ID: 1098509000

View in Genome Browser
Species Human (GRCh38)
Location 12:71289998-71290020
Sequence CAGAAATCTGCATTTCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 12, 3: 54, 4: 528}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098509000 Original CRISPR CAGAAATCTGCATTTCTTTG GGG Intronic
901498401 1:9636188-9636210 AACAATTCTGCATTTTTTTGGGG + Intergenic
901900057 1:12353027-12353049 CATATATCTTCATTTCTTTTAGG - Intronic
901903339 1:12386518-12386540 CAGAATTCTGCATATATTAGAGG + Intronic
901905420 1:12405261-12405283 CGGAAATCTGGATTTTTATGTGG + Intronic
902795938 1:18800339-18800361 CAGAAACCAGCCTTTATTTGGGG - Intergenic
903087034 1:20870754-20870776 TAGAATTCAGCATTTCTTTTTGG - Intronic
904590106 1:31608917-31608939 CAGATGTCTGCATTTGTTAGGGG - Intergenic
907265433 1:53257125-53257147 CTGAATACTGCATATCTTTGAGG - Intronic
907590039 1:55657792-55657814 CATAAATTTTCATTTCTTTAGGG + Intergenic
907642692 1:56207086-56207108 CATAAATTTTCATTTCTTTGGGG - Intergenic
907693806 1:56700452-56700474 CACAACTCTGCATTTGTTTCTGG + Intronic
908091294 1:60687892-60687914 TAGAAATCTGGATTTCTTACTGG + Intergenic
908674230 1:66584346-66584368 CAGAGATTTGCTTCTCTTTGAGG - Intronic
909321161 1:74286885-74286907 CAGAAATCTTCATTTCCTTAGGG - Intronic
909408471 1:75320199-75320221 CAAAGATCTGGTTTTCTTTGAGG - Intronic
910155478 1:84213461-84213483 CAAAAATCTTCACTTATTTGGGG + Intronic
910380582 1:86622630-86622652 CATATATCTCTATTTCTTTGGGG - Intergenic
910514338 1:88041657-88041679 AAGAAAACTGCATGTCTTTAGGG + Intergenic
910944248 1:92571800-92571822 CAGAAACCTGCATTTTCTTGAGG + Intronic
911262576 1:95703001-95703023 CACAAATCTCCATTTCTTTAGGG - Intergenic
912059998 1:105656108-105656130 TGGATATCTGTATTTCTTTGAGG - Intergenic
912277974 1:108280848-108280870 CATAGATCTCCTTTTCTTTGGGG + Intergenic
912290252 1:108413509-108413531 CATAGATCTCCTTTTCTTTGGGG - Intronic
912772500 1:112477533-112477555 CATAGATCTCTATTTCTTTGGGG - Intronic
913427824 1:118754198-118754220 CAGATCTCTGGATTTCTTTGAGG + Intergenic
913966356 1:143380617-143380639 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914060729 1:144206224-144206246 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914118421 1:144760145-144760167 CTGTAAGCTGCATTTTTTTGAGG - Intergenic
914396268 1:147271758-147271780 CAGCAATCTGCCTTTCAGTGAGG - Intronic
914434550 1:147648392-147648414 CAGAAAGCTGTATCTCTATGCGG - Exonic
914454489 1:147823241-147823263 CATATACCTGCATGTCTTTGAGG + Intergenic
915029450 1:152865175-152865197 CAGAAAGCTGAATTTATTTTCGG - Intergenic
915806020 1:158851553-158851575 CAGATATTTCCTTTTCTTTGTGG - Intergenic
916146969 1:161748821-161748843 CATAAGTCTGCCTTTCTTCGTGG - Intergenic
916913360 1:169377047-169377069 TAGAAAACTACATTTCTTTATGG + Intronic
917005260 1:170408324-170408346 CAAATAACTGCACTTCTTTGAGG - Intergenic
917578938 1:176354562-176354584 CACAGATCTCCATTTCTTTCGGG + Intergenic
917921642 1:179755585-179755607 CAAAAATCCTCATTCCTTTGAGG - Intronic
918454762 1:184697802-184697824 CAGAAATATTAATTCCTTTGAGG - Intronic
918888559 1:190232181-190232203 CAGAGATCTTCATGTCTTTTGGG - Intronic
918941801 1:191009464-191009486 CAGCAATTTGCATTTCCCTGTGG + Intergenic
921332322 1:214051658-214051680 CAAAAATCTGCATAACATTGAGG - Intergenic
921701488 1:218273568-218273590 AAGAATTCATCATTTCTTTGTGG - Intergenic
922656294 1:227387133-227387155 CATAAATTTTCATTTCTTTTAGG - Intergenic
1062869200 10:884596-884618 GTGAAATGTGCATTTCTTGGTGG - Intronic
1063277105 10:4581720-4581742 AAGAAATGAGAATTTCTTTGAGG + Intergenic
1063433935 10:6015473-6015495 CAGGAATCTGTATTTCTATCAGG - Intronic
1063473410 10:6307432-6307454 TAGAAATGTTCCTTTCTTTGGGG - Intergenic
1063609134 10:7548166-7548188 CAGATATTTGGATTTCCTTGAGG + Intergenic
1064163629 10:12967334-12967356 CACATATCTTAATTTCTTTGTGG - Intronic
1064267433 10:13836454-13836476 CAGAAATTGACAATTCTTTGGGG + Intronic
1064572809 10:16713675-16713697 CATAAATGTCCTTTTCTTTGGGG + Intronic
1064725286 10:18272923-18272945 CAGAGATCTGCATTTTTTTGGGG - Intronic
1064887961 10:20134203-20134225 CATAGATCTCCAATTCTTTGAGG + Intronic
1067264048 10:44721717-44721739 CAGCAAGCTGCATTCCTTTCTGG + Intergenic
1067716595 10:48695200-48695222 CAGGGATCTGCTTTTCTCTGGGG + Intronic
1067852939 10:49766782-49766804 CATAAGTCTTCATTTCTCTGGGG + Intergenic
1068562550 10:58531582-58531604 CACAGATCTCCATTTCTTTTGGG - Intronic
1070316136 10:75314087-75314109 CGCAGATCTCCATTTCTTTGAGG - Intergenic
1070365433 10:75732515-75732537 TAGAATTCTCCACTTCTTTGGGG + Intronic
1071909992 10:90220616-90220638 CAGAAAGCTGCTTTATTTTGGGG + Intergenic
1073209289 10:101785822-101785844 GACAAATGTGCATTTGTTTGTGG - Exonic
1074255286 10:111796266-111796288 CAGAATTCTGCATTTCTTTCTGG + Intergenic
1074898294 10:117795633-117795655 GAGAAAGCTGCAGATCTTTGGGG - Intergenic
1075067905 10:119302128-119302150 CAGAAATCCACATTCCTTTAAGG + Intronic
1075544470 10:123344288-123344310 CAGAAATGTGACTTTCTTGGTGG + Intergenic
1075760421 10:124851204-124851226 CAGATGTCTGCATATATTTGGGG + Intergenic
1076073130 10:127508794-127508816 TAGAAATGTGCATTTGATTGTGG + Intergenic
1076332972 10:129684797-129684819 CAGAATTCTGCATTTCCTCCTGG - Intronic
1078277107 11:9859967-9859989 CAAAAATCAGGAGTTCTTTGAGG + Intronic
1079160419 11:17987475-17987497 AAGCAATCTGAATCTCTTTGAGG + Intronic
1079691628 11:23425531-23425553 CAGAAAGCTGCCTTGCCTTGGGG - Intergenic
1079882580 11:25944978-25945000 CACAACTCTACATTTCTCTGAGG + Intergenic
1079935657 11:26613483-26613505 CATAAATTTTCTTTTCTTTGGGG + Intronic
1080091855 11:28357777-28357799 CAGAAATCTTCATTTCTTTCGGG + Intergenic
1080208735 11:29760386-29760408 TAGTAATCTGCATTACTCTGAGG - Intergenic
1080590711 11:33721003-33721025 CAGCAGTCTGCATTTGTTTATGG - Intronic
1081747365 11:45482596-45482618 CAGAAAGCAGCTTTTCTTGGTGG - Intergenic
1082129379 11:48470373-48470395 CATATATCTCCATTTCTTTAGGG + Intergenic
1082247709 11:49943328-49943350 CATATATCTCCATTTCTTTAGGG - Intergenic
1082702279 11:56446751-56446773 CAGAAATCTGGAATTATCTGTGG + Intergenic
1083076430 11:60043527-60043549 CAGAAATCTGTATATATTTGCGG + Exonic
1083127998 11:60591544-60591566 CATATATTTCCATTTCTTTGGGG - Intergenic
1083289511 11:61681922-61681944 GGGAAATCTTCAGTTCTTTGTGG + Intronic
1084855380 11:71981717-71981739 CAGAAATGTGCCTCTCTCTGAGG + Intronic
1084929261 11:72541358-72541380 CAGAGAGCTGCACTTCTTTGTGG - Intergenic
1085068087 11:73516142-73516164 CAGAAATCTTAATGCCTTTGAGG - Intronic
1085799477 11:79575766-79575788 CATAATTCTGCATTGCTTTTGGG + Intergenic
1085920366 11:80948083-80948105 GTTAAATCAGCATTTCTTTGGGG - Intergenic
1086177845 11:83913760-83913782 CAAAAGTCTCCCTTTCTTTGAGG - Intronic
1087124779 11:94614217-94614239 CACAAATCTCCATTTCTTTGAGG + Intronic
1087163842 11:94978048-94978070 CAGAAATATGACTTTCTTTCGGG + Intronic
1087227657 11:95620307-95620329 CATAGATCTTCATTTCTTTAGGG - Intergenic
1087253590 11:95930603-95930625 CATAAATCTGAATTTCTTTAGGG - Intergenic
1087786464 11:102360618-102360640 CATAGATCTCCATTTCTTTGTGG + Intronic
1088149635 11:106728133-106728155 CAGAAATATGAAATTATTTGGGG - Intronic
1088630551 11:111770189-111770211 CAGAAATCTGCATTTTTAACAGG - Intergenic
1089481950 11:118812960-118812982 CAGAATGCTGCACTTCTATGTGG - Intergenic
1090125963 11:124084471-124084493 CATAATTATCCATTTCTTTGTGG - Intergenic
1090212466 11:124931723-124931745 CAGATATGGGCATTTCTTTTGGG - Intronic
1090952469 11:131485596-131485618 CATAAATCTTCATTTCTTTTTGG - Intronic
1091664870 12:2411840-2411862 CAGACATCTGCAATTCCTTTGGG - Intronic
1091987888 12:4927840-4927862 CAGAAAAGTCCATTTCTTTCTGG + Intronic
1092578511 12:9814725-9814747 CTGACATCTGCACTCCTTTGGGG + Intergenic
1092600703 12:10060209-10060231 CATAAATTTTCATTTCTATGAGG - Intronic
1093260230 12:16927660-16927682 CATAGATCTTCATTTCTTTAGGG + Intergenic
1093276859 12:17139779-17139801 CAAATATTTTCATTTCTTTGTGG + Intergenic
1093469805 12:19488534-19488556 AAGAAATCAACATTTCTTTTTGG + Intronic
1093841973 12:23914440-23914462 TAGAAATCAGGATTTCCTTGAGG + Intronic
1093842339 12:23919279-23919301 CAAAAATCTGGATTTTTATGAGG + Intronic
1093917195 12:24817638-24817660 CAAAAAATTGCATTTGTTTGAGG + Exonic
1093978870 12:25453061-25453083 CAGGGCTCTGCATTTCTCTGTGG + Intronic
1094674677 12:32607813-32607835 CAGAAATCTGCATTTCATGCAGG + Intronic
1094733982 12:33211440-33211462 AATAAATCTCCACTTCTTTGAGG - Intergenic
1094884984 12:34856819-34856841 CAGATATTTGCACCTCTTTGAGG + Intergenic
1094887423 12:34896221-34896243 CAGATATTTGGACTTCTTTGAGG + Intergenic
1094895203 12:35022912-35022934 CAGATATTTGCACCTCTTTGGGG + Intergenic
1094899991 12:35100375-35100397 CAGATATTTGGATCTCTTTGGGG + Intergenic
1094905866 12:35195130-35195152 CAGATATCTGGACCTCTTTGGGG + Intergenic
1094908779 12:35242342-35242364 CAGATATCTGGACCTCTTTGGGG + Intergenic
1094917823 12:35388745-35388767 CAGATATTTGCACCTCTTTGAGG + Intergenic
1094920019 12:35424073-35424095 CAGATATCTGGACCTCTTTGAGG + Intergenic
1094926226 12:35524788-35524810 CAGAAATTTGGACTTCTTTGAGG + Intergenic
1094926718 12:35532928-35532950 CAGATATTTGGATCTCTTTGGGG + Intergenic
1094927052 12:35538364-35538386 CAGATATTTGGATCTCTTTGAGG + Intergenic
1094931275 12:35606639-35606661 CAGATATTTGGATCTCTTTGGGG + Intergenic
1094932098 12:35619887-35619909 CAGATATTTGCACCTCTTTGAGG + Intergenic
1094935066 12:35668079-35668101 CAGATATTTGCACCTCTTTGAGG + Intergenic
1094935319 12:35672155-35672177 CAGATATCTGGACCTCTTTGGGG + Intergenic
1094936423 12:35690159-35690181 CAGATATTTGGACTTCTTTGAGG + Intergenic
1094940694 12:35759451-35759473 CAGATATTTGGATGTCTTTGGGG + Intergenic
1094941162 12:35766924-35766946 CAGATATCTGGACCTCTTTGGGG + Intergenic
1094941622 12:35774394-35774416 CAGATATTTGGATCTCTTTGGGG + Intergenic
1094944189 12:35816192-35816214 CAGATATCTGGACCTCTTTGGGG + Intergenic
1094954184 12:35977885-35977907 CAGATATCTGGACCTCTTTGAGG + Intergenic
1094955048 12:35991811-35991833 CAGATATTTGCACCTCTTTGAGG + Intergenic
1094957158 12:36026121-36026143 CAGATATCTGCACCTCTTTGAGG + Intergenic
1094957837 12:36036988-36037010 CAGATATTTGGATGTCTTTGGGG + Intergenic
1094965814 12:36166083-36166105 CAGATATTTGGACTTCTTTGAGG + Intergenic
1094966783 12:36181711-36181733 CAGATATTTGGATCTCTTTGAGG + Intergenic
1094968178 12:36204133-36204155 CAGATATTTGGACTTCTTTGAGG + Intergenic
1094975112 12:36315551-36315573 CAGATATTTGGATCTCTTTGGGG + Intergenic
1094986188 12:36494937-36494959 CAGATATTTGCACCTCTTTGAGG + Intergenic
1094988237 12:36528236-36528258 CAGATATTTGGACTTCTTTGAGG + Intergenic
1094989718 12:36552363-36552385 CAGATATTTGGATCTCTTTGGGG + Intergenic
1094992764 12:36601606-36601628 CAGATATTTGGACTTCTTTGAGG + Intergenic
1094993229 12:36609075-36609097 CAGATATTTGCACCTCTTTGAGG + Intergenic
1095001485 12:36742402-36742424 CAGATATTTGGACTTCTTTGAGG + Intergenic
1095001980 12:36750559-36750581 CAGATATTTGCACCTCTTTGAGG + Intergenic
1095002926 12:36765844-36765866 CAGATATTTGCACCTCTTTGAGG + Intergenic
1095003538 12:36775697-36775719 CAGATATTTGGACTTCTTTGAGG + Intergenic
1095010529 12:36889380-36889402 CAGATATTTGCACCTCTTTGGGG + Intergenic
1095019573 12:37035554-37035576 CAGATATTTGCACCTCTTTGAGG + Intergenic
1095020162 12:37045069-37045091 CAGATATTTGCACCTCTTTGAGG + Intergenic
1095021842 12:37072248-37072270 CAGATATTTGCACCTCTTTGAGG + Intergenic
1095266950 12:40171899-40171921 CAGAGAACTTTATTTCTTTGAGG - Intergenic
1095364089 12:41381724-41381746 CATACATCTCCATTTCTTTAGGG + Intronic
1095501621 12:42846220-42846242 CATAGATCTCCATTTATTTGGGG + Intergenic
1095624189 12:44295822-44295844 CATAGATCTCAATTTCTTTGGGG + Intronic
1096352718 12:50913578-50913600 CATAGATCTCCATTTCTTTAGGG - Intergenic
1096363888 12:51011881-51011903 CAGAAATCTGTAATTCTCTTTGG + Intronic
1096484467 12:51968931-51968953 CAGAAATCTGCAATGCTTTCTGG + Intronic
1096522507 12:52192145-52192167 CAGGTATCTGCATTGCTTAGGGG + Intergenic
1098509000 12:71289998-71290020 CAGAAATCTGCATTTCTTTGGGG + Intronic
1098798553 12:74923537-74923559 CATAAATATCCATTTCTTTAAGG - Intergenic
1098821128 12:75231621-75231643 CATAGATCTCCATTTCTTTGGGG + Intergenic
1099224639 12:79955506-79955528 AATAAATCTCCATTTCTTTAGGG + Intergenic
1099564155 12:84219148-84219170 CAGCAATTTGCATTTCATTTTGG + Intergenic
1099599078 12:84708731-84708753 CAGGAATGAGCATTTTTTTGAGG + Intergenic
1099851189 12:88099312-88099334 CAGAAATCAGGAGTTCATTGTGG + Intronic
1099862525 12:88238381-88238403 CATATATCTTCATTTCTTTAGGG + Intergenic
1100482165 12:94989637-94989659 TTCAAAGCTGCATTTCTTTGTGG - Intronic
1100700848 12:97146140-97146162 CTGAGAACTGCATTTATTTGAGG - Intergenic
1100917591 12:99443474-99443496 CTGAAATCTGCATTAGTTTTTGG - Intronic
1102196310 12:111027779-111027801 CAGGAATCTTCATTTGGTTGTGG - Intergenic
1102390975 12:112548412-112548434 CAAAAAGCTGCATTGCTTTTTGG + Intergenic
1103307276 12:119975126-119975148 TATAAATCTGCATTTCCCTGGGG - Intergenic
1103557995 12:121777461-121777483 CAGAAATCTGGATTTTTATGTGG - Exonic
1104608027 12:130204130-130204152 CAGCAGTCTGCATTCCTTTCTGG - Intergenic
1105710346 13:23002054-23002076 TAGAAATTTGCATTTCTATCAGG + Intergenic
1106117714 13:26831343-26831365 CAGAACTCAGCATCTCTTCGAGG - Intergenic
1106647472 13:31652077-31652099 AAGAAATCTTAATTTCTTGGGGG - Intergenic
1106930614 13:34660047-34660069 CAGAAATCTCCCTTCCTATGTGG - Intergenic
1107179260 13:37439279-37439301 GAGATATCTGCATTTCCATGTGG - Intergenic
1107327050 13:39255664-39255686 CAGAGTTCTGCATTCCTATGAGG - Intergenic
1107616798 13:42177479-42177501 CACAATTTTGCATTTCTTTTGGG + Intronic
1107681152 13:42852330-42852352 CATACATCTGCATTTCTGTTGGG - Intergenic
1108906090 13:55476051-55476073 CAGAAATATGAATTTATTTCTGG + Intergenic
1109021327 13:57096488-57096510 CATATTTCTGCATTTCTTTTTGG - Intergenic
1110577525 13:77076350-77076372 GAGAAAACTGCTTTTGTTTGGGG + Intronic
1110644094 13:77861510-77861532 CAGAAGTATTCATTGCTTTGGGG + Intergenic
1110704458 13:78588832-78588854 CAGAAATCTGTATTCATTTCTGG - Intergenic
1111602443 13:90492600-90492622 CACAAATCTTCATTTCTTTGGGG + Intergenic
1111752207 13:92346703-92346725 CAGAGATCTCCATTTCTTTAGGG - Intronic
1112041372 13:95552134-95552156 CAAAACTCTGCAGTTCTTTTTGG - Intronic
1112118120 13:96379663-96379685 AAGAAATCTGCATTTTTATCGGG - Intronic
1112252357 13:97793746-97793768 AAGAGAACTGCATTTCTTGGGGG - Intergenic
1112342777 13:98566168-98566190 GAAAAATCTCCATTTCATTGAGG - Intronic
1112528400 13:100175614-100175636 CAGTAATTTACATTTCATTGTGG + Intronic
1112602088 13:100867316-100867338 CATAAATTTCCAATTCTTTGGGG + Intergenic
1112743474 13:102501134-102501156 CAGAAATTTTCATTTCTCTAGGG + Intergenic
1112885813 13:104170006-104170028 CAAAAATATGCATTTCTTTAGGG - Intergenic
1112964502 13:105171016-105171038 CAGAGATCTCCATTTCTTTGAGG + Intergenic
1113709964 13:112456740-112456762 CAGAACCCTGCATTGATTTGGGG - Intergenic
1114164622 14:20208274-20208296 CAAAACTCTGCATTTGTTTATGG + Intergenic
1114700437 14:24672796-24672818 CAGAAATCTGTATTTTTTACAGG + Intergenic
1115718968 14:36138815-36138837 CACATATATGCATTTCTTTTGGG - Intergenic
1116701185 14:48244153-48244175 CACAAGTCTGCAGTTCTATGCGG - Intergenic
1117229660 14:53702937-53702959 AAGAAATTTGCATGTCTTAGAGG - Intergenic
1117706220 14:58471413-58471435 CAAAAATATGCATTTCTTCCTGG + Intronic
1118111848 14:62730707-62730729 CAGAAATCTTCATTTCTAATGGG + Intronic
1118499874 14:66350022-66350044 CACACATCTGCATTTCTTTAGGG - Intergenic
1118556840 14:67032923-67032945 CATAAATCTCTGTTTCTTTGAGG - Intronic
1118698890 14:68413559-68413581 TAGAAATATGCATGCCTTTGGGG + Intronic
1119712813 14:76835192-76835214 CACTAGTCTGCATTTCTATGAGG - Intronic
1120272047 14:82325726-82325748 CATAAATTTTCTTTTCTTTGTGG + Intergenic
1120329442 14:83071836-83071858 CATAGATCTCCATTTCTTTGTGG + Intergenic
1121269989 14:92631582-92631604 CAGGAATCTGCATTTTTTTTTGG + Intronic
1121937428 14:98033050-98033072 CGGAAATCTGGATTTCTCTTGGG - Intergenic
1123961089 15:25402029-25402051 CATATATCTCCATTTCTTTATGG + Intronic
1123992796 15:25695874-25695896 CTGAAAATTGCATTTCTTTAGGG - Intronic
1124805777 15:32881037-32881059 CACAAAGCTTCATTTCATTGTGG + Intronic
1125004134 15:34799181-34799203 CAGGAATCTGAATTTCTATGAGG - Intergenic
1127035002 15:54906198-54906220 CAGAAAGATGCTTTCCTTTGAGG - Intergenic
1127128506 15:55837076-55837098 CATATAGCTGCCTTTCTTTGTGG - Intronic
1127612152 15:60647379-60647401 CCGAAATCTGCCTGGCTTTGCGG + Intronic
1128408521 15:67368841-67368863 TAGAAATGTGATTTTCTTTGTGG + Intronic
1129381883 15:75173184-75173206 CAGAAATCTCCCCTACTTTGGGG - Intergenic
1129540590 15:76344188-76344210 GAGAAATCTGTATTTCTGTTGGG - Intergenic
1129911343 15:79229672-79229694 TATAGATCTCCATTTCTTTGGGG + Intergenic
1130203038 15:81851057-81851079 CTGAACTCTGCATTTCTCTAGGG - Intergenic
1130410308 15:83642293-83642315 CATAGATCTACATTTCTCTGGGG + Intergenic
1131031372 15:89188645-89188667 CATAAATCTGCATTTCGCAGTGG + Intronic
1131247075 15:90804276-90804298 CAGAAGTCTGCAAATCTCTGGGG + Exonic
1131747041 15:95459986-95460008 CAGAAATGTTCATACCTTTGTGG - Intergenic
1135426053 16:22336542-22336564 CATAAATCTCCATTTCTTTAGGG - Intergenic
1135510060 16:23074883-23074905 TAAAAATATGCATTTATTTGGGG + Intronic
1135757183 16:25107827-25107849 CAGGGATGTGCATTTCTTAGGGG + Intergenic
1135782080 16:25313267-25313289 CATAAATCTCCATTTCTTTAGGG + Intergenic
1137256446 16:46778774-46778796 CAGATATCTGCAGTTCTCAGTGG - Intronic
1138080106 16:54082440-54082462 CAGAAATCTGCCTTTGGTTAAGG + Intronic
1138132335 16:54491224-54491246 GAAAAATAAGCATTTCTTTGGGG + Intergenic
1138794046 16:59945999-59946021 CACACATTTGTATTTCTTTGGGG + Intergenic
1138851969 16:60640593-60640615 ATGAAATCTTCATTCCTTTGGGG + Intergenic
1139035768 16:62944617-62944639 CAGAAAATTTCATTTCTTTGAGG + Intergenic
1140127270 16:72128555-72128577 CAGTTAGCTGCATTTCTGTGTGG + Intronic
1140548397 16:75835307-75835329 CCAAAATCTGCATTTGTTTCTGG + Intergenic
1140570669 16:76103236-76103258 CATACATCTCCATTTCTTTAAGG + Intergenic
1141030501 16:80583688-80583710 CAAACATGTGCATTTCTTGGTGG - Intergenic
1143936407 17:10490088-10490110 TATAGATCTCCATTTCTTTGGGG + Intergenic
1144090840 17:11854827-11854849 CAGCTATCTGCATTGTTTTGTGG + Intronic
1144371579 17:14596396-14596418 CACAAGTCTGCCTTTCTTCGTGG + Intergenic
1145178376 17:20722046-20722068 CAGAAATCTCCATGGCTTTGGGG + Intergenic
1147469166 17:40641894-40641916 CTTCACTCTGCATTTCTTTGAGG + Intronic
1148054688 17:44787123-44787145 CAGAAAACTCCATTTTATTGTGG + Intergenic
1148409595 17:47453345-47453367 CTGAAATCACCATTTCTCTGAGG - Intergenic
1149081820 17:52666933-52666955 CAGTAGTCTTCATTTCTTTGGGG - Intergenic
1149345538 17:55731325-55731347 CAGAAATGTTCATTTTATTGTGG - Intronic
1149468303 17:56896801-56896823 CAATAATTTGCATTTCTTAGGGG - Intronic
1149838022 17:59931633-59931655 CAGAAATCTCCATGGCTTTGGGG + Exonic
1150178797 17:63092212-63092234 CATATATCTTCATTTCTTTTGGG + Intronic
1150305112 17:64078032-64078054 CACAAATGTGCATTTCTGTTGGG + Intronic
1150731424 17:67698399-67698421 CAGAAACTTTTATTTCTTTGGGG + Intergenic
1151133175 17:71919498-71919520 GACAAATCTACATTTCATTGTGG + Intergenic
1151771396 17:76164520-76164542 CAAAAATCAGCATTCCTTTCAGG + Intronic
1151844970 17:76646792-76646814 CAGTATTCTACATTTCTCTGAGG + Intergenic
1152032522 17:77853179-77853201 CAGACAGCTGCATTTCTATCAGG - Intergenic
1152334380 17:79692148-79692170 GGGAAATCTGCATTCCATTGTGG + Intergenic
1153462407 18:5350946-5350968 CATATATATGCATTTCTGTGTGG - Intergenic
1155258166 18:24015848-24015870 AAGGAACCTTCATTTCTTTGGGG + Intronic
1156043425 18:32850812-32850834 GATAAATTTCCATTTCTTTGGGG - Intergenic
1156069519 18:33189205-33189227 CACAAATCTTCATTTCCATGGGG - Intronic
1156228854 18:35134811-35134833 AAGAAAACTGAAGTTCTTTGTGG - Intronic
1157084120 18:44560268-44560290 CTGAAATCTTCACTTATTTGAGG - Intergenic
1158024845 18:52884579-52884601 TAGAATTCTGAATTTCTTTGCGG + Intronic
1158247700 18:55450841-55450863 AAGAAATCTGCATTTGTCAGTGG + Intronic
1158871273 18:61690708-61690730 CTGAAATCTGAATTTCCTTATGG - Intergenic
1158923982 18:62231064-62231086 CAGAAATCTGGTTAGCTTTGTGG + Intronic
1159108828 18:64032686-64032708 AATAAATCTTCATTTCTGTGGGG - Intergenic
1159594430 18:70369445-70369467 CAGAAGTCTGCATTCCTATCGGG - Intergenic
1161727228 19:5936597-5936619 CTGGAATCTGCATTTCTCAGAGG - Intronic
1161904644 19:7147495-7147517 CAGAAAACTTCACTTCTTGGTGG - Intronic
1164787664 19:30946570-30946592 CAGAGCTCTGCATTTCTTCCTGG + Intergenic
1164946934 19:32303608-32303630 TATAGATCTTCATTTCTTTGGGG + Intergenic
1164972642 19:32545699-32545721 CAGGAATCGGCATTTTTTTAAGG - Intergenic
1165677087 19:37735749-37735771 CAGAAACCTGGATATTTTTGAGG + Intergenic
1167413109 19:49356540-49356562 CAGAAATCTTCATTTCCTGGTGG - Intronic
1168049584 19:53818774-53818796 CAGGAATCTGCATTTTGATGTGG - Intronic
1202700137 1_KI270712v1_random:158112-158134 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
925325121 2:3012857-3012879 CATATATCTTCTTTTCTTTGGGG - Intergenic
925599752 2:5596229-5596251 CAGAACCCTGGATTTCTTTTGGG - Intergenic
925965941 2:9066292-9066314 CATAGATCTCCATTTCTTTGGGG + Intergenic
927093918 2:19733367-19733389 CAGAAAACTGCATTGCTAAGTGG - Intergenic
929066586 2:37982086-37982108 CAGAAATCCACCCTTCTTTGCGG + Intronic
929534944 2:42775771-42775793 GAGAAATCTGTTTTTCCTTGTGG + Intronic
930779744 2:55212379-55212401 CAGGAATTTGCATTTCTAAGAGG + Intronic
931528754 2:63188779-63188801 TACAGATCTGCATTTCTTTAAGG + Intronic
931624785 2:64247423-64247445 CAGACATCTGCATGTCAGTGAGG + Intergenic
934171070 2:89541587-89541609 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
934281375 2:91615905-91615927 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
934607191 2:95705232-95705254 CAGAAACTTGGATTTCTTTCAGG - Intergenic
934958915 2:98649933-98649955 CATATGTCTTCATTTCTTTGGGG - Intronic
935507621 2:103925700-103925722 GAGAACTTTGCATTACTTTGAGG - Intergenic
936000183 2:108819846-108819868 CAGAGATCTGCATTTCTTTAGGG - Intronic
936431130 2:112464567-112464589 CATACATTTTCATTTCTTTGGGG - Intergenic
937195010 2:120146147-120146169 AAGAAATTTACATTTCTTTCTGG - Intronic
938134691 2:128746337-128746359 CTGAAATATGCATTTATTAGGGG + Intergenic
938311905 2:130296308-130296330 CACAAATCTGCCTTTCTTCATGG - Intergenic
939564215 2:143767393-143767415 CAGGATTCTGCATTTTATTGTGG + Intronic
939856642 2:147366557-147366579 CAGAACACTGCGTTTCTTTAAGG + Intergenic
940881745 2:158953669-158953691 CAGAAATATGATTTTGTTTGGGG - Intergenic
941477330 2:165966283-165966305 AATAAATCTGCGTTTCTTGGAGG + Intergenic
942367493 2:175243028-175243050 TAGAAATCTCCATTTTTTAGTGG - Intergenic
943341263 2:186684889-186684911 CAGAAAGCTGTCTTTCTTTCTGG + Intergenic
944373154 2:199010664-199010686 CACATATCTCCATTTATTTGGGG + Intergenic
945129504 2:206554174-206554196 AAGATATCTGCATTTTTTTCAGG - Intronic
945655798 2:212621473-212621495 CACAGATTTCCATTTCTTTGGGG - Intergenic
945805667 2:214487130-214487152 CAGCAATCTGGATTCTTTTGAGG - Intronic
946746912 2:222855218-222855240 CAGGACTCTGCATATCATTGAGG - Intergenic
946814302 2:223560598-223560620 AAGGTAGCTGCATTTCTTTGAGG - Intergenic
947066916 2:226237312-226237334 CAGACATCTGCAGATCATTGTGG + Intergenic
947618266 2:231572577-231572599 TAGCTATCTGGATTTCTTTGGGG + Intergenic
948334672 2:237198565-237198587 CATTAATTTGCAGTTCTTTGGGG + Intergenic
1168730542 20:75208-75230 CATATATCTCCATTTCTTTGTGG - Intergenic
1169508787 20:6242130-6242152 CAGAAAACTCCAGTTCTCTGGGG + Intergenic
1170006022 20:11669990-11670012 GAGGAATCTACATTGCTTTGAGG - Intergenic
1170056257 20:12207811-12207833 CATAGATCTGCATTTCTTTAGGG + Intergenic
1170235740 20:14102943-14102965 CAGAAAACAGCATTTCTATGAGG + Intronic
1170369865 20:15637096-15637118 AGGAAATCTGCAGTTCTTTGTGG - Intronic
1170805720 20:19629051-19629073 CATAAATCTTTATTTCTTTTGGG - Intronic
1171005710 20:21463659-21463681 CAGAAATCTGCAGTGATCTGGGG - Intergenic
1171111527 20:22487826-22487848 AAGAAAACTGCGTTTATTTGTGG - Intergenic
1172053467 20:32137467-32137489 CAGAAATCTCCATTTCTATGAGG - Intronic
1172808234 20:37628625-37628647 CAGAAATAAGCATTTATTTCAGG - Intergenic
1173020142 20:39260203-39260225 CAGAGATCTACCTTTCTTTTGGG + Intergenic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1173427681 20:42956975-42956997 CAGAAATCTGCATTTCCAATGGG - Intronic
1173715769 20:45204053-45204075 CATACATCTCCATGTCTTTGGGG + Intergenic
1177341080 21:19801081-19801103 GAGAAAACTGCATTTCACTGAGG + Intergenic
1177875970 21:26632600-26632622 CATAGATCTTCATTTCTTTAGGG + Intergenic
1181413375 22:22741509-22741531 AAGAAATCTGCTCTTATTTGTGG - Intronic
1181748354 22:24971708-24971730 CAGAAATTGGTATTTTTTTGGGG + Intronic
1182278316 22:29204276-29204298 TACAAAGCTGCATTTCTTGGAGG + Intergenic
1184965751 22:47970930-47970952 TTAAAATCTGCATTTCTCTGTGG + Intergenic
1185107001 22:48877634-48877656 CACAAGTTTTCATTTCTTTGGGG + Intergenic
949581333 3:5391507-5391529 CAGAAATCTGCATTCTAGTGGGG - Intergenic
949767334 3:7541744-7541766 ATGAAATCTGCATTTCTTACTGG + Intronic
950803310 3:15573702-15573724 CAGAAATGTGCATTTCTAACAGG + Intronic
950855824 3:16103933-16103955 CACAAATCTTGAGTTCTTTGAGG - Intergenic
951131879 3:19056222-19056244 CAGAGATCTCCATTTCCTAGAGG - Intergenic
951891482 3:27571972-27571994 CAAAAATATTCACTTCTTTGAGG - Intergenic
952059944 3:29495712-29495734 CAGAAATCTGTATTTCTGACCGG - Intronic
952192723 3:31041302-31041324 GAGAAATCTGCAGTTCCCTGAGG - Intergenic
952547628 3:34437785-34437807 CAGATATCAGCATTTCTATATGG - Intergenic
952712336 3:36444001-36444023 CAGACATCGGCTTTTTTTTGGGG - Intronic
952782482 3:37115640-37115662 GAGAAATCGGCATTTTCTTGAGG - Intronic
953501354 3:43437937-43437959 CACAGATCTTCATTTCTTTTGGG - Intronic
955261761 3:57397953-57397975 CATAGATCTGCATTTCCTTATGG - Intronic
955320762 3:57972698-57972720 TACAAGTCTGCCTTTCTTTGTGG - Intergenic
956368297 3:68530296-68530318 CAGAAATCTGTTTTTCATTATGG - Intronic
956636311 3:71368978-71369000 CAGAAATAAGTATTTCTTTGAGG - Intronic
956636314 3:71369017-71369039 CAGAAATAAGTATTTATTTGAGG - Intronic
957736072 3:84204441-84204463 CAGAAATATGCATAGTTTTGGGG + Intergenic
957912898 3:86645462-86645484 CCTAAATCTGCATTAATTTGGGG + Intergenic
958500542 3:94901831-94901853 TAGAAATATGCCTTTCTTTTTGG + Intergenic
958585236 3:96078541-96078563 CAGAAATTTGCATTTCCAAGGGG - Intergenic
958608451 3:96391361-96391383 CAGGAGTCTGAATTACTTTGAGG - Intergenic
959469263 3:106729454-106729476 CAGAATTTTGCATTTCTCTTTGG + Intergenic
959936857 3:112038328-112038350 TAAAAATCTGTGTTTCTTTGGGG + Intronic
960021248 3:112956501-112956523 CATACATCTCCATGTCTTTGTGG + Intronic
960302673 3:116023246-116023268 CAGACATCAACATTTCTTTCTGG + Intronic
960313064 3:116140857-116140879 CAGAAACCTGAATTTCCTTTGGG - Intronic
960391312 3:117080689-117080711 CAGAAATTTGCATTTCTATTAGG + Intronic
960598294 3:119428598-119428620 CATAAATCTCCATTTCTTTGGGG + Intergenic
960728814 3:120701469-120701491 AAGAAATCTGCATTTTTGTCAGG - Intronic
960798759 3:121515828-121515850 CACAGATCTTCATTTCTTTAGGG - Intronic
961449737 3:126997249-126997271 CAGAAGGATGGATTTCTTTGGGG + Intronic
961500609 3:127330338-127330360 TATAGATCTCCATTTCTTTGGGG - Intergenic
961983243 3:131103975-131103997 CATAGCTATGCATTTCTTTGGGG - Intronic
962954429 3:140251154-140251176 TAGACATCTCTATTTCTTTGTGG + Intronic
963712647 3:148764959-148764981 CATAAATCTTGATTTCTTTTAGG - Intergenic
963788069 3:149555573-149555595 TATAAATATGCATTTCATTGAGG + Intronic
964301053 3:155285193-155285215 CAGAAATCTTTTTTTTTTTGAGG - Intergenic
964314558 3:155429511-155429533 TAGAAACCAGCATTTCCTTGTGG - Intronic
964884289 3:161463873-161463895 CATAAATTTTCTTTTCTTTGGGG + Intergenic
964991700 3:162820576-162820598 CAGAAAGCTTGATTACTTTGTGG - Intergenic
965202822 3:165681762-165681784 CTCAAATCTGCATGTCTTAGGGG - Intergenic
965556032 3:170019234-170019256 CAGAAAGCTGCACTTCTTGGAGG - Intergenic
965596236 3:170414162-170414184 CTGGAATGTGCATTTCTCTGTGG - Intergenic
965689420 3:171339520-171339542 CAGAGATCTGCGTCTGTTTGTGG + Intronic
965701353 3:171461259-171461281 CAGGACTCAGCATTTCTTTCAGG + Intergenic
966065386 3:175815426-175815448 CATAGATCTCCATTTCTTTAGGG - Intergenic
966567052 3:181395539-181395561 AATAGATCTCCATTTCTTTGGGG + Intergenic
966571963 3:181453890-181453912 CAGAAATCTGTTCCTCTTTGTGG - Intergenic
967803909 3:193696373-193696395 GGGAGATCTTCATTTCTTTGAGG + Exonic
968133280 3:196205161-196205183 CATAAGTTTTCATTTCTTTGGGG - Intronic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
968734318 4:2287561-2287583 CACAAATCTTCCTTTCTCTGCGG + Intronic
969199547 4:5591783-5591805 CACAGATTTGCATTTCTATGAGG + Intronic
969200737 4:5603224-5603246 CAGGAATCTGAATTTTATTGGGG + Intronic
969469147 4:7376686-7376708 CATACATATGCATGTCTTTGTGG + Intronic
971413334 4:26398610-26398632 CAGAATTCTGTTTTTCTTTTTGG + Intronic
973709052 4:53608643-53608665 CATACATGTGCATGTCTTTGTGG - Intronic
973724128 4:53755165-53755187 CATAGATCTGCCTTTCTTTAGGG - Intronic
974850343 4:67396835-67396857 AATAAATCTACATTTCTTTTTGG - Intergenic
974996752 4:69170335-69170357 CATAGATCTTCATTTCCTTGAGG + Intronic
975009734 4:69335284-69335306 CATAGATCTTCATTTCCTTGAGG + Intronic
975217922 4:71778583-71778605 TAGAAATCTAGATTTTTTTGTGG + Intronic
975833563 4:78397028-78397050 CACAAATCTTCATTTCTTTGGGG + Intronic
976374213 4:84325646-84325668 CTGACATCTGCATTACTTTGAGG + Intergenic
977542610 4:98336153-98336175 AAGAAATCTGTATTTCTTATAGG + Intronic
978729424 4:112007992-112008014 AAGTAAGCTGCATTTCATTGTGG + Intergenic
978908446 4:114037380-114037402 AAGCAATCTGCCTTTCTTTGTGG + Intergenic
979395739 4:120187112-120187134 CAGGAATCTGCTTATCTTGGCGG - Intergenic
979550608 4:121987014-121987036 CACAAATCTCAATTTCTTTTAGG + Intergenic
979575365 4:122284895-122284917 CAGTAATCTCCCTTTATTTGGGG - Intronic
981617132 4:146654128-146654150 TAGAAAGCTGCATTTCTGTCTGG + Intergenic
981974782 4:150712909-150712931 CAAAAAACTGGTTTTCTTTGTGG - Intronic
982045031 4:151436069-151436091 AAGATAGCTGCATTTCTTTTTGG - Intronic
982521319 4:156419907-156419929 CAGAAACCTGCATCTTTTTAGGG - Intergenic
982679536 4:158412284-158412306 TAGAAATGCACATTTCTTTGGGG + Intronic
983106543 4:163693413-163693435 CAGAAAGCTGCAGTTCTGAGTGG + Intronic
983690288 4:170461083-170461105 AAGAAATCAGAATTTCTTAGAGG - Intergenic
984028600 4:174574772-174574794 CAGAAATCTGGATTTACTTTTGG + Intergenic
985147603 4:186909662-186909684 CAAAAAGCTGAATTTGTTTGTGG + Intergenic
985813547 5:2109611-2109633 CAGATGTCTGCATTTGTGTGGGG - Intergenic
986214015 5:5700958-5700980 CATACATCTTCATTTCTTTTGGG - Intergenic
986238572 5:5935769-5935791 CAGGAATCGCTATTTCTTTGTGG + Intergenic
986638307 5:9846895-9846917 TTGAAATCTGCTTTTCTTTCAGG + Intergenic
986724572 5:10584711-10584733 CAGCAATCTCCATTTCTGTCTGG - Intronic
986909836 5:12542417-12542439 CAGACATATGCATTTCTTCCTGG + Intergenic
987821301 5:22970200-22970222 AAGAGCTCTGCATCTCTTTGGGG - Intergenic
987887823 5:23833291-23833313 CATAATTCTACATTTCTCTGTGG - Intergenic
988338745 5:29941220-29941242 GAGAAATCTGAGTTTATTTGGGG + Intergenic
988803204 5:34716101-34716123 CATACATCTGCAGTTATTTGTGG + Intronic
988974675 5:36503175-36503197 TAGGAATCTGCAGTTCTTTCAGG - Intergenic
989423203 5:41264737-41264759 GAGAAATCTCCATTTGGTTGTGG - Intergenic
989713390 5:44429018-44429040 AAGAAATCTGAATTTCTTCTAGG - Intergenic
990050327 5:51492151-51492173 CAGCGATCTGCATCTCTTTTTGG + Intergenic
990353451 5:54941423-54941445 CTGAAATCTGCTTTTTTTTGAGG - Intergenic
990614530 5:57493997-57494019 CAAAAATTTGCAATTCTATGTGG + Intergenic
990789537 5:59461715-59461737 AAAAAATCTGGTTTTCTTTGAGG - Intronic
991275881 5:64845379-64845401 CAAATATCTCCGTTTCTTTGGGG - Intronic
992625679 5:78634116-78634138 CAGAAATATGCTTTTTTTGGGGG - Intronic
993060973 5:83038771-83038793 CAGAAACATGAATTTCATTGAGG + Intergenic
993521357 5:88905854-88905876 CAGAAATGTACATTAGTTTGTGG - Intergenic
994769930 5:103968158-103968180 CATAGATTTCCATTTCTTTGGGG + Intergenic
995185872 5:109269139-109269161 TATAAATCTCCATTTCTTTTGGG - Intergenic
995614132 5:113942057-113942079 CTGAAAACTACAATTCTTTGGGG + Intergenic
995661278 5:114485995-114486017 CAGAAAACTGCAGTCCTATGAGG + Intronic
996040981 5:118810498-118810520 CATAGATCTCCATTTCTTTAGGG - Intergenic
996143993 5:119950698-119950720 CAGAACTCTTCATTTATATGTGG + Intergenic
996954091 5:129162998-129163020 CATAATTCTGCATTTCTCAGAGG + Intergenic
997432493 5:133850313-133850335 CAGACATCTGAAATACTTTGAGG - Intergenic
997810587 5:136963878-136963900 CAGAAATCAGTAATTCTTTAAGG + Intergenic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1000880473 5:166691386-166691408 CTGAAATCTGCATTTCTAACAGG + Intergenic
1000971967 5:167724673-167724695 GAGAAGACTTCATTTCTTTGTGG + Intronic
1000990884 5:167910535-167910557 CTAGCATCTGCATTTCTTTGTGG + Intronic
1001561502 5:172672289-172672311 CAGAAACCTGCATCTCCTGGAGG - Intronic
1001710636 5:173775246-173775268 TATAATTATGCATTTCTTTGTGG + Intergenic
1001863623 5:175082965-175082987 CATAAATTTCTATTTCTTTGGGG + Intergenic
1001887294 5:175304598-175304620 CAGAGACCTGCATTTCTGTAGGG - Intergenic
1002141854 5:177146581-177146603 AAGAAATCTGTATTTCTATCAGG + Intronic
1003795921 6:9603140-9603162 TAGCAATCTGAATTTCATTGAGG - Intronic
1003984461 6:11420651-11420673 CATACATCTCCATTTCTTTAAGG - Intergenic
1007439634 6:41847189-41847211 CACAGATCTGCATTTCTTTAGGG - Intronic
1007710267 6:43818451-43818473 CAGATATCTCTGTTTCTTTGAGG + Intergenic
1008512906 6:52293621-52293643 CTCAAATCTACTTTTCTTTGAGG - Intergenic
1009271080 6:61614856-61614878 CAAAAAACTGCAGTTCCTTGAGG - Intergenic
1010076928 6:71809384-71809406 TATAAATTTCCATTTCTTTGGGG - Intergenic
1010336895 6:74695868-74695890 CAATAATATGCATTACTTTGGGG - Intergenic
1010365859 6:75050376-75050398 CAGAAGTCTAAATTTCTCTGAGG + Intergenic
1010500182 6:76589899-76589921 CATAAATTGGCATTTCTTTAGGG + Intergenic
1010947941 6:81999922-81999944 TATAAATCTCCCTTTCTTTGGGG - Intergenic
1011483619 6:87819576-87819598 CAGAAATCTGCATCTCAGAGAGG - Intergenic
1012295358 6:97514782-97514804 CATATATCTCCATTTCTTTGTGG - Intergenic
1012516631 6:100069549-100069571 CATAGATCTCCCTTTCTTTGGGG + Intergenic
1012671687 6:102057656-102057678 AAGGAATTTGGATTTCTTTGTGG - Intronic
1013379627 6:109554832-109554854 CAGCAATTTGTATTTCTGTGGGG + Intronic
1014888033 6:126806058-126806080 CACAAAAATGCTTTTCTTTGAGG - Intergenic
1014932402 6:127349609-127349631 CATAGATCTTCATTTCTTTAGGG - Intergenic
1015151522 6:130044482-130044504 AAGAAATCTGTATTGCTTTAAGG + Intronic
1015473922 6:133637947-133637969 CAGAAATCTGGCTTTCAGTGGGG + Intergenic
1015482419 6:133727452-133727474 TATAAATCTGTATTTCTTTAGGG - Intergenic
1015637482 6:135292057-135292079 CAGAAATCTGTATTTCTTTTAGG + Intronic
1016793405 6:148090561-148090583 CATAAATCTTCCTTTCTTTGGGG - Intergenic
1017149161 6:151262449-151262471 CTGTAGTCTGCATTTCTTAGAGG - Intronic
1017985944 6:159443220-159443242 CAGAAATATACATTTTTATGTGG + Intergenic
1018257881 6:161940731-161940753 CAGAAATCAGAATGTCTATGTGG + Intronic
1018811598 6:167302099-167302121 AATAAATCTGCATTTCTAGGTGG + Intronic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1019311290 7:362125-362147 CAGACTTCTGCAATTGTTTGTGG - Intergenic
1019872869 7:3781569-3781591 TACAGATCTCCATTTCTTTGGGG - Intronic
1020053821 7:5102990-5103012 CATAGATCTCCTTTTCTTTGGGG + Intergenic
1020552042 7:9619806-9619828 AAGAGATATGTATTTCTTTGGGG - Intergenic
1020836901 7:13164814-13164836 CAGCAATCTGTTTTTGTTTGGGG - Intergenic
1021060716 7:16106789-16106811 CATAAATGTACATTCCTTTGAGG - Intronic
1021795696 7:24251524-24251546 CATAGATCTCCATTTCTTTAGGG - Intergenic
1021891794 7:25193759-25193781 CAGAAAACTGGATATCTTTGTGG + Intergenic
1023040555 7:36169205-36169227 CATATATTTTCATTTCTTTGGGG + Intronic
1023145296 7:37145068-37145090 CAGGCATCTGAATTTCTTGGAGG + Intronic
1023236155 7:38090550-38090572 CATAGATTTCCATTTCTTTGGGG - Intergenic
1024319749 7:48052936-48052958 CAGCCATCTGCATTTATTGGAGG + Intronic
1025968362 7:66297211-66297233 CATAAATCTGTATTTCCTAGTGG + Intronic
1026094601 7:67334152-67334174 CAGAAATGTACATTAGTTTGTGG + Intergenic
1026261231 7:68757477-68757499 GAGAAATGAGTATTTCTTTGTGG + Intergenic
1027334513 7:77134097-77134119 CTGCAATCTGCATTTGGTTGTGG + Intronic
1027824631 7:83094722-83094744 CAGACATCTTCATTTTTCTGGGG + Intronic
1028594102 7:92529454-92529476 AATAACTCTGCATTTCTTTCAGG + Exonic
1028740750 7:94271719-94271741 CAGAAATCTGGCTTTCTTGCAGG - Intergenic
1029781334 7:102737494-102737516 CTGCAATCTGCATTTGGTTGTGG - Intergenic
1029869104 7:103669745-103669767 CATAGAACTGCATTTCCTTGGGG - Intronic
1030501262 7:110363232-110363254 CATAGATTTTCATTTCTTTGAGG + Intergenic
1030733133 7:113013822-113013844 CACAGATCTACATTTCTTTAGGG + Intergenic
1030934617 7:115569926-115569948 CAGAAATCCACATTTCCTGGTGG - Intergenic
1030986729 7:116250400-116250422 CAGGAATGTTCATTTGTTTGGGG - Exonic
1031242276 7:119261639-119261661 CAGAAATAGGTATTGCTTTGAGG - Intergenic
1031712168 7:125062279-125062301 CAGACTTCTCCTTTTCTTTGGGG + Intergenic
1031980366 7:128120753-128120775 CAGAAATCTGGATTTGTCTCTGG - Intergenic
1032698595 7:134359143-134359165 CAGAAAAGTGCTTTTTTTTGTGG + Intergenic
1032847376 7:135763056-135763078 CATCAGTCTGCAGTTCTTTGAGG + Intergenic
1033710014 7:143933480-143933502 CATAAATCTCCATTTCTTTAGGG + Intergenic
1034364881 7:150537365-150537387 CATAGATCTGCATTTCTGTAAGG - Intergenic
1035516557 8:238497-238519 CAGAAACCTGTATTTCTTTATGG - Intronic
1036983873 8:13503961-13503983 AAGAAATCTTCCTTTCTTTCTGG + Intronic
1037138363 8:15490650-15490672 CATAAATCAGCATCTCTTTTAGG - Intronic
1037303279 8:17477145-17477167 CGTAGATCTCCATTTCTTTGAGG + Intergenic
1037626423 8:20611263-20611285 GGGAAAGCTGCATCTCTTTGAGG - Intergenic
1037965881 8:23133868-23133890 CATAAATCTGCCTTTCTTCGTGG + Intergenic
1039198766 8:35062397-35062419 CATAAATTTGTATTTCTTTGTGG - Intergenic
1039239625 8:35541920-35541942 CTGAAATCTGAAGTTCTTTAAGG + Intronic
1039240399 8:35549813-35549835 CAGAATTCTGAATATTTTTGAGG + Intronic
1039652317 8:39354962-39354984 CATAAATCTGCAACTCTTTTGGG - Intergenic
1040091723 8:43405469-43405491 CTGATATTTGTATTTCTTTGGGG + Intergenic
1041941793 8:63396586-63396608 CAGAAAACTGCATTTATTCTTGG - Intergenic
1042830543 8:73023131-73023153 CAAATATATGCATTTCTTTTGGG + Intronic
1043085351 8:75825239-75825261 CAGAACTCTGGAATTCTCTGGGG - Intergenic
1043535041 8:81193632-81193654 CAGAAATATGCCTTTCCTTATGG + Intergenic
1043560522 8:81488306-81488328 CAGAGTTTTGCTTTTCTTTGGGG + Intergenic
1044341751 8:91054158-91054180 AGGAATTCTGCATTCCTTTGTGG + Intergenic
1045700012 8:104855299-104855321 AAGAAATTTGGATGTCTTTGTGG - Intronic
1046002757 8:108441664-108441686 CAGGAATCCGCAGTTCTGTGTGG + Intergenic
1046822195 8:118646419-118646441 CATAATTCTGGATTGCTTTGGGG + Intergenic
1047325542 8:123832290-123832312 TAGCAAACTGGATTTCTTTGGGG - Intergenic
1050006745 9:1140200-1140222 CATAGATCTTCATTTCTTTAGGG + Intergenic
1050278225 9:4022581-4022603 CAGATGTTTGCATTTCTCTGGGG - Intronic
1050965800 9:11800699-11800721 CAGAAAAATTCATTGCTTTGTGG + Intergenic
1051098935 9:13498503-13498525 CACAATTCTGCATTGCTGTGGGG - Intergenic
1051202814 9:14647924-14647946 CAAAAATCTGGATTTCAATGGGG - Intronic
1051245385 9:15105234-15105256 CATACATCTGCATTTCTTTAGGG - Intergenic
1051322400 9:15921514-15921536 CTGAAAACTGCCTTTCTTTATGG - Intronic
1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG + Intergenic
1051561313 9:18443708-18443730 CAGATTTCTCCATATCTTTGGGG - Intergenic
1051792261 9:20819185-20819207 TAGAACTTTACATTTCTTTGAGG + Intronic
1051812574 9:21066901-21066923 CTGAAATCCTCTTTTCTTTGAGG + Intergenic
1052116199 9:24651166-24651188 CATAGATCTCCATTTCTCTGGGG + Intergenic
1052704589 9:31980402-31980424 TATAAATTTCCATTTCTTTGTGG + Intergenic
1052890370 9:33693931-33693953 CTGTCATCTGCACTTCTTTGTGG + Intergenic
1054426320 9:65073756-65073778 CAGATATTTGGATTGCTTTGAGG + Intergenic
1055131460 9:72779741-72779763 CATAATTCTGTATTTCTTGGAGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057200590 9:93137712-93137734 CAGGAGTCTGCATTTCTATCAGG + Intergenic
1058683536 9:107460845-107460867 CACAGATCTCCATTTCTTTAGGG - Intergenic
1059207235 9:112478098-112478120 CCTAGATCTCCATTTCTTTGGGG - Intronic
1059857471 9:118415870-118415892 AAGATAGCTGCATTTCTTTTAGG + Intergenic
1060330737 9:122666953-122666975 CAGAAATTTCTGTTTCTTTGGGG - Intergenic
1060542295 9:124439078-124439100 CAGAAACCTGGTTCTCTTTGGGG + Intergenic
1061055726 9:128221959-128221981 CAGAAATCTGGATTTGTATTTGG - Intronic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1186872276 X:13784746-13784768 CAGATCTCTGCCTTTCTTTCTGG - Intronic
1187798873 X:23037102-23037124 CAGGAATCTGCCTGTCTTTTGGG + Intergenic
1188677782 X:32964397-32964419 GAGAACTCTGCATTTCTATTTGG - Intronic
1189269277 X:39739488-39739510 CAGACATCTTCATGCCTTTGTGG - Intergenic
1189889085 X:45580443-45580465 CATATATCTCCATTTCTTTAGGG + Intergenic
1190680610 X:52824687-52824709 CAGAAAACTGCATTTCATTTAGG - Intergenic
1192619505 X:72663047-72663069 CATAAATTTCCTTTTCTTTGAGG - Intronic
1192728413 X:73777479-73777501 CATATATCTACATTTCCTTGGGG + Intergenic
1193277472 X:79606001-79606023 CAGAATCCTGTATTTCTCTGAGG - Intergenic
1193549900 X:82879108-82879130 CATAACTCTGCATTTATTTTGGG + Intergenic
1193552380 X:82911880-82911902 CATAGATCTGCATTTATTTAAGG - Intergenic
1194361913 X:92962940-92962962 CATAAGTCTTCATTTCTTTGGGG - Intergenic
1194506646 X:94742207-94742229 CAGATATCTGTGTTTCTCTGGGG + Intergenic
1195893298 X:109719496-109719518 CATATCTTTGCATTTCTTTGTGG - Intronic
1196063232 X:111433708-111433730 CAGAAGTTTTCATTTCTCTGGGG - Intergenic
1196169387 X:112570911-112570933 TAGAACTCTGCATTTTTTTTAGG - Intergenic
1196296420 X:114002736-114002758 GAGAAATCAGCATGTCTTTCTGG + Intergenic
1197572701 X:128168791-128168813 CAGAAAACAGCATTTATTTATGG + Intergenic
1198004551 X:132479735-132479757 CAGACACCTGCATTTCTTCATGG - Intronic
1198937453 X:141913431-141913453 TAGAGATCTGCCTTACTTTGGGG + Intergenic
1198961599 X:142189434-142189456 TAGAGATCTGCCTTACTTTGGGG - Intergenic
1199537585 X:148920582-148920604 CAAAAATGTGTATGTCTTTGGGG + Intronic
1199838440 X:151618066-151618088 AAAAAATCTACATTTCTTTTGGG + Intronic
1200670160 Y:6079156-6079178 CATAAGTCTTCATTTCTTTGGGG - Intergenic
1201667235 Y:16472391-16472413 CAGAAATCTGGATATATGTGGGG - Intergenic