ID: 1098512635

View in Genome Browser
Species Human (GRCh38)
Location 12:71335899-71335921
Sequence TTGGACTAACTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098512635_1098512641 26 Left 1098512635 12:71335899-71335921 CCTGTTTTTCCCAGTTAGTCCAA 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1098512641 12:71335948-71335970 CTATCTTTTTTTGGTATTTCTGG 0: 1
1: 0
2: 1
3: 74
4: 694
1098512635_1098512639 -4 Left 1098512635 12:71335899-71335921 CCTGTTTTTCCCAGTTAGTCCAA 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1098512639 12:71335918-71335940 CCAAGAGATTACTCATTACATGG 0: 1
1: 0
2: 0
3: 6
4: 99
1098512635_1098512640 17 Left 1098512635 12:71335899-71335921 CCTGTTTTTCCCAGTTAGTCCAA 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1098512640 12:71335939-71335961 GGTTTTTAACTATCTTTTTTTGG 0: 1
1: 0
2: 4
3: 66
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098512635 Original CRISPR TTGGACTAACTGGGAAAAAC AGG (reversed) Intronic
905697257 1:39983998-39984020 ATGAACTAATTGGAAAAAACTGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
910740638 1:90512196-90512218 TTGGAAAAACTGAGGAAAACAGG + Intergenic
911439079 1:97902459-97902481 TTGGATTTACTGGGTAAAACTGG + Intronic
914401931 1:147329259-147329281 TTGGACTGTCTTGGCAAAACGGG - Intergenic
915717610 1:157959316-157959338 TTGGACTAACAGAAAAAAATGGG - Intergenic
919187820 1:194176735-194176757 TTGTAATAACTGTGAGAAACAGG + Intergenic
921519395 1:216141030-216141052 TGTGACTAACTGGAAAAAATGGG + Intronic
921830079 1:219718314-219718336 TTGTACTTAGTGGGAGAAACAGG - Intronic
923662721 1:235972351-235972373 TTGATTTAACAGGGAAAAACAGG - Intergenic
923693992 1:236228291-236228313 TTCCACAAACTGTGAAAAACAGG + Intronic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063410263 10:5831834-5831856 CTGGAGTAGCTGGGAATAACAGG + Intronic
1065604527 10:27403821-27403843 TTGTACTAACTTTGAAATACAGG - Intronic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1070689336 10:78512903-78512925 CTGGGCTAACTGGGAAAAGCGGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078252360 11:9626779-9626801 TTGGAATAACTGCGAGAAACTGG + Intergenic
1079782002 11:24618773-24618795 TTGTATTTACTGGGAGAAACAGG + Intronic
1079981387 11:27154710-27154732 TTGGCCTAACTGGCTAAACCAGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1086187971 11:84042193-84042215 TTTGATTAAGTGGGAAAAAATGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1090942243 11:131397034-131397056 CAGGAATAACTGGGAAAAAGTGG + Intronic
1092841328 12:12544537-12544559 TTGGAATAACTGTGGAAAACTGG - Intronic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1096579939 12:52578467-52578489 TTGGACTAGCATGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1100870262 12:98903423-98903445 TTGGAACTACTGGGAAAAAGGGG + Intronic
1100995645 12:100298056-100298078 TTGGCTAAACTGGCAAAAACTGG - Exonic
1103480476 12:121247178-121247200 TTGGACCCACTGGGAAGAAGTGG - Intronic
1104812721 12:131628404-131628426 TTGTCCTTCCTGGGAAAAACAGG + Intergenic
1105673702 13:22647501-22647523 TTGGACTAAATCAGAAAAAGAGG - Intergenic
1105674370 13:22654528-22654550 TTTGACTGACAGGGAAAATCGGG - Intergenic
1106123969 13:26885034-26885056 TTTGGCTAACTGGGATAAAGAGG - Intergenic
1107077306 13:36336936-36336958 ATGAATTAAATGGGAAAAACTGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108020169 13:46120169-46120191 TTAAACTAACTGGCAAAAGCAGG + Intergenic
1108664542 13:52616851-52616873 CTGGAGTAACTGGAAGAAACAGG - Intergenic
1109992786 13:70081129-70081151 TTGAACAAACTGGGACAAATTGG - Intronic
1110421014 13:75308666-75308688 TTGAACTAACTCAGAAAAAGAGG - Intronic
1111568069 13:90042611-90042633 TTGGGGTAACTGGGTAAAAAAGG + Intergenic
1112476261 13:99733609-99733631 TTGGACTAATTTGGAAAATATGG + Intronic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1115250287 14:31338717-31338739 TTGGCATATGTGGGAAAAACAGG + Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1123186411 14:106521454-106521476 AGGGAACAACTGGGAAAAACAGG + Intergenic
1123755552 15:23395113-23395135 TGGGGCTAACTAGGAAAAAATGG + Intergenic
1127432413 15:58923423-58923445 TTGGCCCAACTGGGAGAAAGGGG + Intronic
1127546471 15:59997944-59997966 TTCCAATAAGTGGGAAAAACGGG - Intergenic
1127734254 15:61827389-61827411 TTGGACAAACTGGGACAAGTTGG - Intergenic
1130142902 15:81245930-81245952 TTGTACTTACTGGGAGAAATAGG + Intronic
1131495601 15:92908100-92908122 TCAGACTAACTGGCAAAAGCCGG - Intronic
1132164947 15:99577343-99577365 TTGAAATAACTGGTAACAACTGG + Intronic
1132416326 15:101622015-101622037 TTGGAATAACTGGGAAACTCAGG + Intronic
1132427515 15:101730994-101731016 ATGGACTAAATGGCAAACACAGG + Intergenic
1133477959 16:6141565-6141587 TTGGACAAGCAGGGAAAGACAGG - Intronic
1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG + Exonic
1144216693 17:13061865-13061887 TTCAACAAATTGGGAAAAACTGG - Intergenic
1150948260 17:69771834-69771856 TTGTACTGAATGGGCAAAACTGG + Intergenic
1151206309 17:72510320-72510342 TTAGGATAACTGGGAAAAAAAGG + Intergenic
1153067051 18:1057989-1058011 TTGGACCACCTGGAAAAAAATGG - Intergenic
1155538842 18:26845561-26845583 TTGGAGAGACTGGGACAAACTGG - Intergenic
1156569370 18:38235560-38235582 TTGGACTACCGGGGAAATGCAGG - Intergenic
1157659227 18:49424439-49424461 TTGTACTGACTGGCAAAAACTGG + Intronic
1157839678 18:50945021-50945043 TTGTACTAAACAGGAAAAACAGG - Intronic
1158085408 18:53645247-53645269 TTGTGCTAAGTGGGATAAACAGG - Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1158593038 18:58793329-58793351 AGGGACTAACTTGGAAAATCTGG - Intergenic
1164759145 19:30715243-30715265 TTGAGCCAACAGGGAAAAACTGG - Intergenic
1165154476 19:33778782-33778804 TTGAAATAAATGGGAAGAACCGG + Intergenic
1165834469 19:38745689-38745711 TTGGAGGAAATGGGAGAAACAGG + Intronic
1166231295 19:41427042-41427064 TTGGACGGAGTGGGAAGAACAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926368455 2:12155628-12155650 TTGGACAAAATGGGAAACATAGG - Intergenic
929948650 2:46389477-46389499 TTGGACTGGCTGGGAAAACTGGG - Intergenic
929969478 2:46561746-46561768 TAGGGCTAAATGGGATAAACGGG - Intronic
930207497 2:48602636-48602658 TGGGACTAACTGGGATCACCTGG + Intronic
931826411 2:66004943-66004965 TTTGATTAACTGGGAGACACCGG - Intergenic
931837643 2:66115940-66115962 CTGAAGTAAATGGGAAAAACTGG - Intergenic
932152330 2:69384862-69384884 TTAGACTAGATGGGAAAATCTGG - Intronic
933180726 2:79223487-79223509 TTCGTCTAACTGGGAAAACATGG - Intronic
933216241 2:79633684-79633706 TTTGACTAGCTGGGAAACAGAGG - Intronic
936918152 2:117661128-117661150 TTGGAATCACTGGGAAATAGTGG + Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
939776482 2:146393439-146393461 TTGTTCTTCCTGGGAAAAACAGG + Intergenic
940249183 2:151655403-151655425 TTTGAATAACTGGGACAAGCAGG + Intronic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941731795 2:168925972-168925994 TTGGGCTAACAGGTAAGAACTGG + Intronic
944719501 2:202408792-202408814 TTGAACTATCTTGGAAACACAGG + Intronic
945194135 2:207222422-207222444 TTGGGCTAACTGGCAACAAATGG + Intergenic
945624563 2:212186140-212186162 TTCGACTAAATGAGAAAGACAGG + Intronic
946457677 2:219841145-219841167 TGGCACTAACTGGGACTAACTGG + Intergenic
948391077 2:237611939-237611961 ATGGAATAACGGAGAAAAACAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1170864743 20:20143245-20143267 TTAAACTCACTGGGAAATACAGG + Intronic
1173045492 20:39505456-39505478 TTGTGCTTACTGGGAAGAACAGG - Intergenic
1175144849 20:56887783-56887805 TTGGTCTAACTGGGTATAAATGG + Intergenic
1176037534 20:63047163-63047185 TATGACCCACTGGGAAAAACTGG - Intergenic
1177959854 21:27649874-27649896 CTGGACAAACTTGGAAAGACAGG + Intergenic
1178242121 21:30914909-30914931 TTGGGCTAATTGGAAAAAAGAGG + Intergenic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1178729741 21:35090319-35090341 TAGGAATAACTCAGAAAAACTGG - Intronic
1182269698 22:29145632-29145654 CTGGACAAACGGGGAAGAACAGG - Intronic
1183914075 22:41102632-41102654 TGGGAAGAACAGGGAAAAACAGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951298432 3:20968232-20968254 ATGGAATAACGGAGAAAAACAGG + Intergenic
954628193 3:52034395-52034417 TTGGACTTACAGGGAACAAAGGG + Intergenic
956547797 3:70425143-70425165 TTGGAGAAACTGGGAAACAGTGG - Intergenic
957284262 3:78197272-78197294 TTGGACTCAAAGGGAAACACGGG - Intergenic
957551014 3:81704700-81704722 GTGGAATAACTGGAAAAAATAGG - Intronic
957570855 3:81946160-81946182 TTGGAAGGTCTGGGAAAAACTGG + Intergenic
959553162 3:107687245-107687267 TTGCATAAACTGGGAAAAACAGG + Intronic
960728833 3:120701846-120701868 TTGCATTCACTGGGAAAGACAGG - Intronic
961191804 3:124968405-124968427 TTGTTCTAACTGAGAAAAAAAGG - Exonic
961377679 3:126477068-126477090 CTGGATGAACTGGGAAAAAGAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962493573 3:135917684-135917706 TTGGTCAAACTGAGCAAAACTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966952241 3:184831809-184831831 TTGCACTATCAAGGAAAAACGGG - Intronic
967613916 3:191542083-191542105 ATGAACTAACTCCGAAAAACAGG - Intergenic
971272861 4:25167109-25167131 TTTGAGGAACTGGGAAAAACAGG - Intronic
971989137 4:33868275-33868297 TTGTACTGAATGGGAAAAGCTGG + Intergenic
973909264 4:55563222-55563244 TTGGATAAACTGGGAGAAAAGGG - Intronic
974929017 4:68339407-68339429 TTGGACATAATTGGAAAAACTGG + Intronic
975763251 4:77638499-77638521 TTGGATTACCTGGAAAAAAGTGG - Intergenic
976073458 4:81270285-81270307 TTGGACTAACAGAGATGAACTGG + Intergenic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
977227639 4:94412180-94412202 TTGCAGTAACTGAGGAAAACAGG - Intergenic
977986558 4:103389419-103389441 TTGTACTGAATGGGCAAAACTGG + Intergenic
978602479 4:110443371-110443393 TTGGAGTCACAGGGAAAAGCTGG + Intronic
978946906 4:114510527-114510549 CTGGACTAACTTGGAGAAAGAGG + Intergenic
981216132 4:142170751-142170773 TTGGAATTCCTGGGAAGAACAGG + Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983029254 4:162778965-162778987 TTGGACTAACTTGGAAACTTGGG + Intergenic
983346140 4:166527171-166527193 CTGGAAAAACTGAGAAAAACTGG + Intergenic
985372980 4:189307019-189307041 TTAGCCTAACTGAGAAAAAAAGG + Intergenic
987924278 5:24319940-24319962 TTGAATTAACTGGCAAAAAAAGG - Intergenic
988012849 5:25512733-25512755 TTATACTAAATGGGAAAAAGTGG - Intergenic
988162538 5:27539367-27539389 TAGAACAAACTGGGAAGAACTGG - Intergenic
989042661 5:37245431-37245453 TTGGTTTAACTAGGAAAAATAGG - Intronic
989144184 5:38232362-38232384 TTGGACCAACTCTGCAAAACTGG + Intergenic
989268516 5:39504923-39504945 TGGGAATAACTGGGAAATGCAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990680418 5:58236817-58236839 TTGGATGTACTGGGAAAAGCTGG + Intergenic
991057029 5:62332670-62332692 GTAGACTAAATGGGAAAAAATGG + Intronic
991341763 5:65619354-65619376 TTGGTCCAACAGGGAAAGACGGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993278986 5:85900330-85900352 TTGGAGCAAATGGGGAAAACTGG - Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
1000523674 5:162328779-162328801 TAGGAGTAACTGAGAAAGACGGG + Intergenic
1000713617 5:164611676-164611698 CTGGAATAACTGTGAAAAAGTGG - Intergenic
1006357607 6:33569457-33569479 ATGGACTAACAGGCAAAAACTGG - Intergenic
1007478809 6:42136722-42136744 TGGGACTTGCTGGGAAAGACTGG - Intronic
1008481448 6:51990073-51990095 TTGGACTAAATGAGAAAAAAAGG - Intronic
1010352667 6:74893426-74893448 CTGGTCTAAATGGGAAAAAAAGG + Intergenic
1013219040 6:108060368-108060390 TTCAACTAACTGGGGAAAAAAGG + Intronic
1013714828 6:112946358-112946380 TTGGACTAACTTAGAAAACTGGG - Intergenic
1013784387 6:113763722-113763744 TTGCACTTAGTTGGAAAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030861260 7:114632817-114632839 TTAGAATAACTCAGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031392821 7:121237029-121237051 ATGGATTAACTGGGCAAAAAGGG - Intronic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032906422 7:136372719-136372741 TGGGACTATCTGGGAAAACAGGG - Intergenic
1037596395 8:20357905-20357927 TTGGACTGAATGGGTAATACAGG - Intergenic
1039790466 8:40871958-40871980 TTAGACTTTCAGGGAAAAACAGG + Intronic
1040691661 8:49945999-49946021 TTTTACTAACTAGGAAAACCAGG + Intronic
1040716842 8:50265355-50265377 TTGGAATAACTGGAAACCACCGG + Intronic
1041040449 8:53841307-53841329 TTGGAATAAGTGGGAAACATAGG - Intronic
1043524785 8:81084214-81084236 TTGTACTTAGTGGGAAGAACAGG + Intronic
1045404774 8:101854932-101854954 TTGGTCCAACTGGGGAAGACTGG + Intronic
1046853597 8:119004011-119004033 TAGGACTTACTGGGAAAACCAGG + Intronic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1048369527 8:133765645-133765667 TAGGACTCACTGGGACATACAGG - Intergenic
1048643048 8:136385979-136386001 CTGGACTAATAGGGAAAAATGGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050435649 9:5607094-5607116 TAGGTCAAATTGGGAAAAACTGG - Intergenic
1050854276 9:10331641-10331663 TTGGACTAACAAGCAAAAATGGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1054222203 9:62423617-62423639 TTGCACTAACAGGAAAAAGCAGG + Intergenic
1054228510 9:62485555-62485577 TTGCACTAACAGGAAAAAGCAGG - Intergenic
1055245395 9:74235474-74235496 TTGGATTAATTGGGTAAAAGTGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056267692 9:84915695-84915717 TTGTACTTAGTGGGAAAAATTGG + Intronic
1056474575 9:86941421-86941443 TTTGAGTAGCTGGGAGAAACAGG + Intergenic
1057201860 9:93144848-93144870 TTGTACAAGCTGGGAAAGACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058749475 9:108025202-108025224 CTTGGCTAACTGGGAAAAAAAGG - Intergenic
1059488431 9:114645614-114645636 TAGGACTGACTGAGAAATACGGG - Intronic
1059947271 9:119422885-119422907 TTGGAATAACTTGGGAAACCAGG - Intergenic
1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG + Intronic
1189447167 X:41091237-41091259 TTGGGCTCACTGGAGAAAACTGG - Intronic
1189573073 X:42320414-42320436 TTGGACTGTCTTGCAAAAACTGG + Intergenic
1189698837 X:43695343-43695365 TTTTAAAAACTGGGAAAAACTGG + Intronic
1189698838 X:43695353-43695375 TGGGAAAAACTGGAAAAAACTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193075871 X:77355159-77355181 TTGGACGAAAAGGGAAAAAAGGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194780072 X:98013367-98013389 TTGGACTAACAGGAGAAAATAGG - Intergenic
1199675119 X:150182190-150182212 TTGCAATTACTGGGAAGAACTGG - Intergenic
1201675275 Y:16574999-16575021 TTGGAGAAACAGGGAAAAATGGG + Intergenic