ID: 1098509330

View in Genome Browser
Species Human (GRCh38)
Location 12:71292985-71293007
Sequence CCATTTGCTATGTAAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098509324_1098509330 19 Left 1098509324 12:71292943-71292965 CCAAGATATATCATGATGTGTAA 0: 1
1: 0
2: 1
3: 41
4: 422
Right 1098509330 12:71292985-71293007 CCATTTGCTATGTAAGAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 149
1098509328_1098509330 -7 Left 1098509328 12:71292969-71292991 CCAAGGGGCAGATTTTCCATTTG 0: 1
1: 0
2: 3
3: 34
4: 464
Right 1098509330 12:71292985-71293007 CCATTTGCTATGTAAGAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098509330 Original CRISPR CCATTTGCTATGTAAGAAGC TGG Intronic
902641525 1:17769343-17769365 CCATTTCCTCTGTAAAGAGCTGG + Intronic
903653176 1:24933185-24933207 CCATGGGCTATGGAAGGAGCTGG + Intronic
908077927 1:60541508-60541530 CCATTGGCTATGGGAGAAGCGGG + Intergenic
910035413 1:82782379-82782401 TCATTTTCTATGTCAGAAGATGG - Intergenic
912334407 1:108848751-108848773 CCATTTGCAAGACAAGAAGCTGG - Exonic
913447134 1:118961506-118961528 CCATTTACTATGTAAAATTCAGG + Intronic
915182087 1:154070800-154070822 CATTCTGCTATGTAAGAAACAGG + Intronic
915614014 1:157021112-157021134 CCAGTTGCTCTGTAGGAAGATGG + Intronic
916191822 1:162186695-162186717 CCATTTGCAAACCAAGAAGCAGG + Intronic
921103531 1:211952561-211952583 CCACTTGCCATATAAGAAACAGG + Exonic
1063771882 10:9213471-9213493 CCATTTCCTATGTAAGATACAGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1065643341 10:27807370-27807392 CTCTTTGCTGTGTAAGAACCTGG - Intergenic
1065975582 10:30839107-30839129 CCATTTGCTGTTTAAAAAGGGGG - Intronic
1066609533 10:37226403-37226425 CAATTTGCCATGGATGAAGCTGG - Intronic
1074221464 10:111442387-111442409 CCATGTGCTTTGAAAGAAGTGGG - Intergenic
1083468062 11:62862360-62862382 CCATTGGCCCTGTTAGAAGCAGG - Intronic
1085582777 11:77669719-77669741 ACATTTTTTATGTAAGAGGCAGG + Intronic
1087445633 11:98248767-98248789 CCATATGTTAGGTAAAAAGCAGG - Intergenic
1089191179 11:116654339-116654361 CCATTTGCTATAACAGCAGCAGG + Intergenic
1092658916 12:10718044-10718066 ACATTTGCTATGTGAGGAGAGGG - Intronic
1094354112 12:29559297-29559319 CTGTTTGCTCTGTAAGCAGCCGG + Intronic
1096593452 12:52677951-52677973 CCACTTACTATGTAAGGTGCTGG + Intronic
1096690842 12:53320944-53320966 GCGTTTGCTATGTAAGAAAGAGG - Intronic
1098509330 12:71292985-71293007 CCATTTGCTATGTAAGAAGCTGG + Intronic
1098922328 12:76313845-76313867 CCATTTCCTAAATAAGAAGCTGG - Intergenic
1104761040 12:131297670-131297692 ACATTTGCTCTGTAAGGAGGGGG + Intergenic
1104818738 12:131663122-131663144 ACATTTGCTCTGTAAGGAGGGGG - Intergenic
1104832238 12:131761301-131761323 CTATTTGCTATGGAAGATGGCGG + Intronic
1104987909 12:132607434-132607456 CCATTCGTTATGTAAGATGAAGG + Intronic
1106363079 13:29050403-29050425 TCACTTGCTTTGTAAGAACCAGG - Intronic
1114734478 14:25030054-25030076 CCATTTTACATATAAGAAGCTGG + Intronic
1115140326 14:30163616-30163638 CCATTTTCTAGGGATGAAGCAGG - Intronic
1116363262 14:44028407-44028429 ACATTTACTATGTCAGAAGGTGG - Intergenic
1118359297 14:65042649-65042671 CCATTTGCTTTGGGAGAAGTAGG + Intronic
1118477903 14:66135406-66135428 CCATTTGCTAAGCAGGTAGCAGG + Intergenic
1121478196 14:94234183-94234205 TCATTTGGTATTTAATAAGCAGG - Intronic
1121946751 14:98130466-98130488 CCACTTGCTATGTAAAATGGGGG - Intergenic
1123632876 15:22274265-22274287 CCTTGTGCAGTGTAAGAAGCTGG + Intergenic
1125143332 15:36436113-36436135 CACTGTGCTATGTAAGAAGGAGG - Intergenic
1127758438 15:62114750-62114772 CTATCTGCTCTGTAAAAAGCAGG + Intergenic
1127817168 15:62621143-62621165 CAAGGTGCTATATAAGAAGCAGG - Intronic
1128821469 15:70659240-70659262 CCATTTCCTATAGAAGAGGCAGG + Intronic
1133482449 16:6184187-6184209 CCATATGTTATGGGAGAAGCCGG - Intronic
1135071475 16:19355832-19355854 ACCTTTTCTATGTAAGAATCAGG - Intergenic
1135923578 16:26672826-26672848 CAATGTGCTTTGGAAGAAGCTGG + Intergenic
1137365558 16:47856422-47856444 ACCTTTGCCATGTAAGAATCTGG + Intergenic
1138368550 16:56504345-56504367 TCATTTGCTAACTAAGAAGCAGG + Intronic
1139146188 16:64328128-64328150 CCATTTACTGTGTAATAGGCAGG - Intergenic
1139507191 16:67404709-67404731 CCATTTCCTAATGAAGAAGCTGG - Intronic
1141045507 16:80712898-80712920 ACATTTGCTATCAAGGAAGCTGG - Intronic
1141970185 16:87476502-87476524 CCTTGTGCAGTGTAAGAAGCTGG - Intronic
1142990808 17:3729586-3729608 GCACTTGCTATGTACAAAGCAGG - Intronic
1143882792 17:10042633-10042655 CCAAATGCTATGTGATAAGCTGG + Intronic
1144818548 17:18054419-18054441 CCATTTGCTATTTAAGCAGCAGG - Intronic
1145275200 17:21424985-21425007 CCTGTTGCCATGTAGGAAGCAGG + Intergenic
1145313055 17:21710882-21710904 CCTGTTGCCATGTAGGAAGCAGG + Intergenic
1145400430 17:22527651-22527673 GCATCTGCTATGATAGAAGCTGG + Intergenic
1145711476 17:26982688-26982710 CCTGTTGCCATGTAGGAAGCAGG + Intergenic
1145827619 17:27889013-27889035 CCTTTTCCAATGTAAGCAGCGGG + Intronic
1150359284 17:64516651-64516673 ACTTTTTCTATGTAAGAGGCAGG - Intronic
1153137959 18:1939760-1939782 CCATTTGCCATGAATGAACCTGG - Intergenic
1153390972 18:4559130-4559152 CTCTTTGCCATGTAAGAAGGTGG - Intergenic
1155055842 18:22182766-22182788 CCACTTGCTATGAAAAAAGAGGG + Exonic
1155885595 18:31204801-31204823 CCATTTTCTTTCTGAGAAGCTGG + Intergenic
1161804753 19:6436461-6436483 ACATTTGCTCTGGAGGAAGCCGG - Intronic
1168719674 19:58548159-58548181 CCTTTTGCTTTCTAAGAAGTTGG + Exonic
926030866 2:9586891-9586913 CAATTGCCTATCTAAGAAGCAGG + Intronic
929306608 2:40370371-40370393 GCCTTTGCTATATAAGAAGTTGG - Intronic
932594000 2:73083085-73083107 ACATTTCCTGTGCAAGAAGCTGG - Intronic
932760305 2:74435243-74435265 CCCATTGCTTTTTAAGAAGCAGG - Intronic
933272374 2:80246951-80246973 CCATTTGGAATGTAAGATCCTGG - Intronic
938936008 2:136128019-136128041 CCATTAACTATGTATGTAGCAGG + Intergenic
938955442 2:136293629-136293651 CCATATACTATGTCAGATGCTGG + Intergenic
943857253 2:192812999-192813021 CCATTTGCTGAGTTAGGAGCAGG + Intergenic
943870029 2:192982945-192982967 CAATTTGCTATGTAAAAACTTGG + Intergenic
945280007 2:208027032-208027054 CTCTTTGCTCTTTAAGAAGCAGG + Intergenic
947027530 2:225753550-225753572 CCATTTGAAGTGGAAGAAGCAGG - Intergenic
948181297 2:235983096-235983118 CCATTTGCTGAGCAGGAAGCTGG + Intronic
948353841 2:237361601-237361623 CCATTTCTTATGTTAGAAGGAGG - Intronic
1170746105 20:19100258-19100280 CCATTTGCTAAGGAAGAACTGGG + Intergenic
1171785190 20:29457554-29457576 CCATTTGCTTAGCAGGAAGCAGG + Intergenic
1173380222 20:42533143-42533165 CCATTTGCTTAGTAAACAGCGGG + Intronic
1173609222 20:44354596-44354618 CAATTAGCTATTTTAGAAGCAGG + Intergenic
1175623347 20:60469318-60469340 CCATTTGCTTTATAAGAAAGGGG + Intergenic
1179016554 21:37598581-37598603 CCATTTGCTGGGGAAGGAGCAGG - Intergenic
1182048030 22:27291461-27291483 CCATATACTCTGTAAGGAGCCGG - Intergenic
950394175 3:12721012-12721034 CTAAGTGCTATGTAAGAAGAGGG - Intergenic
950874245 3:16255746-16255768 CAATTTGCTAGGTAAAAAGCAGG + Intergenic
952072722 3:29658268-29658290 TCTTTTGCTCTGTAAGAAGATGG - Intronic
952815965 3:37448364-37448386 CCATTTGTTATAGCAGAAGCAGG - Intergenic
957591087 3:82198837-82198859 CCATTTACTTTGAGAGAAGCTGG - Intergenic
958982795 3:100743616-100743638 ACATTTGCTAGGAAATAAGCTGG + Intronic
966350236 3:179026255-179026277 CCATCTGAAATGAAAGAAGCTGG - Intronic
967900789 3:194449806-194449828 CCATTTGATGTGTAAAAAGTGGG - Intronic
973728381 4:53799263-53799285 GCATCTTCTATGTAATAAGCAGG - Intronic
980272831 4:130608939-130608961 CCAGTTTGTATGTAAGAATCAGG - Intergenic
980538578 4:134163105-134163127 CCATTAGCTATAGAAGAACCAGG + Intergenic
987566841 5:19600047-19600069 CACTTTGCTATGGATGAAGCTGG + Intronic
987707913 5:21478900-21478922 CCATTTCCAATCTAGGAAGCAGG - Intergenic
988751869 5:34196037-34196059 CCATTTCCAATCTAGGAAGCAGG + Intergenic
989066434 5:37467332-37467354 CCATTTCCAATCTAGGAAGCAGG - Intronic
991711081 5:69409226-69409248 CCCTCTGCTATGTAACAAGCTGG + Intronic
991737198 5:69638822-69638844 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991739635 5:69656854-69656876 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991757867 5:69896323-69896345 CCATTTCCAATCTAGGAAGCAGG - Intergenic
991788772 5:70218548-70218570 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991791210 5:70236595-70236617 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991813523 5:70493654-70493676 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991816655 5:70514937-70514959 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991819095 5:70532978-70533000 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991837270 5:70772205-70772227 CCATTTCCAATCTAGGAAGCAGG - Intergenic
991881219 5:71218912-71218934 CCATTTCCAATCTAGGAAGCAGG + Intergenic
991883656 5:71236936-71236958 CCATTTCCAATCTAGGAAGCAGG + Intergenic
994201086 5:96977003-96977025 CCATCTACTATGAAAGAAGAAGG - Intronic
994487229 5:100395264-100395286 CCATTTCCAATCTAGGAAGCAGG + Intergenic
994651869 5:102539237-102539259 CCATTTCATAGGTAAAAAGCAGG - Intergenic
1001335622 5:170794417-170794439 CCATTTGGAATGGCAGAAGCTGG + Intronic
1001871374 5:175158945-175158967 CTATGTGCTAGGTCAGAAGCGGG + Intergenic
1005550032 6:26902740-26902762 CCATTTCCAATCTAGGAAGCAGG + Intergenic
1005584433 6:27261815-27261837 CAATTTTCTATGTATGAAGATGG - Intergenic
1007010724 6:38415064-38415086 CCATTTGCTACGTTAGAAAGGGG - Intronic
1007185064 6:39963715-39963737 CTATTTGCTATCTAAAATGCAGG + Intergenic
1009249291 6:61277645-61277667 CCAGTTGCTATAAAAGAAACAGG + Intergenic
1009492033 6:64303181-64303203 GCAGTTGCAATGTTAGAAGCCGG - Intronic
1010873139 6:81066313-81066335 CCATTTGCTTTGTAAAAATTAGG + Intergenic
1014766548 6:125413166-125413188 CCATTTGCAAGATTAGAAGCAGG - Intergenic
1016208808 6:141504087-141504109 CCATTTCCTATGGAAAAAGAAGG - Intergenic
1019666890 7:2256481-2256503 CCATCTGCTCTGGAGGAAGCCGG + Intronic
1021061863 7:16122790-16122812 CTAATTGGTATGGAAGAAGCCGG + Intronic
1028418787 7:90609562-90609584 GCTTCTGCCATGTAAGAAGCTGG + Intronic
1029923572 7:104292138-104292160 CCATTTTCTATTTAAGCAACAGG + Intergenic
1032457524 7:132084788-132084810 CCATCTGCTAGGTAAAAAGGTGG - Intergenic
1035413460 7:158665150-158665172 CCATCTCCTATCTAAGAGGCTGG + Intronic
1039122026 8:34157980-34158002 CCATTTGATATGGGAGAAACTGG - Intergenic
1043126844 8:76407805-76407827 TCATTTGCTTTCTAAGCAGCAGG + Intergenic
1047157589 8:122338127-122338149 AGGTTTGCTATGTAAGATGCGGG + Intergenic
1048636029 8:136296259-136296281 GCCTTTACTGTGTAAGAAGCAGG - Intergenic
1049335397 8:142081887-142081909 CTATTTTCTCTGTAGGAAGCTGG - Intergenic
1050056937 9:1665652-1665674 CCTGTTGCCATATAAGAAGCTGG - Intergenic
1050565281 9:6875776-6875798 GCATTTTCCATGTAAGTAGCGGG - Intronic
1050821758 9:9888152-9888174 CCATTTGCTATGTGGGAAGATGG - Intronic
1052391564 9:27884344-27884366 TCATTAGATATGCAAGAAGCAGG + Intergenic
1054852591 9:69863993-69864015 GTATTTGCTGTGTGAGAAGCAGG + Intronic
1054856247 9:69902428-69902450 CTATTTTGTATGTTAGAAGCTGG + Intronic
1056712886 9:89005444-89005466 CCACTTGCTATGTAAAGAGGAGG + Intergenic
1057808039 9:98234743-98234765 CCATTTGCTCTTTTGGAAGCAGG + Intronic
1059020872 9:110575154-110575176 CCATTTGTAATCTAACAAGCAGG - Intronic
1060288360 9:122275736-122275758 CCATTTGCCATGGATGAACCCGG - Intronic
1061225218 9:129277312-129277334 CCATTTGCTGTGGGAGGAGCAGG - Intergenic
1195625732 X:107004347-107004369 ACATTTGCTATGTCAAAATCGGG + Intergenic
1197080758 X:122412607-122412629 CTATTTGCTTTGTACTAAGCTGG + Intergenic
1197562331 X:128038495-128038517 CCTTTTGTTATATAAGAAGAGGG - Intergenic
1198967061 X:142238257-142238279 CCAGTGGCTTTGTAAGAAGAGGG - Intergenic
1199475111 X:148236393-148236415 CCATATGCTGTGTAAGAACAGGG + Intergenic
1201381049 Y:13379352-13379374 CAATTTGGCATTTAAGAAGCTGG + Intronic
1201788561 Y:17811471-17811493 ACATTTGCTATATAACAAGTGGG + Intergenic
1201812992 Y:18094517-18094539 ACATTTGCTATATAACAAGTGGG - Intergenic