTGGTGGG + Intronic
982361749 4:154525865-154525887 AACCCTTGTGCACTGTTGATGGG + Intergenic
982583848 4:157212384-157212406 AACTTTTGTATACTGTTGGTGGG - Intronic
982817969 4:159909488-159909510 AACCCTTGTATACTGTGGGTGGG + Intergenic
982834222 4:160103357-160103379 AACCCTTCAACACTGTTGGTGGG + Intergenic
982910982 4:161143000-161143022 AACCCTTGTAAACTGTTGGTAGG + Intergenic
982952696 4:161720393-161720415 AACATTTGTACACTATTGATGGG + Intronic
982989005 4:162246685-162246707 ATCCTTTGCCTACTTTTGATGGG + Intergenic
983006552 4:162491551-162491573 AACCTTTTCATTTTGTTGATTGG - Intergenic
983072313 4:163283161-163283183 AACAATTTAACACTGTTGATGGG - Intergenic
983138947 4:164124308-164124330 AACCTTGGCACACTGTTGGTGGG + Intronic
983256582 4:165407200-165407222 AACCTTTGTACACTGCCGATGGG - Intronic
983312620 4:166083997-166084019 AATCCTTGCATACTGTTGTTGGG - Intronic
983508449 4:168581362-168581384 AACCCTTGTACACTGTTGGTGGG - Intronic
983703352 4:170626014-170626036 AACCCTTGTATACTGTTGCTGGG - Intergenic
983725075 4:170911263-170911285 AATGTTTACATACTGTTGATGGG - Intergenic
983736244 4:171065471-171065493 AAACTTTGTACACTGTTGATGGG + Intergenic
983831431 4:172332913-172332935 AACTTTTGTACACTGTTGGTGGG - Intronic
983855776 4:172642106-172642128 GACCCTTGAATACTGTTTGTGGG + Intronic
983948610 4:173613864-173613886 AACATTTTTACACTGTTGATAGG - Intergenic
983970925 4:173873167-173873189 AACCCTTGTACACTGTTGGTGGG + Intergenic
984018795 4:174459271-174459293 AACCCTTGTATACTGTTAATGGG - Intergenic
984073199 4:175142707-175142729 AACCTTAGCACACTGTTGGTGGG - Intergenic
984078980 4:175219032-175219054 AACCTTAGCACACTGTTGGTGGG - Intergenic
984239288 4:177198380-177198402 AACCTTTGTACACTGTTGGTGGG - Intergenic
984306127 4:177994168-177994190 AATCCTTGAACACTGTTGGTGGG + Intergenic
984338956 4:178429218-178429240 AACACTTGTACACTGTTGATGGG + Intergenic
984354916 4:178645574-178645596 AACCCTTGTACACTGTTGATGGG - Intergenic
984627654 4:182025633-182025655 AACCCTTGTAAACTGTTGGTGGG - Intergenic
984823141 4:183901524-183901546 AACCTTTGTGCACTGTTGGTAGG - Intronic
984987910 4:185349523-185349545 AACCCTTGTACACTGTTGGTGGG - Intronic
985032294 4:185801428-185801450 AACCCTTGTAAGCTGTTGATGGG - Intronic
985098961 4:186438724-186438746 AACCCTTGTACACTGTTGGTGGG + Intronic
985232149 4:187830774-187830796 AACCTTTCTATACTGTTGGTGGG - Intergenic
985287117 4:188347355-188347377 AACCATTGTACACTGTTGGTGGG + Intergenic
985374948 4:189325197-189325219 AACCCTTGTACACTGTTGATAGG - Intergenic
985442788 4:189996514-189996536 AACCCTTGTACACTGTTGTTGGG - Intergenic
985690003 5:1302707-1302729 AACCCTTGGACACTGTTGGTGGG - Intergenic
985774897 5:1836373-1836395 TACCTTTGATGACTGTTGAATGG + Intergenic
986288699 5:6380296-6380318 AACCCTTGTACACTGTTGATGGG + Intergenic
986312374 5:6561866-6561888 AACCTTTTTGTACTGTTGATGGG + Intergenic
986880827 5:12168907-12168929 AACGTTTTAAAACTGTTGTTGGG + Intergenic
986891950 5:12320222-12320244 AACATTTATATACTGTTGGTGGG - Intergenic
986947583 5:13043435-13043457 AACCATTGTACACTGTTGGTCGG + Intergenic
987182249 5:15380072-15380094 AACCCTAGTATACTGTTGGTAGG + Intergenic
987239174 5:15976377-15976399 AACCTTTGTACGCTGTGGATGGG + Intergenic
987241263 5:16002484-16002506 AGCCCTTGAACACTGTTGGTGGG - Intergenic
987267369 5:16270815-16270837 AACCCTTGTACACTGTTGGTGGG + Intergenic
987400589 5:17472003-17472025 AACCCTTGTACACTGTTGGTGGG + Intergenic
987631908 5:20484308-20484330 AATCTTTGTACACTGTTGGTGGG + Intronic
987773771 5:22337950-22337972 AACCTTTGTACACTGTTGGTGGG + Intronic
987784453 5:22481229-22481251 AACTCTTGTACACTGTTGATGGG + Intronic
987808801 5:22806268-22806290 AACCCTTTTACACTGTTGATGGG - Intronic
987870269 5:23608452-23608474 AACACTTGCACACTGTTGATGGG - Intergenic
988091811 5:26552157-26552179 AACCCTTGCACACTGTTGGTAGG + Intergenic
988213927 5:28247006-28247028 AACTTTTGCATGCTGTTGACAGG + Intergenic
988315057 5:29614860-29614882 AACTTTTGCACACTGTTGGTTGG - Intergenic
988664773 5:33313722-33313744 AACTTTCATATACTGTTGATGGG - Intergenic
988780795 5:34519964-34519986 AACCTTTGTACACTGTTGGTGGG + Intergenic
988862027 5:35291664-35291686 GACCTTTGTACACTGTTGATGGG - Intergenic
989403024 5:41029084-41029106 AACCCTTGTACACTGTTGGTGGG - Intronic
989428324 5:41322438-41322460 AACCCTTGTATACTGTTGGTGGG + Intronic
989491725 5:42063272-42063294 AACCCTTGCACACTGTTCATGGG + Intergenic
989553710 5:42766295-42766317 AACCCTCGTACACTGTTGATGGG + Intronic
989658911 5:43777169-43777191 AAACTTTGTACACTGTTGGTGGG - Intergenic
989786144 5:45333099-45333121 AACCCTTGTACACTGTTGGTGGG - Intronic
990121496 5:52459566-52459588 AAACCTTGTATACTGTTGATGGG - Intergenic
990215145 5:53522355-53522377 AACCCTTGTGTACTGTTGTTAGG - Intergenic
990801035 5:59603526-59603548 AACCCTTGTACACTGTTGATGGG + Intronic
990854222 5:60245313-60245335 AACCCTTGTATGCTGTTGGTGGG + Intronic
990923251 5:60991907-60991929 AACCCTTGTATACTGTTGGTGGG - Intronic
990932343 5:61107195-61107217 AACCCTTGTACACTGTTGGTGGG - Intronic
991042532 5:62190775-62190797 AATCTTTGCACACTGTTGGTCGG - Intergenic
991205792 5:64048992-64049014 AACCCTTGTACACTGTTGGTGGG + Intergenic
991276301 5:64850932-64850954 AACCCTTGTACACTGTTGGTGGG + Intronic
991281522 5:64920020-64920042 ATGCATAGAATACTGTTGATGGG - Intronic
991380441 5:66017305-66017327 AATCTCTGAACACTGTTGGTGGG - Intronic
991518178 5:67463484-67463506 AACTTTTGAATGGTGTTGATGGG - Intergenic
991545474 5:67777390-67777412 AACCCTTGCACACTGTTGGTGGG - Intergenic
991567263 5:68018280-68018302 AACCCTTGTACACTGTTGGTGGG + Intergenic
991985114 5:72277244-72277266 AACGTTTTTACACTGTTGATGGG + Intronic
992681771 5:79160651-79160673 AACCCTTGTATGCTGTTGGTGGG + Intronic
992750522 5:79856861-79856883 AAGCTTTGAAGACAGGTGATGGG + Intergenic
992800062 5:80287981-80288003 AACTTTTGTATATTGTTGGTGGG + Intergenic
992932319 5:81661460-81661482 AACCATTGTACACTGTTGGTGGG - Intronic
992948021 5:81828701-81828723 AACCCTTGCACACTGTTGGTGGG + Intergenic
992980872 5:82170624-82170646 AACCTCAGAATACTTTGGATAGG + Intronic
993026453 5:82652676-82652698 AACCCTTGGACACTGTTGGTGGG - Intergenic
993065431 5:83091972-83091994 AACCTTTGTATCCTGTTGGTAGG - Intronic
993163837 5:84325517-84325539 AACCCTTGTGTACTGTTGGTGGG + Intronic
993537805 5:89108316-89108338 AACCCTTGTACACTGTTGATGGG + Intergenic
993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG + Intergenic
993757828 5:91752886-91752908 AACCCTTGTATACTATTGGTGGG - Intergenic
994016957 5:94978231-94978253 AACCCTTGTACACTGTTGGTGGG + Intronic
994293581 5:98061557-98061579 AACACTTGCACACTGTTGATGGG + Intergenic
994319183 5:98370616-98370638 AACCATTGTATCCTGTTGGTGGG - Intergenic
994326490 5:98452710-98452732 AACCCTTGTATACGGTTGTTGGG + Intergenic
994404267 5:99324251-99324273 AACGTTTTTACACTGTTGATGGG + Intergenic
994671657 5:102768959-102768981 AACCTTTGAACACTGTTGGTGGG - Intronic
994690388 5:103011871-103011893 AACCCTTGTATACTGTTGGTGGG - Intronic
994924084 5:106091165-106091187 AACCTTTGTACACTGTTGGTGGG - Intergenic
995515090 5:112946584-112946606 AACCTTTGTACACTGTTAGTGGG + Intergenic
995665883 5:114541612-114541634 AACTCTTATATACTGTTGATGGG - Intergenic
995771016 5:115670196-115670218 AACCCTTGTACACTGTTGATGGG + Intergenic
995932550 5:117465493-117465515 AACATTTGGACACTGTTGGTGGG - Intergenic
995935738 5:117510942-117510964 AACCCTTGCATACTGTTGAGGGG + Intergenic
996027916 5:118670024-118670046 AACCGTTTTACACTGTTGATGGG - Intergenic
996115969 5:119618892-119618914 GACCTTTGTACACTGTTGGTAGG - Intronic
996136874 5:119853814-119853836 AACCTTTGCACACTATTGGTGGG - Intergenic
996174882 5:120344202-120344224 AACCCTTATACACTGTTGATGGG + Intergenic
996204330 5:120712853-120712875 AACCTTTGCACACTGTTGATAGG + Intergenic
996208202 5:120769819-120769841 AACCTTTGTACACTGTTGGCAGG - Intergenic
996292524 5:121868956-121868978 AACCTTTGTCCACTGTTGGTGGG + Intergenic
996313564 5:122135523-122135545 AACCCTTGTACACTGTTGGTAGG + Intronic
996475822 5:123919418-123919440 AACCTTTGTACACTGTTGGTGGG - Intergenic
996598336 5:125230957-125230979 AACATTTATACACTGTTGATGGG - Intergenic
996737114 5:126768140-126768162 AACTTTTATATACTATTGATGGG - Intergenic
996957897 5:129207314-129207336 AACCTTTGTACACTGTTGGTGGG - Intergenic
996991253 5:129635287-129635309 AACACTTATATACTGTTGATGGG + Intronic
997026801 5:130073576-130073598 AACCATTGTATACTGCTGGTGGG + Intronic
997188798 5:131909949-131909971 AACCCTCGTATACTGTTGGTGGG + Intronic
997190101 5:131924431-131924453 AACCCTTGTACACTGTTGGTGGG - Intronic
997833028 5:137168733-137168755 AACCCTAGTATACTGTTGGTAGG + Intronic
997871369 5:137508097-137508119 AACCCTTGTACACTGTTGGTGGG - Intronic
998055483 5:139073084-139073106 AAGCTTTGTACACTGCTGATGGG + Intronic
998656355 5:144184621-144184643 AACCTTTGTGCACTGTTGGTGGG - Intronic
998746663 5:145267767-145267789 AACCTTTGTACACTGTTAGTAGG - Intergenic
999036330 5:148355040-148355062 AACCTTTGTATATTGTTAGTGGG - Intergenic
999181506 5:149673017-149673039 ACCCCTTGTACACTGTTGATAGG + Intergenic
999587400 5:153105904-153105926 AACCCTTGTACCCTGTTGATGGG + Intergenic
999820835 5:155226663-155226685 AACACTTTTATACTGTTGATGGG + Intergenic
999918118 5:156286205-156286227 AACACTTTTATACTGTTGATGGG + Intronic
999919097 5:156298374-156298396 AACCCTTGTACACTGTTGGTGGG - Intronic
999920610 5:156315668-156315690 AACCCTTGCATATTGCTGATGGG - Intronic
1000275413 5:159730321-159730343 AACACTTATATACTGTTGATGGG + Intergenic
1000695676 5:164378780-164378802 AACCTTTATACACTGTTGGTGGG - Intergenic
1000737861 5:164927998-164928020 AACACTTTAATACTGTTGGTGGG - Intergenic
1000970260 5:167706706-167706728 AACCCTTTAACACTATTGATGGG - Intronic
1001258985 5:170209966-170209988 AATCTTTGTACACTGCTGATGGG - Intergenic
1001359495 5:171066780-171066802 AACGTTTGCACACTGTTGGTGGG - Intronic
1001760301 5:174202668-174202690 AACCCTTGTTCACTGTTGATGGG - Intronic
1001814062 5:174652910-174652932 AACCCTTGTACACTGTTGGTGGG + Intergenic
1002120508 5:177000316-177000338 AACCCTTGTACACTGTTGGTGGG - Intronic
1002326393 5:178411180-178411202 AACCTTTGTACACTGCTGGTAGG + Intronic
1002626937 5:180535765-180535787 AACGCTTGAACACTGTTGGTGGG - Intronic
1002890756 6:1329724-1329746 AACCCTTGTACACTGTTGATGGG - Intergenic
1003013327 6:2447173-2447195 AACCTTTGCATACCGTTGGTGGG - Intergenic
1003126237 6:3358100-3358122 AACCTTTAAACACTGTTGGTAGG + Intronic
1003549378 6:7088685-7088707 AACCTTTAAACACTGCTGGTGGG - Intergenic
1003720697 6:8698658-8698680 AACACTTGCACACTGTTGATAGG + Intergenic
1003738926 6:8912252-8912274 AACCCTTGTACACTGTTGGTGGG + Intergenic
1003772018 6:9316217-9316239 ATCCTTTGAAAACTGTGGGTGGG + Intergenic
1003903311 6:10675636-10675658 AGCCCTTGCATACTGTTGGTGGG - Intronic
1004091858 6:12511564-12511586 AACTTTTGGACACTGTTGATGGG + Intergenic
1004154269 6:13153328-13153350 AACCTTTAAATACAGTTTCTTGG + Intronic
1004692036 6:18000648-18000670 AACCCTTGTATACTGTTGGTGGG + Intergenic
1005235033 6:23750379-23750401 AACCCTTACATACTGTTGGTAGG - Intergenic
1005280295 6:24266694-24266716 AATACTTGTATACTGTTGATGGG + Intronic
1005729145 6:28679323-28679345 AATCCTTGTACACTGTTGATGGG - Intergenic
1005907648 6:30278527-30278549 AACCCTCGTACACTGTTGATGGG - Intergenic
1005938053 6:30539272-30539294 AACACTTGTATACTGTTGGTAGG + Intergenic
1006071603 6:31501043-31501065 AACCCTTGTACACTGTTGGTGGG - Intronic
1006207460 6:32360659-32360681 AACCCTTGTACACTGTTGTTAGG - Intronic
1006240096 6:32670254-32670276 AACATTTGTACACTGTTGGTGGG + Intergenic
1006249351 6:32767673-32767695 AACATTTGCACACTGTTGGTGGG + Intergenic
1006278363 6:33024793-33024815 AACCCTTGTACACTGTTGGTGGG - Intergenic
1007136645 6:39528583-39528605 AACCCTTGTACACTGTTGGTGGG - Intronic
1007158281 6:39767680-39767702 AACATTTTTACACTGTTGATGGG + Intergenic
1007847708 6:44774079-44774101 AACCTTTGTACACTTTTGGTGGG - Intergenic
1008108963 6:47471879-47471901 AACCTTTGTACACTGTTGGTGGG + Intergenic
1008222434 6:48872264-48872286 AACTCTTGCATACTGTTGGTGGG + Intergenic
1008237489 6:49067844-49067866 AACCTTTGTACAATGTTGTTGGG + Intergenic
1008333156 6:50266819-50266841 AACCCTTGTACACTGTTGCTGGG - Intergenic
1008445816 6:51589144-51589166 AACCTTTGTACACTGTTCTTGGG - Intergenic
1008457852 6:51732666-51732688 AACCATTGTGTACTGTTGGTGGG + Intronic
1008614398 6:53212175-53212197 AACCCTTGTACACTGTTGGTGGG - Intergenic
1008733223 6:54508706-54508728 AACTTTTGTAGACTCTTGATGGG + Intergenic
1008778269 6:55067889-55067911 AACCCTTGTACACTGTTGGTGGG - Intergenic
1008840052 6:55891995-55892017 AACCCTTGTACACTGTTGGTGGG + Intergenic
1009002940 6:57742784-57742806 AAACCTTGTATACTGTTGGTGGG - Intergenic
1009387601 6:63104781-63104803 AACCCTTGTACACTGTTGGTGGG - Intergenic
1009409928 6:63354523-63354545 AACTCTTGTACACTGTTGATGGG + Intergenic
1009539972 6:64942068-64942090 AACGTTTAAACACTGTTGTTGGG - Intronic
1009568565 6:65348344-65348366 AACCCTTGTACACTGTTGGTGGG - Intronic
1009595877 6:65735701-65735723 AACACTTAAACACTGTTGATGGG + Intergenic
1009894142 6:69726257-69726279 AACCCTTGTACACTGTTGGTGGG + Intronic
1009950003 6:70384459-70384481 AACTTTTGCACACTGTTGGTTGG - Intergenic
1010074222 6:71782356-71782378 AACCCTAGTATACTGTTGGTGGG - Intergenic
1010156871 6:72804772-72804794 AACCCTTGTATACTGTTAGTGGG - Intronic
1010182408 6:73102828-73102850 AACCATTGTACACTGTTGGTGGG + Intronic
1010480099 6:76340868-76340890 AACCTTTGTATGCTGTTGGTGGG + Intergenic
1010506856 6:76671308-76671330 AGCCTCTGAATATTATTGATTGG - Intergenic
1010535381 6:77022180-77022202 AACCCTTGTACACTGTTGGTGGG + Intergenic
1010588531 6:77684961-77684983 AACCTTTGTACACTGTTGGTGGG - Intergenic
1010629714 6:78183950-78183972 AACACTTGTATACTATTGATGGG - Intergenic
1010708468 6:79142655-79142677 AACATTTTTACACTGTTGATGGG - Intergenic
1010944028 6:81953646-81953668 AACACTTTTATACTGTTGATGGG - Intergenic
1011013961 6:82734587-82734609 AACCCTTGTATACTGTTGGTGGG - Intergenic
1011123431 6:83980272-83980294 AACCCTTGTACACTGTTGGTGGG - Intergenic
1011344005 6:86348880-86348902 AACCCTTGTACACTGTTGGTGGG + Intergenic
1011454116 6:87528293-87528315 AACCCTTGTACACTGTTGGTGGG + Intronic
1011628786 6:89304820-89304842 AACGTTTATACACTGTTGATGGG + Intronic
1011946823 6:92915091-92915113 AACCGTTGCACACTGTTGGTAGG + Intergenic
1011998135 6:93619305-93619327 AACAGTTTTATACTGTTGATGGG + Intergenic
1012060621 6:94474925-94474947 AACACTTACATACTGTTGATGGG - Intergenic
1012293960 6:97496075-97496097 AACTCTTGTACACTGTTGATGGG + Intergenic
1012300605 6:97582847-97582869 AACCTTTATATACTGTTGGTGGG - Intergenic
1012343014 6:98152063-98152085 AACACTTGTATACTGTTGCTGGG - Intergenic
1012351273 6:98253867-98253889 AACCTTTACACACTGTTGGTGGG - Intergenic
1012576339 6:100804782-100804804 AACATTTATATACTGTTGGTGGG + Intronic
1012670719 6:102043824-102043846 AACCCTTGCATACTGTTGGTGGG - Intronic
1012832193 6:104218224-104218246 AACATTTATATACTGTTGGTGGG - Intergenic
1012892794 6:104916007-104916029 AACCCTTGCACACTGTTGGTGGG + Intergenic
1012990867 6:105924551-105924573 AACATTTGCACACTGTTGGTGGG - Intergenic
1013023224 6:106241374-106241396 AACCTTTGTGCACTGTTGGTGGG + Intronic
1013340963 6:109215289-109215311 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1013379230 6:109550302-109550324 AAACTTTGAATACCGTTTCTAGG - Exonic
1013808759 6:114020863-114020885 AACCCTTGCACACTGTTGGTAGG + Intergenic
1013903964 6:115192343-115192365 AAGCTTTTAATACTGTTGCATGG - Intergenic
1013956361 6:115845724-115845746 AACCCTTGTAAACTGTTGGTGGG - Intergenic
1014347500 6:120292683-120292705 AACCCTAGCATACTGTTGGTGGG - Intergenic
1014364116 6:120519202-120519224 AACACTTAAAAACTGTTGATAGG - Intergenic
1014375568 6:120668160-120668182 AAACTTTGTACACTGTTGGTGGG - Intergenic
1014385461 6:120795749-120795771 AATCTTTGTGTACTGTTGGTGGG - Intergenic
1014391411 6:120870894-120870916 AACCCTTAAACACTGTTGATGGG + Intergenic
1014553403 6:122815196-122815218 AACGCTTGTACACTGTTGATGGG - Intergenic
1014583492 6:123167692-123167714 AACCCTTGTATACTGTTGGTGGG + Intergenic
1014708652 6:124780121-124780143 AACCATAGAATACTTTTGCTGGG - Intronic
1014730203 6:125023455-125023477 CACCCTTGTATACTGTTGGTGGG + Intronic
1014730650 6:125027764-125027786 AACCTTTGTACACTTTTGGTGGG - Intronic
1014782700 6:125583089-125583111 AACCCTTGTACACTGTTGATGGG - Intergenic
1014855131 6:126391082-126391104 AACCCTTGTACACTGTTGGTGGG - Intergenic
1014862705 6:126488975-126488997 AACCTTTGTACACTGTTTGTAGG - Intergenic
1014864778 6:126515362-126515384 AACATTCGTATACTGTTGGTGGG - Intergenic
1014926626 6:127278760-127278782 GACCTTTGAAAACTGCTGGTAGG - Intronic
1015030770 6:128592571-128592593 AACCCTTGTACACTGTTGGTGGG + Intergenic
1015103526 6:129508962-129508984 AACCCTTGTACACTGTTGGTGGG - Intronic
1015208490 6:130669170-130669192 AACCTTCGTAGACTGTTGGTAGG + Intergenic
1015232741 6:130935035-130935057 ATCCTTTGAATCCTGTGGAATGG - Intronic
1015325726 6:131921211-131921233 AACCCTTGTATACTGTTGATGGG + Intergenic
1015345958 6:132159832-132159854 AACCCTTGAACACTGATGGTGGG + Intergenic
1015695324 6:135973583-135973605 AACCCTTGTGTACTATTGATGGG - Intronic
1016075775 6:139794274-139794296 AACCCTTATACACTGTTGATGGG - Intergenic
1016135477 6:140536122-140536144 AACCCTTGTATACTCTTGGTGGG + Intergenic
1016152305 6:140756934-140756956 AACTTTTGAATAGTGATTATGGG - Intergenic
1016285703 6:142470158-142470180 AACCCTTGCACACTGTTGGTGGG - Intergenic
1016289122 6:142508098-142508120 AACTCTTGTACACTGTTGATGGG - Intergenic
1016366073 6:143320246-143320268 AACCCTTGTACACTGTTGATGGG + Intronic
1016574872 6:145558539-145558561 AACCCTTGTACACTGTTGGTTGG - Intronic
1016601965 6:145872569-145872591 AACACTTTAATACTGTTGGTGGG + Intronic
1017318960 6:153066269-153066291 AACCATTGTACACTGTTGGTGGG + Intronic
1017432914 6:154388623-154388645 AACCCTTGCATACTGTTGATGGG - Exonic
1017461144 6:154651740-154651762 AACCCTTGTACACTGTTAATGGG - Intergenic
1018069019 6:160144906-160144928 AACCTTTGTGAACTGTTGGTGGG - Intronic
1018407478 6:163502958-163502980 AACATTTATATACTGTTGGTGGG - Intronic
1018448679 6:163884062-163884084 AACTCTTGTATACTGTTGGTGGG + Intergenic
1019208172 6:170380462-170380484 AACCCTTGTACACTGTTGGTGGG - Intronic
1019346652 7:534182-534204 AAACTTAAAATACTGTTGAATGG - Intergenic
1020331798 7:7025813-7025835 AACCCTTGCACACTGTTGGTGGG - Intergenic
1020423001 7:8030917-8030939 ACCCTCTGTACACTGTTGATGGG + Intronic
1020458738 7:8404074-8404096 AACCCTTGTGTACTGTTGATGGG + Intergenic
1020576950 7:9945581-9945603 TGCCTTTGAATGCTGTTGATGGG + Intergenic
1020609921 7:10382774-10382796 AATCTTTATAAACTGTTGATGGG + Intergenic
1020634522 7:10680336-10680358 AGCATTGGAATACTGATGATAGG - Intergenic
1020765596 7:12316184-12316206 AACCTTTGTATACTGTTGGTAGG + Intergenic
1020873269 7:13661488-13661510 AACCCTTGAGAACTGTTGGTGGG + Intergenic
1020922003 7:14277881-14277903 AACCCATGTATACTGTTGGTGGG - Intronic
1020970276 7:14929342-14929364 AACATTTATACACTGTTGATGGG - Intronic
1021160368 7:17265034-17265056 AACCCTGGTATACTGTTAATAGG - Intergenic
1021187978 7:17587639-17587661 AACCCTTATACACTGTTGATAGG + Intergenic
1021343744 7:19496620-19496642 ACCCTCTGAGTTCTGTTGATGGG + Intergenic
1021347183 7:19542889-19542911 AACACTTTTATACTGTTGATGGG - Intergenic
1021539259 7:21738652-21738674 AACATTTACATTCTGTTGATGGG + Intronic
1021595033 7:22306159-22306181 AACCCTTGTACACTGTTGGTGGG - Intronic
1021623195 7:22567662-22567684 AGCCCTTGTATACTGTTGGTGGG - Intronic
1021636019 7:22694347-22694369 AACCCTTGTATACTGTTGCTGGG + Intergenic
1021770302 7:23993787-23993809 AATCTTTGTACACTGTTGGTGGG - Intergenic
1022080836 7:27019531-27019553 AACCCTTGTATTCTGTTGGTAGG + Intergenic
1022216515 7:28267962-28267984 ACCCTTTGTATACTGTTGGTGGG - Intergenic
1022397032 7:29998292-29998314 AACTCTTCTATACTGTTGATGGG - Intergenic
1022431730 7:30329916-30329938 AACCCTTGTACACTGTTGGTGGG - Intronic
1022749534 7:33209552-33209574 AACCTTCTAACACTATTGATGGG - Intronic
1022896508 7:34755209-34755231 AACCTTTGTACACTGCTGGTGGG - Intronic
1022976619 7:35564288-35564310 AACCCTTGTACACTGTTGGTGGG + Intergenic
1023068984 7:36409563-36409585 AACCTTAGAATCCTCTTAATGGG + Intronic
1023104367 7:36748964-36748986 AACCCTTGGACACTGTTGGTGGG + Intergenic
1023206422 7:37755280-37755302 AACCTTTGTACACTATTGGTGGG - Intronic
1023392928 7:39727876-39727898 AACCCTTGTACACTGTTGGTGGG - Intergenic
1023421576 7:39985584-39985606 AACCCTTGTACACTGTAGATGGG - Intronic
1024029008 7:45440695-45440717 AACCTTTGTACACTGTTGGTGGG + Intergenic
1024041072 7:45555108-45555130 AACCCTTGTATGCTGTTGGTGGG + Intergenic
1024129368 7:46334968-46334990 AACCTTTGCACACTGTTCTTTGG - Intergenic
1024136505 7:46414380-46414402 AACCCTTCTATACTGTTGGTGGG - Intergenic
1024317141 7:48031578-48031600 AACCCTTGTATACTGTTGGTGGG + Intergenic
1024498769 7:50077772-50077794 AACCCTTGTACACTGTTGATGGG + Intronic
1024593298 7:50909060-50909082 AACCATTGTACACTGTTGGTGGG - Intergenic
1024683696 7:51720895-51720917 AACCCTTGAGCACTGTTGGTGGG - Intergenic
1025061816 7:55815728-55815750 AATCCTTGTACACTGTTGATAGG + Intronic
1025603313 7:63019845-63019867 AACCCTTGTACACTGTTGGTGGG - Intergenic
1026247218 7:68631845-68631867 AACCCTTGTACACTGTTGGTGGG - Intergenic
1026563441 7:71469615-71469637 AACACTTGACCACTGTTGATTGG + Intronic
1027409324 7:77898008-77898030 AACCTTTAAATTATCTTGATAGG + Intronic
1027807195 7:82842933-82842955 AACCCTTGTACACTGTTGGTGGG + Intronic
1027918037 7:84351748-84351770 AACCCTTGTACACTGTTGGTGGG + Intronic
1027996935 7:85435990-85436012 AACCCTTGTACACTGTTGGTGGG + Intergenic
1028186737 7:87795509-87795531 AACCCTTGTACACTGTTGGTGGG + Intronic
1028239960 7:88407812-88407834 AACCATTGTACACTGTTGGTAGG - Intergenic
1028241339 7:88424833-88424855 AACCTTCATATACTGTTCATGGG - Intergenic
1028398631 7:90400639-90400661 AACTCTTGTACACTGTTGATGGG + Intronic
1028760552 7:94491325-94491347 AACACTTTTATACTGTTGATGGG + Intergenic
1029009799 7:97247296-97247318 AACCCTTGCACACTGTTGATGGG + Intergenic
1030232088 7:107219218-107219240 AACCCTTGTACACTGTTGGTGGG + Intronic
1030350211 7:108476517-108476539 AACCCTTGTAAACTGTTTATAGG + Intronic
1030418076 7:109270650-109270672 AACCCTTTTACACTGTTGATGGG - Intergenic
1030430054 7:109433956-109433978 AATCCTTATATACTGTTGATGGG - Intergenic
1030465563 7:109899148-109899170 AACATTTATACACTGTTGATGGG + Intergenic
1030546583 7:110903836-110903858 AACCCTTGAACACTGTCGGTGGG - Intronic
1030702259 7:112654075-112654097 AACCCTTGTACACTGTTGGTGGG + Intergenic
1030834662 7:114266990-114267012 AACGTTTGAATAGAGTTCATTGG + Intronic
1031211970 7:118840826-118840848 AACCTTTGCACACCGTTGGTGGG - Intergenic
1031231188 7:119108787-119108809 AACCCTTGTACACTGTTGCTGGG - Intergenic
1031433598 7:121705003-121705025 AACCCTTGTACACTGTTGATGGG + Intergenic
1031472742 7:122186679-122186701 AACCTTTGTACACTATTGGTGGG + Intergenic
1031504628 7:122566295-122566317 AACCCTTGCATATTGTTGGTAGG + Intronic
1031670916 7:124544333-124544355 AACCTTTGTATACTATTAGTGGG + Intergenic
1032674416 7:134115397-134115419 AACCCTTGTACACTGTTGGTAGG + Intergenic
1032955603 7:136968407-136968429 AACCCTTGTATGCTGTTGGTGGG + Intronic
1033123218 7:138684642-138684664 AACCCTTGTACACTGTTGGTGGG + Intronic
1033869889 7:145739231-145739253 AACCCTTATATACCGTTGATGGG - Intergenic
1033914950 7:146313167-146313189 AACCCTTGTACATTGTTGATGGG - Intronic
1033929134 7:146502498-146502520 AACACTTGAACACTGCTGATGGG - Intronic
1034033400 7:147792811-147792833 AACCTTTATACACTGTTGATGGG - Intronic
1034216698 7:149413049-149413071 AACCCTTATATACTGTTGGTGGG + Intergenic
1034597684 7:152214098-152214120 AACCTTTGTACATGGTTGATAGG + Intronic
1034755296 7:153611942-153611964 AACCCTTGCAAACTGTTGGTGGG + Intergenic
1035018370 7:155785983-155786005 AACCCTTGAGCACTGTTGGTGGG - Intergenic
1036271383 8:7306582-7306604 AACCTTTGTATACTGGTGGTGGG + Intergenic
1036349965 8:8003761-8003783 AACCTTTGTATACTGGTGGTGGG - Intergenic
1036510954 8:9399691-9399713 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1036845235 8:12164275-12164297 AACCTTTGTATACTGGTGGTGGG - Intergenic
1036866604 8:12406596-12406618 AACCTTTGTATACTGGTGGTGGG - Intergenic
1036981047 8:13470631-13470653 AACTTTTGTACACTGTTGGTGGG + Intronic
1037178893 8:15979884-15979906 AACCTTTGTAGACTGTTGGTGGG - Intergenic
1037208635 8:16357425-16357447 AACCCTTGTACACTGTTGGTTGG - Intronic
1037384454 8:18322831-18322853 AACCCTTGCACACTGTTGGTGGG - Intergenic
1037954830 8:23047735-23047757 AACCCTTGCTTACTGTTGGTGGG + Intronic
1037997258 8:23361914-23361936 AACCCTTGTGCACTGTTGATGGG + Intronic
1038898578 8:31815702-31815724 AACATTTGTATATTGTTGGTGGG - Intronic
1039392374 8:37191792-37191814 AACATTTTTACACTGTTGATGGG - Intergenic
1039420755 8:37436539-37436561 AACCCTTGTACACTGTTGGTGGG - Intergenic
1039461201 8:37746405-37746427 CACCTTTTAATACAGTTGAATGG + Intronic
1040477381 8:47791732-47791754 AACCCTTGTATACTATTGGTGGG + Intronic
1040597758 8:48856523-48856545 AGCCTTTATATACTGTTGGTTGG + Intergenic
1040628444 8:49179505-49179527 AACCCCTGTACACTGTTGATGGG + Intergenic
1040789438 8:51208154-51208176 AACCTTTGTACATTGTTAATGGG - Intergenic
1040831598 8:51683103-51683125 AACCCTTGTACACTGTTGGTAGG - Intronic
1040842400 8:51798713-51798735 AACCTTTTTACACTGTTGGTGGG + Intronic
1040912713 8:52537350-52537372 AACCTTTATATACTGTTGGTGGG + Intronic
1041023805 8:53664092-53664114 AACCCTTGCATACTGTTAGTGGG + Intergenic
1041077367 8:54181282-54181304 AACCCTTGCACACTTTTGATAGG + Intergenic
1041146949 8:54886568-54886590 AACCCTTGTACACTGTTGGTGGG + Intergenic
1041154425 8:54970565-54970587 AACCCTTGAACACTGTTGGTGGG + Intergenic
1041315812 8:56561153-56561175 AACCATTGTATACAGTTGGTAGG - Intergenic
1041364562 8:57087865-57087887 AACCCTTGTACACTGTTGATAGG + Intergenic
1041495627 8:58482548-58482570 AACCCTTGTACACTGTTGGTGGG - Intergenic
1041598350 8:59684164-59684186 AACCCTTATATACTGTTAATGGG + Intergenic
1041613476 8:59878773-59878795 AACACTTGTACACTGTTGATGGG + Intergenic
1041853212 8:62417582-62417604 AACTCTTGTATACTGTTGGTAGG - Intronic
1041893598 8:62899111-62899133 AACCCTTGTATACTGTTGATGGG + Intronic
1041982219 8:63875411-63875433 AACTCTTGTATACTGTTGATGGG - Intergenic
1042006887 8:64190960-64190982 AACCCTTGTACACTGTTGGTAGG + Intergenic
1042073593 8:64963528-64963550 AACCCTTGAGTACTGTTGGTGGG + Intergenic
1042074248 8:64972228-64972250 AACCCTTGTATGCTGTTGATGGG - Intergenic
1042726334 8:71881672-71881694 AACCTTTGTACACTTTTGATGGG - Intronic
1042981198 8:74530931-74530953 AACCCTTGTATACTGTTGATGGG + Intergenic
1043015482 8:74934857-74934879 AACCTTCGTACACTGTTGGTGGG - Intergenic
1043228831 8:77772171-77772193 AACCCTTGTACACTGTTGGTGGG + Intergenic
1043235785 8:77864240-77864262 AACCCTTGTATACTGTTGATGGG + Intergenic
1043307363 8:78812505-78812527 AACATTTGAACACTGTTGGTAGG - Intergenic
1043317062 8:78936027-78936049 AATCCTTGTATACTGTTGATGGG - Intergenic
1043567848 8:81568509-81568531 AACCCTTGAACACTGCTGATGGG + Intergenic
1043665233 8:82802365-82802387 ACCCTTTGTACACTGTTGGTGGG - Intergenic
1043770925 8:84199105-84199127 AACCCTTGTATACTGTTGGTGGG - Intronic
1044006881 8:86948368-86948390 AACCCTTGTATACTGTTGGTGGG - Intronic
1044010652 8:86989801-86989823 AACCCTCGTACACTGTTGATGGG - Intronic
1044022434 8:87122177-87122199 AACTCTTGAACACTGTTGGTGGG - Intronic
1044123590 8:88429240-88429262 AACCCTTGTATACTGCTGGTGGG - Intergenic
1044242043 8:89899868-89899890 AACCCTTGTACACTGTTGGTGGG + Intergenic
1044269049 8:90218758-90218780 AACTTTTGTGCACTGTTGATGGG - Intergenic
1044584058 8:93852585-93852607 AACCTTTGCACACTGTTGGTGGG + Intergenic
1044634946 8:94313326-94313348 AGCCCTTGTATACTGTTGGTGGG - Intergenic
1044732516 8:95240925-95240947 AACCCTTGTACACTGTTGGTAGG - Intergenic
1045460759 8:102423564-102423586 AACCTTCATATATTGTTGATGGG - Intergenic
1045590516 8:103589459-103589481 AACCCTTGTACACTGTTGGTGGG + Intronic
1045599934 8:103702047-103702069 AACACTTGTATACTGTTGGTAGG - Intronic
1045635661 8:104185760-104185782 AACCCTTATACACTGTTGATAGG + Intronic
1045685852 8:104711351-104711373 AACTCTTGAATATTGCTGATGGG + Intronic
1045764877 8:105655547-105655569 AACATTAGAAAACTGTTGAATGG + Intronic
1045791047 8:105984912-105984934 AACCCTTGCATACTGTTAGTGGG + Intergenic
1045807289 8:106178459-106178481 AACCCTTGTACACTGTTAATGGG - Intergenic
1045995153 8:108353464-108353486 AACCCTTGTACACTGTTGGTGGG + Intronic
1046113710 8:109759398-109759420 AACACTTGTACACTGTTGATGGG - Intergenic
1046133974 8:110003103-110003125 AACCGTTATATACTGTTGGTGGG - Intergenic
1046142284 8:110109380-110109402 AACACTTGCATACTGTTTATGGG - Intergenic
1046275981 8:111960592-111960614 AACCCTTGTACACTGTTGGTGGG - Intergenic
1046290620 8:112155067-112155089 GACCTTTGTATTCTGTTGGTGGG - Intergenic
1046726691 8:117682650-117682672 AACCCTTGCACACTGTTGGTGGG + Intergenic
1046770911 8:118115394-118115416 AACCCTTGCACACTGTTGGTGGG + Intergenic
1046785908 8:118266370-118266392 AACCCTTGCACACTGTTGGTGGG + Intronic
1046873807 8:119231477-119231499 AACCCTTGCACACTGTTGGTAGG + Intronic
1046881494 8:119313696-119313718 AACCCTTGCACACTGTTGGTAGG + Intergenic
1046882805 8:119328899-119328921 AACCCTTGAACACTTTGGATGGG + Intergenic
1047001102 8:120573135-120573157 AATCCTTGTATACTGTTGATAGG - Intronic
1047001107 8:120573179-120573201 AACCCTTGTACACTGTTGTTAGG - Intronic
1047158245 8:122346581-122346603 AACCCTTGTGCACTGTTGATGGG + Intergenic
1047217596 8:122889337-122889359 AACCCTTGTACACTGTTGGTAGG - Intronic
1047382873 8:124380207-124380229 AACCCTTGTACACTGTTGATGGG - Intergenic
1047681824 8:127261510-127261532 AACCTTTGCACGCTTTTGATGGG - Intergenic
1048079754 8:131112748-131112770 AACCCTTGTACACTGTTGGTGGG - Intergenic
1048515071 8:135099553-135099575 AATCCTTGCATGCTGTTGATGGG + Intergenic
1048764719 8:137831570-137831592 ATCTCTTGAATACTGCTGATTGG - Intergenic
1048787634 8:138067326-138067348 AACCCTTGTATATTGTTGGTGGG - Intergenic
1048933066 8:139331563-139331585 AACCTTTGGACACTGTTGGTGGG - Intergenic
1048936052 8:139357985-139358007 AACTTTTCAATAATTTTGATGGG - Intergenic
1050041102 9:1494712-1494734 AACCCTTGTACACTGTTGATGGG - Intergenic
1050047859 9:1566897-1566919 AACCTTTGTACACTGTTGGTGGG - Intergenic
1050186191 9:2976946-2976968 AACCCTTGAGCACTGTTGGTGGG + Intergenic
1050248639 9:3719514-3719536 AACCTTTGTACACTGTTGGCAGG + Intergenic
1050356671 9:4790436-4790458 AACCCTTGTACACTGTTGGTGGG + Intergenic
1050522408 9:6514971-6514993 AACCTTTGTATATTGTTGGTGGG - Intergenic
1050645811 9:7718429-7718451 AACACTTTTATACTGTTGATGGG + Intergenic
1050761455 9:9076913-9076935 AACCCTTGTACACTGTTGGTAGG - Intronic
1050963182 9:11764442-11764464 AACCCTTGTACACTGTTGGTGGG + Intergenic
1051038868 9:12781868-12781890 AACCCTTGTACACTGTTGGTGGG - Intronic
1051111416 9:13641617-13641639 AGCCCTTGAACACTGTTGGTTGG + Intergenic
1051169879 9:14310667-14310689 TACCTTTGTATACAGTTGTTTGG - Intronic
1051234803 9:14988190-14988212 AACCCTTGTACACTGTTGGTGGG + Intergenic
1051313265 9:15800226-15800248 AACCTTTGTATGCTGTTGGTGGG - Intronic
1051313475 9:15802866-15802888 AACATTTTTATACTGTTGCTGGG - Intronic
1051429437 9:16966856-16966878 AACCCTTGCACACTGTTGGTAGG - Intergenic
1051473692 9:17479073-17479095 ACCCTTTGTACACTGTTGGTGGG + Intronic
1051642206 9:19233879-19233901 AGCCTTTGAAAACTTTTTATTGG + Intronic
1051656043 9:19382815-19382837 AACCCTTGTGTACTGTTGGTGGG - Intergenic
1051862481 9:21642224-21642246 AACCCTCGTACACTGTTGATGGG + Intergenic
1051879496 9:21825471-21825493 AACCCTTGTATACTGCTGGTAGG - Intronic
1052063087 9:23985081-23985103 AACCCTTGTACACTGTTGGTGGG - Intergenic
1052262473 9:26533446-26533468 AACCCTTGCACACTGTTGATGGG + Intergenic
1052321962 9:27177301-27177323 AACCCTTGTATGCTGTTGGTGGG - Intronic
1052434746 9:28411876-28411898 AAACTTTGTACACTGTTAATGGG - Intronic
1052446575 9:28569168-28569190 AAACTTTGTACACTGTTGGTGGG + Intronic
1052508831 9:29388678-29388700 AACCCTTGCATACTGTTAGTGGG - Intergenic
1052511890 9:29432830-29432852 AACACTTGTACACTGTTGATGGG - Intergenic
1052561379 9:30088569-30088591 GACCTGTGAATCCTGGTGATGGG + Intergenic
1052611312 9:30777856-30777878 AACCTTTGTACACTGTTGGTGGG + Intergenic
1052661754 9:31441951-31441973 AACCCTAGCATACTGTTGGTGGG + Intergenic
1053254207 9:36602004-36602026 CACCTGTGAATAATGTTGATAGG + Intronic
1053326551 9:37157821-37157843 AACCTGTGTACACTGTTGGTGGG + Intronic
1053436415 9:38078035-38078057 AACCTCTGCACACTGTTGATGGG - Intergenic
1053848420 9:42265624-42265646 AATGTTTGTATGCTGTTGATGGG + Intergenic
1054748937 9:68884839-68884861 AACTCTTGTATACTGTTGGTGGG + Intronic
1054853098 9:69869026-69869048 AACCCTTGAACACTGTTGGTGGG + Intronic
1055176789 9:73328313-73328335 AATCTTTGAAAACTGTTAGTGGG - Intergenic
1055229116 9:74040311-74040333 AACTTTTGACTACTGTTGACTGG - Intergenic
1055387601 9:75780033-75780055 AACCCTTGCACACTGTTGGTGGG + Intergenic
1055395743 9:75873198-75873220 AACCTTTGTACACTGTTGGTGGG + Intergenic
1055521845 9:77089307-77089329 AACCCTTGTACACTGTTGGTGGG - Intergenic
1055531348 9:77187342-77187364 GACCTTTGTACACTGTTGGTAGG - Intronic
1055674911 9:78648275-78648297 AACGTTTGTACACTGTTGATGGG + Intergenic
1055750937 9:79504134-79504156 AAGCTTTGAATACCTGTGATGGG - Intergenic
1055820971 9:80263367-80263389 AACCCTTGTATACTGTTGGAGGG + Intergenic
1055940187 9:81642124-81642146 AACCTTTGTACACTGTTCTTAGG + Intronic
1056228785 9:84523897-84523919 AACCTTTGTACACTGTTAATGGG - Intergenic
1056517300 9:87366060-87366082 AACCCTGGAACACTGTTGGTAGG + Intergenic
1056651225 9:88465407-88465429 AACCCTTGTATACTGTAGGTAGG - Intronic
1056680550 9:88714036-88714058 AACCTTTAAAAATTTTTGATGGG + Intergenic
1057040811 9:91846170-91846192 AAGCTTGGAATACTGTAGAGTGG + Intronic
1057237073 9:93369930-93369952 AATGTTTGTATGCTGTTGATGGG - Intergenic
1057284268 9:93737258-93737280 AACCTTTTTACACTGTTGGTGGG + Intergenic
1057451262 9:95162566-95162588 AACCCTTGTACACTGTTGCTAGG - Intronic
1057475449 9:95397272-95397294 AACCTTTGTACCCTGTTGGTGGG + Intergenic
1057579834 9:96277597-96277619 AACTCTTGTATACTGTTGGTGGG + Intronic
1057622895 9:96652688-96652710 AACTTTTGTACACTGTTGTTAGG + Intronic
1057639805 9:96807938-96807960 AACTTTTGTATACTGTTAGTGGG + Intergenic
1058044832 9:100346615-100346637 AACCATTGATGACTGTTGGTGGG - Intronic
1058197053 9:101990405-101990427 AATCTTTGTATGCTGTTGATGGG + Intergenic
1058198268 9:102006548-102006570 AACTTTTGCACACTGTTGGTGGG - Intergenic
1058246705 9:102635188-102635210 AACCTTTTTACACTGTTGGTAGG + Intergenic
1058301640 9:103380872-103380894 AACTCTTATATACTGTTGATGGG - Intergenic
1058313038 9:103529933-103529955 AACCCTTATACACTGTTGATGGG + Intergenic
1058342550 9:103916807-103916829 AACTTTTGTACACTGTTGGTTGG - Intergenic
1058363449 9:104178383-104178405 AACCCTTTTAAACTGTTGATGGG - Intergenic
1058476477 9:105339285-105339307 AACCTTTGTGTACCGTTGATGGG + Intronic
1058555811 9:106165960-106165982 AACATTTTTATACTGTTGGTGGG + Intergenic
1058631863 9:106997205-106997227 AACCCTTGTGCACTGTTGATAGG + Intronic
1059160613 9:112031630-112031652 AACCCTTGCACACTGTTGGTGGG + Intergenic
1059619066 9:115983445-115983467 AACCTCTGAATGCTGTGGTTTGG + Intergenic
1059828075 9:118056097-118056119 AACCCTTGTACACTGTTGGTAGG - Intergenic
1059924313 9:119192627-119192649 AACCTTTCTATACAGTTGGTAGG + Intronic
1059979102 9:119749822-119749844 AACCTTTGTATACTGATAGTGGG - Intergenic
1060253902 9:122008591-122008613 AACCTTTGCACACTGTTGGTGGG + Intronic
1060383191 9:123196766-123196788 AACCCTTGTATACTGTTGGTAGG + Intronic
1060425505 9:123501574-123501596 AACCTTTGGGTACTGTTGATGGG - Intronic
1061628000 9:131853193-131853215 AGCCTTTGAATCTTGTTGCTGGG - Intergenic
1061979945 9:134096523-134096545 TACATTTGTACACTGTTGATGGG + Intergenic
1062153903 9:135035491-135035513 AACCTTTGGGCACTGCTGATGGG - Intergenic
1062296724 9:135834184-135834206 AACCTTTGCATACTGTTGGTGGG + Intronic
1203757747 Un_GL000218v1:150995-151017 AACACTTTTATACTGTTGATGGG - Intergenic
1203570743 Un_KI270744v1:128132-128154 AACCCTTGTACACTGTTGGTGGG + Intergenic
1186066739 X:5774674-5774696 AACCCTTGTATCCTGTTGGTGGG - Intergenic
1186298470 X:8173761-8173783 AACCTGTGTACACTGTTGGTGGG - Intergenic
1186915428 X:14214357-14214379 AACCATTGTACACTGTTGGTGGG - Intergenic
1186994406 X:15104381-15104403 AACCCTTGCATACTGTTGGCGGG + Intergenic
1187183114 X:16962015-16962037 AACCCTTTTATACTTTTGATGGG + Intronic
1187492607 X:19766123-19766145 AACCTTTATATACTGTCGGTGGG - Intronic
1187571103 X:20503035-20503057 AACCCTTGCACACTATTGATGGG - Intergenic
1187581822 X:20615268-20615290 AACCCTTATACACTGTTGATGGG - Intergenic
1187619732 X:21038591-21038613 AACCCTTGCACACTGTTGTTAGG - Intergenic
1187630945 X:21171308-21171330 AACCTTTGCACACTGTTGGTAGG + Intergenic
1187651551 X:21414180-21414202 AACCCTCGTATACTGTTGGTGGG - Intronic
1187759394 X:22563634-22563656 AATCGTTGCATACTGTTGGTAGG - Intergenic
1187781361 X:22829636-22829658 AACCCTTGTACACTGTTGGTGGG + Intergenic
1187837584 X:23450252-23450274 AACACTTACATACTGTTGATGGG + Intergenic
1187936383 X:24340232-24340254 AACCTTCAAACACTGTTGATAGG + Intergenic
1187941710 X:24388942-24388964 AACCCTTGTGCACTGTTGATGGG - Intergenic
1188028103 X:25232596-25232618 AACCCTTGTACACTGTTGGTGGG + Intergenic
1188036616 X:25325100-25325122 AACCCTTGAACACTGTTGGTGGG - Intergenic
1188048959 X:25460892-25460914 AACCCTTGTACACTGTTGGTGGG + Intergenic
1188089589 X:25947233-25947255 AACCCTTGCACACTGTTGGTGGG + Intergenic
1188094507 X:26004963-26004985 AATCCTTGTATACTGTTGGTGGG + Intergenic
1188217658 X:27499182-27499204 AACCCTTGTACACTGTTTATGGG - Intergenic
1188229943 X:27649419-27649441 AACATTTACATACTGTTGATGGG - Intronic
1188265786 X:28072283-28072305 AACCCTTGTACACTGTTGGTGGG + Intergenic
1188298205 X:28476236-28476258 AACCCTTAAACACTGCTGATGGG - Intergenic
1188349011 X:29104002-29104024 AACCCTTGTACACTGTTGGTGGG + Intronic
1188426601 X:30054650-30054672 AACCCTTGTACACTGTTGGTGGG - Intergenic
1188479681 X:30624459-30624481 AGCCCTTGTACACTGTTGATGGG + Intergenic
1188594646 X:31884025-31884047 AACCCTTGTACAATGTTGATGGG + Intronic
1188741592 X:33790158-33790180 AACCTTCGCACACTGTTGGTGGG - Intergenic
1188760277 X:34019361-34019383 AACACTTACATACTGTTGATGGG + Intergenic
1188791314 X:34411467-34411489 AACCCTTGTACACTGTTGGTGGG + Intergenic
1188924917 X:36027767-36027789 AACACTTATATACTGTTGATGGG - Intergenic
1188949689 X:36355241-36355263 AACCCTTGAACATTGTTGGTAGG + Intronic
1188957611 X:36452242-36452264 TACCTTTGTACACTGTTGGTGGG + Intergenic
1188977584 X:36693574-36693596 AATCTTTGTATACTGTTGGTAGG + Intergenic
1188990212 X:36809720-36809742 AACCTTTGTACACTGTTGGTGGG - Intergenic
1188992176 X:36834852-36834874 AACCCTTGTACACTGTTGGTAGG + Intergenic
1188998684 X:36918329-36918351 AACCCTTGTACACTGTTGGTGGG - Intergenic
1189059093 X:37733449-37733471 AACACTTGTATACTGTTGATAGG - Intronic
1189157733 X:38775993-38776015 AACCCTAGCATACTGTTGGTAGG - Intergenic
1189541142 X:41991169-41991191 AACCCTTGTACACTGTTGGTAGG + Intergenic
1189718392 X:43888321-43888343 AACCCTTGTACACTGTTGGTGGG - Intergenic
1189868353 X:45354873-45354895 AACCCTTGTACACTGTTGGTGGG - Intergenic
1190151353 X:47952673-47952695 AACCCTTGTATACTATTGGTGGG + Intronic
1190373997 X:49771083-49771105 AACCTTTGCACACTGTTGGTGGG - Intergenic
1190409367 X:50119969-50119991 AACCTTTGTACACTGTTAGTGGG - Intergenic
1190475275 X:50821045-50821067 AACCTTCATATACTGTTGGTTGG + Intergenic
1190485983 X:50925527-50925549 AACCCTTGCACACTGTTGGTGGG - Intergenic
1190505613 X:51123158-51123180 AACAATTGTATGCTGTTGATGGG - Intergenic
1190530846 X:51374538-51374560 AACCTTTGTACACTGTTGGTGGG + Intergenic
1190558339 X:51661114-51661136 AACCCTTGTACACTGTTGGTTGG - Intergenic
1190802126 X:53799300-53799322 AACCCTTGTATGCTGTTGGTGGG + Intergenic
1190854702 X:54282383-54282405 AACCCTTGTACACTGTTGATGGG - Intronic
1190893235 X:54589848-54589870 AACCCTTGCACACTGTTGATGGG - Intergenic
1190957950 X:55214961-55214983 AACCCTTGTACACTGTTGGTGGG - Intronic
1191084208 X:56546944-56546966 AACCCTTGTACACTGTTGGTGGG + Intergenic
1191122030 X:56915884-56915906 AACATTTTTATACTGTTGGTAGG - Intergenic
1191189002 X:57645752-57645774 AACCCTTGTACACTGTTGGTGGG + Intergenic
1191227598 X:58060746-58060768 AACCCTTGTACACTGTTGCTGGG - Intergenic
1191781887 X:64877964-64877986 AACCCTTGCACACTGTTGGTAGG + Intergenic
1191801374 X:65084638-65084660 AACCCTTGTACACTGTTGGTGGG + Intergenic
1191867284 X:65714427-65714449 AACCTTTATACACTGTTGGTGGG - Intronic
1191888116 X:65910367-65910389 AACCCTTGTATATTGCTGATGGG - Intergenic
1191964005 X:66736274-66736296 AACTTTTATATACTGTTCATGGG - Intergenic
1191970297 X:66806793-66806815 AACCCTTAAACACTGTTGGTGGG - Intergenic
1192020187 X:67381838-67381860 AAACCTTGTACACTGTTGATGGG + Intergenic
1192064951 X:67873410-67873432 AACCTTTATACACTGTTGGTGGG - Intergenic
1192074191 X:67974273-67974295 AACCTTCGTACACTTTTGATGGG + Intergenic
1192091851 X:68167377-68167399 AACCTTTGTACACTCTTGGTAGG + Intronic
1192303745 X:69935403-69935425 AACCCTTGTACACTGTTGGTGGG - Intronic
1192333098 X:70195269-70195291 AATCTTTGTACACTGTTGGTAGG + Intronic
1192375058 X:70550781-70550803 AACCCTTGCACACTGTTGGTGGG + Intronic
1192415583 X:70977323-70977345 AACTCTTGTATACTGTTTATGGG - Intergenic
1192417149 X:70991806-70991828 AACCCTTGTACACTGTTGGTGGG - Intergenic
1192507283 X:71696151-71696173 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192512580 X:71732380-71732402 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1192514117 X:71749129-71749151 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192519413 X:71785401-71785423 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1192526823 X:71853634-71853656 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192655971 X:72995191-72995213 AACCCTTGTACACTGTTGGTGGG + Intergenic
1192658498 X:73017951-73017973 AATCATTGTATACTGTTGATGGG - Intergenic
1192707201 X:73538864-73538886 AACCCTAGTATACTGTTGACAGG + Intergenic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1192838187 X:74825004-74825026 AACCCTTGTATACTGTTGATAGG - Intronic
1192852709 X:74974557-74974579 AACCCTTGTATACTGTGGATGGG - Intergenic
1192856898 X:75021541-75021563 AACGCTTTAATACTGTTGGTGGG - Intergenic
1192865107 X:75122629-75122651 AACCCTTGTACACTGTTGGTGGG - Intronic
1192898449 X:75469833-75469855 AACATTTGAAGGCTGTTGGTGGG - Intronic
1193010252 X:76667636-76667658 AACATTTTTATACTGTTGGTGGG + Intergenic
1193106819 X:77685569-77685591 AACCCTTGTATACTGTTGGTAGG + Intronic
1193190530 X:78564796-78564818 AACCTTTGTACACTGTTGGTGGG - Intergenic
1193194436 X:78613977-78613999 AACCCTTGTATACTGTTGGTGGG - Intergenic
1193321265 X:80124186-80124208 GACCCTTGTACACTGTTGATGGG - Intergenic
1193446351 X:81608872-81608894 AACCCTTGTACACTGTTGGTGGG - Intergenic
1193456502 X:81737734-81737756 AACCCTTGTACACTGTTGGTAGG - Intergenic
1193484976 X:82076545-82076567 AACCCTTGCACACTGTTGGTGGG - Intergenic
1193520703 X:82525809-82525831 AACCCTTGTAAACTGTTGGTTGG - Intergenic
1193561835 X:83028093-83028115 AACCCTTGTACACTGTTGTTGGG + Intergenic
1193611237 X:83633730-83633752 AACGTTTGTACACTGCTGATGGG - Intergenic
1193626496 X:83828107-83828129 CACCCTTGTACACTGTTGATGGG + Intergenic
1193660012 X:84246018-84246040 AGCCCTTGTACACTGTTGATGGG - Intergenic
1193664971 X:84304997-84305019 AACCCTTGTACACTGTTGGTGGG + Intergenic
1193681964 X:84532545-84532567 AACCCTTGTACACTGTTGACGGG - Intergenic
1193687946 X:84601671-84601693 AACCCTTGCACACTGTTGGTGGG - Intergenic
1193766681 X:85537182-85537204 AGCATTTGAAAACTGTTGGTGGG + Intergenic
1193802599 X:85954305-85954327 AACCCTTGAACACTGTGGGTGGG + Intronic
1193829795 X:86276142-86276164 AACCCTTGTACACTGTTGGTGGG - Intronic
1193892236 X:87063859-87063881 AACTTTTATACACTGTTGATGGG + Intergenic
1193907719 X:87263096-87263118 AACCTTTGTACACCGTTGGTGGG + Intergenic
1193987683 X:88266119-88266141 AACACTTAAATACTGTTGTTGGG + Intergenic
1193990970 X:88307023-88307045 AACCCTTGTACACTGTTGGTGGG - Intergenic
1194036520 X:88880545-88880567 AACCCTTGCACACTGTTGCTGGG - Intergenic
1194072564 X:89345113-89345135 AACATTTACACACTGTTGATGGG - Intergenic
1194093675 X:89608881-89608903 TATCTTTGAATAATGTTAATGGG - Intergenic
1194164016 X:90491183-90491205 AACCTTTGTACACTGTGGGTGGG + Intergenic
1194173191 X:90614495-90614517 AACCCATGAAGACTGTTGATGGG - Intergenic
1194220671 X:91185859-91185881 AACCCTTGAAAACTGTTAGTAGG + Intergenic
1194272676 X:91837316-91837338 AACTCTTGAATACTGTTGGTGGG + Intronic
1194290491 X:92065474-92065496 AACCTTTGTACATTGTTGGTGGG - Intronic
1194357995 X:92911959-92911981 AACCCTTCTATACTGTTGGTGGG + Intergenic
1194563415 X:95450556-95450578 AACCCTTGTACACTGTTGGTGGG - Intergenic
1194631043 X:96284435-96284457 AACCCTTGAACACTGTTGGTGGG + Intergenic
1194686808 X:96929220-96929242 AATCTTTAAATAGTTTTGATAGG - Intronic
1194857543 X:98952496-98952518 AACTCTTGTACACTGTTGATGGG - Intergenic
1194891879 X:99389114-99389136 AAACCTTGAACACTGTTGTTGGG - Intergenic
1194929804 X:99873011-99873033 AACCCTTGTAGACTGTTGGTAGG + Intergenic
1195027523 X:100892708-100892730 AACCCTTGCATACTGTTAGTGGG + Intergenic
1195072664 X:101295574-101295596 AACCCTTGTATACTGTTGGTAGG + Intergenic
1195089839 X:101448454-101448476 AACCCTTGTACACTGTTGGTGGG - Intronic
1195097607 X:101519780-101519802 AACCCTTGCACACTGTTGATGGG - Intronic
1195162358 X:102183136-102183158 AATATTTAAATACAGTTGATGGG + Intergenic
1195166397 X:102224733-102224755 AACATTTAAATACAGTTGATGGG + Intronic
1195169706 X:102254484-102254506 AACCCTTGTACACTGTTGATGGG - Intergenic
1195189151 X:102432616-102432638 AACCCTTGTACACTGTTGATGGG + Intronic
1195192463 X:102462355-102462377 AACATTTAAATACAGTTGATGGG - Intronic
1195199050 X:102529703-102529725 AAACTTTGACTACAATTGATAGG + Intergenic
1195302806 X:103548159-103548181 AACTTTTGTACACTGTTGCTGGG + Intergenic
1195452167 X:105027708-105027730 AACCCTTGTATACTGCTGGTGGG + Intronic
1195472611 X:105248874-105248896 AACCCTTGTACACTGTTGGTAGG + Intronic
1195482576 X:105363555-105363577 AACCCTTTTATACTGTTGGTGGG - Intronic
1195534340 X:105994203-105994225 AACCCTTGTACACAGTTGATGGG + Intergenic
1195547641 X:106130881-106130903 TACCCTTGAACACTGTTGATGGG + Intergenic
1195558277 X:106252447-106252469 AACCCTTGTACACTGTTGGTGGG - Intergenic
1195601966 X:106759313-106759335 AACCCTTGTACACTGTTGGTTGG + Intronic
1195632699 X:107075761-107075783 AACCCTTGTGCACTGTTGATGGG + Intronic
1195774982 X:108393015-108393037 AACCTTAGTATATTGCTGATGGG + Intronic
1195804873 X:108753052-108753074 AACCCTTGTACACTGTTGGTGGG - Intergenic
1195953189 X:110300139-110300161 AACCTTTGTACACTGTTGGTTGG - Intronic
1195958095 X:110355612-110355634 AATCCTTGCACACTGTTGATTGG + Intronic
1196164576 X:112524447-112524469 AACCTGTGCACACTGTTGGTGGG - Intergenic
1196205912 X:112939214-112939236 AACCCTTGTATACTGTTGGTGGG + Intergenic
1196213902 X:113027781-113027803 AACCCTTGTACACTGTTGGTGGG - Intergenic
1196215183 X:113042318-113042340 AACCCTTGTACACTGTTGGTGGG - Intergenic
1196387708 X:115176279-115176301 AACCATTGTACACTATTGATGGG - Intronic
1196474128 X:116062712-116062734 AACCCTTATATACTATTGATGGG - Intergenic
1196479635 X:116132176-116132198 AACCTTCGTACACTGTTGGTGGG - Intergenic
1196509541 X:116491648-116491670 AAACTTTGTACACTGTTGGTAGG - Intergenic
1196557359 X:117104356-117104378 AACCCTTGCACACTGTTGGTGGG + Intergenic
1196771213 X:119295925-119295947 AACCATTGTACACTGTTGGTGGG - Intergenic
1196800409 X:119538160-119538182 CACCTTTTAATACAGTTGAATGG + Exonic
1196913351 X:120506688-120506710 AACCCTTGTACACTGTTGGTGGG - Intergenic
1196985741 X:121268271-121268293 AACCCTTGTACACTCTTGATGGG - Intergenic
1196995990 X:121384509-121384531 AACCCTTGTACACTGTTGGTGGG + Intergenic
1197044822 X:121982737-121982759 AGCCTTTGCTCACTGTTGATGGG + Intergenic
1197090706 X:122533041-122533063 AACCCTTGTACACTGTTGGTGGG + Intergenic
1197124286 X:122925735-122925757 AACTCTTATATACTGTTGATGGG - Intergenic
1197208219 X:123808286-123808308 AACCTGTAAATGCTTTTGATAGG + Intergenic
1197261094 X:124319008-124319030 AACTCTTGAACACTGTTGGTGGG + Intronic
1197264802 X:124357602-124357624 AACCCTTGCACACTGTTGGTGGG - Intronic
1197430281 X:126354224-126354246 AATCTTTGTGCACTGTTGATGGG + Intergenic
1197450508 X:126608778-126608800 AACCCTTGTACACTGTTGGTGGG - Intergenic
1197452196 X:126633217-126633239 AACCCTTGTATATTGTTGGTGGG - Intergenic
1197469687 X:126851969-126851991 AACCATTGTACACTGTTGGTGGG - Intergenic
1197492485 X:127135509-127135531 AAAGTTTGTACACTGTTGATGGG + Intergenic
1197526765 X:127574358-127574380 AACCCTTGTACACTGTTGATGGG - Intergenic
1197606511 X:128591720-128591742 AACATTTTTACACTGTTGATGGG - Intergenic
1197651308 X:129067749-129067771 AACCCTTGTACACTGTTGGTGGG + Intergenic
1197862005 X:130980666-130980688 AACCTTTGTACACTGTTGGTGGG + Intergenic
1197922085 X:131605684-131605706 AACCCTTGCACACTGTTGGTAGG - Intergenic
1197926581 X:131653074-131653096 AACCCTCAAACACTGTTGATGGG - Intergenic
1197986798 X:132274820-132274842 AACCCTTGTACACTGTTGGTGGG - Intergenic
1198145788 X:133856228-133856250 AACTCTTGTATACTGTTGGTGGG - Intronic
1198192281 X:134320098-134320120 AACCCTTGCACACTGTTGTTGGG + Intergenic
1198538294 X:137608535-137608557 AACCCTTGTACACTGTTGGTAGG + Intergenic
1198570437 X:137949517-137949539 AACCCTTGAACACTGTTGGTGGG - Intergenic
1198628496 X:138606904-138606926 AACATTTGTAGACTGTTGCTGGG - Intergenic
1198798838 X:140429099-140429121 AACCCTTGTACACTGTTGGTGGG + Intergenic
1198890041 X:141384057-141384079 AACCCTTGTACACTTTTGATGGG + Intergenic
1198964187 X:142210282-142210304 AACACTTGCATACTGTTGGTGGG - Intergenic
1199035592 X:143046371-143046393 AACCCTTGTACACTGTTGGTAGG - Intergenic
1199075795 X:143524012-143524034 AACCCTTGTACACTGTTGGTGGG - Intergenic
1199096140 X:143742654-143742676 AACTTTTGCACACTGTTGGTGGG - Intergenic
1199124248 X:144095916-144095938 AACCCTCGTATACTGTTGGTGGG + Intergenic
1199153570 X:144519191-144519213 AACCCTTGTAATCTGTTGATGGG - Intergenic
1199159635 X:144593480-144593502 AACCCTTGTACACTGTTGGTGGG - Intergenic
1199178120 X:144816710-144816732 AACCTCTGTACACTGTTGGTGGG + Intergenic
1199187346 X:144930832-144930854 AACCTTTATACACTGTTGGTGGG - Intergenic
1199195386 X:145023371-145023393 AACCCTTGTATACTATTGGTGGG + Intergenic
1199304617 X:146252698-146252720 AACCTTTGTACTCTGTTGGTGGG + Intergenic
1199327383 X:146514841-146514863 AACCTTTGTACACTGTTGGAGGG - Intergenic
1199358689 X:146891622-146891644 AATCTTTGTACACTGTTGGTAGG + Intergenic
1199362291 X:146935970-146935992 AACCCTTGTACACTGTTGACAGG - Intergenic
1199483169 X:148320903-148320925 AATTGTTGAATACTGTTTATGGG - Intergenic
1199533226 X:148872842-148872864 AACGGTTGAATACTCATGATGGG - Intronic
1199580589 X:149356461-149356483 AACTTTTGTACACTGTTGGTGGG - Intergenic
1199660292 X:150042823-150042845 AACCCTCGTACACTGTTGATGGG - Intergenic
1199683890 X:150247700-150247722 AACCTTTGTAGAATGTTGTTAGG + Intergenic
1199797116 X:151210416-151210438 ACCCTTTGTAAACTGTTGGTGGG + Intergenic
1199925267 X:152456200-152456222 AATCTTTGTACACTGTTGGTGGG + Intergenic
1200272923 X:154703773-154703795 AACCTTTGTACACTGTTGGCAGG + Intronic
1200273308 X:154708739-154708761 AACCCTTGTACACTGTTGGTGGG + Intronic
1200274795 X:154721792-154721814 AACCCTAGTATACTGTTGGTGGG + Intronic
1200280338 X:154771966-154771988 AACCTTTGTACACTGTTGATGGG - Intronic
1200307196 X:155038961-155038983 AATCTTTGTACACTGTTGGTAGG - Intronic
1200319489 X:155171938-155171960 AACGTTTGTATACTGTTGGTGGG - Intergenic
1200335297 X:155344629-155344651 AACCCTTGCACACTGTTGGTGGG - Intergenic
1200351171 X:155496592-155496614 AACCCTTGCACACTGTTGGTGGG + Intronic
1200363854 X:155639823-155639845 AACCCTTGTATACTGTTAGTGGG - Intronic
1200446305 Y:3265007-3265029 AATCTTTGAAGAATGTTAATGGG - Intergenic
1200510275 Y:4068992-4069014 AACCTTTGTACACTGTGGGTGGG + Intergenic
1200512364 Y:4096642-4096664 AACCCTTGTATACTGTTAGTGGG + Intergenic
1200519407 Y:4192210-4192232 AACCCATAAAGACTGTTGATGGG - Intergenic
1200557179 Y:4649611-4649633 AACCCTTGAAAACTGTTAGTAGG + Intergenic
1200589921 Y:5058733-5058755 AACTCTTGAATACTGTTGGTGGG + Intronic
1200608003 Y:5290074-5290096 AACCTTTGTACATTGTTGGTGGG - Intronic
1200666174 Y:6027610-6027632 AACCCTTGTATACTGTTGGTGGG + Intergenic
1200726802 Y:6680860-6680882 AACATTTACACACTGTTGATGGG - Intergenic
1200727954 Y:6696636-6696658 AACATTTACACACTGTTGATGGG - Intergenic
1201439159 Y:13989595-13989617 AACCTGTGTACACTGTTGGTGGG - Intergenic
1201445414 Y:14053113-14053135 AACCTGTGTACACTGTTGGTGGG + Intergenic
1201457312 Y:14182971-14182993 AACCTTTACATGTTGTTGATGGG - Intergenic