ID: 1098514162

View in Genome Browser
Species Human (GRCh38)
Location 12:71354389-71354411
Sequence GCCACAGTGCAGAAAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098514162 Original CRISPR GCCACAGTGCAGAAAGGGCA GGG Intronic
900379216 1:2375556-2375578 GCCACAGTACATGAAGGGCTGGG + Intronic
900484458 1:2914849-2914871 GCCACTGTGTACAAAGGGCTGGG - Intergenic
900819112 1:4872595-4872617 GCCTCTGTGCAGAGAGGGCGGGG - Intergenic
900847287 1:5114076-5114098 GCCACATGGCAGAAAGTGAAAGG + Intergenic
900956346 1:5888329-5888351 GCACCAGAGCAGAGAGGGCACGG - Intronic
901413375 1:9100592-9100614 ACCAAAGTTCAGAAAGTGCATGG + Exonic
902649489 1:17827193-17827215 GCCACTGAGCAGAATAGGCAAGG + Intergenic
902918661 1:19653688-19653710 GGCACAGCCGAGAAAGGGCATGG - Intronic
903222975 1:21879076-21879098 GCCACAGTGCAACAAGTGCAAGG - Exonic
904284787 1:29446905-29446927 GCCACTGTGCTGCAAGGCCAGGG + Intergenic
904462015 1:30685907-30685929 GCCCCAGAGAAGACAGGGCAGGG - Intergenic
905813977 1:40933639-40933661 GCCAGAGTGGCAAAAGGGCAGGG + Intergenic
906185623 1:43860005-43860027 GCCACAGGGCAGGAAGAGAAGGG - Intronic
908960881 1:69695675-69695697 GGCACAGGGCAGCAAGGGCCTGG - Intronic
909538201 1:76761799-76761821 GCTACATGGTAGAAAGGGCAAGG - Intergenic
911003344 1:93190970-93190992 GACACAGTACAAGAAGGGCAAGG - Intronic
911522014 1:98940639-98940661 GGCAAAGTGCAGAATGGACAAGG + Intronic
912696774 1:111847992-111848014 GCCACTGTGCAGTCAAGGCAGGG + Intronic
913497126 1:119438694-119438716 GCCACAGTGCACAAAGCTCCAGG + Intergenic
914690992 1:150026822-150026844 GCCAATCTGCAGAAAGGGTAAGG - Intergenic
916064428 1:161124518-161124540 CCCACCGTACTGAAAGGGCAGGG + Exonic
916244444 1:162673254-162673276 GCCCCAGTTCAGAAAGGGTATGG + Intronic
916786183 1:168088735-168088757 GACACAGCGAACAAAGGGCAGGG + Intronic
917629035 1:176875112-176875134 TCCTCAGGGCAGAAAGGGCCAGG - Intronic
917751796 1:178060096-178060118 GCATCAGTGGAGAAAGGGAAGGG + Intergenic
917908425 1:179613649-179613671 CCCACAATGCAAAAGGGGCAAGG + Intronic
919767113 1:201134600-201134622 GCCACAGTGCAATCAGGCCAAGG - Intergenic
920123133 1:203673621-203673643 GTCAGAGTGGAGAAAGGGAATGG + Intronic
920336533 1:205248943-205248965 GCCACACTGCAGGAGGGGAAGGG - Intronic
921656990 1:217751500-217751522 GTCTCTGTGCAGAAAGGCCAAGG + Intronic
923333390 1:232946417-232946439 GCCACAGAGTAGTAAGGCCATGG - Intergenic
923599325 1:235388258-235388280 GTAACAGAGAAGAAAGGGCATGG - Intronic
924086168 1:240454146-240454168 TCCACAGTGAAGAAAGCACAGGG - Intronic
1063942805 10:11147964-11147986 GCCACAGGGCAGAATGAGGAAGG + Intronic
1065122898 10:22545386-22545408 GCCAAAGGGCAGAGAGGGAAGGG + Intronic
1065159039 10:22900193-22900215 ACCACAGTACAGACAGGGCAGGG - Intergenic
1066037891 10:31512148-31512170 GCCACAGTGTAGACAAGGCTTGG + Intronic
1067015617 10:42754896-42754918 GCCCCAGTGGGGAAGGGGCAAGG - Intergenic
1067200987 10:44171942-44171964 GCCACAATGCAGGCAGCGCAAGG + Intergenic
1067465919 10:46498712-46498734 CCCACAGTGCAGAAAGGGACTGG - Intergenic
1067621268 10:47885894-47885916 CCCACAGTGCAGAAAGGGACTGG + Intergenic
1067776056 10:49165663-49165685 GCCAGAGTGCAGAGAAGGCTGGG + Intronic
1070334826 10:75446027-75446049 GCAGCAGGGGAGAAAGGGCAAGG - Intronic
1070592885 10:77812906-77812928 GCCCCAGGGCAGCAAGTGCATGG - Intronic
1071707115 10:88011288-88011310 CTCACAGAGCAGAAAGGGCAAGG + Intergenic
1072633433 10:97162938-97162960 GCCACAGTACAGAAATGGGAAGG - Intronic
1072727538 10:97823847-97823869 GCCACTGGGCAGAGAAGGCAGGG + Intergenic
1073476828 10:103759193-103759215 GCCACAGTGCAGAGGGTGCTGGG - Intronic
1074436160 10:113436239-113436261 ACCACAGTGCAGTCAGGTCAAGG - Intergenic
1075554863 10:123423052-123423074 GCCAAAGTGCACAAAGAACAGGG + Intergenic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1076421349 10:130334704-130334726 GACACAAAGCAGAGAGGGCAGGG - Intergenic
1077957604 11:7037833-7037855 GCCAGAGAGCAGTAAGGTCATGG + Intronic
1078070731 11:8107836-8107858 GCCACAGTGCCAAAAGGCCAGGG + Intronic
1078071027 11:8110597-8110619 AACACAGTGAAGAAAGTGCAGGG + Exonic
1079029402 11:16974923-16974945 GACACAGTACAAGAAGGGCAAGG - Intronic
1079735658 11:23994118-23994140 GCCTGAGGGCAGCAAGGGCAGGG - Intergenic
1079882589 11:25945049-25945071 GCCTCAGAGCAGCAGGGGCAAGG - Intergenic
1079925207 11:26484828-26484850 GCCACACTGATGAAAGGGCTTGG - Intronic
1080308887 11:30866937-30866959 CCCACAGGGCAGAAAGTGGAAGG - Intronic
1080987187 11:37482948-37482970 CTCACAGTGTGGAAAGGGCAAGG - Intergenic
1081643447 11:44774018-44774040 GCTACACTGCTGAAAGGGAAAGG - Intronic
1081802426 11:45869311-45869333 GGCACAGTGCAGGCAGGGCCTGG + Intronic
1083192498 11:61062364-61062386 GTCACAGAGAGGAAAGGGCATGG + Intergenic
1083354992 11:62059629-62059651 GCCACAGTACAGGTCGGGCACGG - Intergenic
1083775143 11:64890975-64890997 GCCACAGGGCAGGCAGGGCAGGG + Intergenic
1084666214 11:70577697-70577719 GGTACAGTGCAGCCAGGGCAGGG - Intronic
1084780174 11:71402881-71402903 GCCACAGTGCAGTGACGTCATGG + Intergenic
1085506706 11:77064978-77065000 GCCACAGATCAGCACGGGCATGG + Intergenic
1085750898 11:79160360-79160382 GCAACCGTGCAGAATGGGCAAGG + Intronic
1086753538 11:90529737-90529759 GCCACAGTGGGGCAGGGGCAGGG - Intergenic
1087382681 11:97426928-97426950 GCCACAGAATAGAAAGTGCATGG - Intergenic
1087813201 11:102630900-102630922 GCCACAGTGCAGCAAAGGCTTGG + Intergenic
1088933628 11:114377429-114377451 GCCAATTTGCAGAGAGGGCAGGG + Intergenic
1089329618 11:117680420-117680442 GCCACAGAGCAGAAAGTGTAGGG + Intronic
1090197349 11:124827969-124827991 GGCACAGTGAACAAAGTGCACGG + Intergenic
1091727502 12:2856025-2856047 GGCAGGGTGCAGAAAGGGGAAGG - Intronic
1092055745 12:5506826-5506848 GCAAAAGACCAGAAAGGGCAGGG - Intronic
1092563556 12:9641716-9641738 GCCAGAGTGCAGCAGGGCCACGG - Intergenic
1092950475 12:13498910-13498932 GTCAGACTGCAGAAACGGCAAGG - Intergenic
1093634858 12:21453424-21453446 AACACAGTGTAGAAAGGGTATGG - Intronic
1096088560 12:48883152-48883174 GCGACAGTGCATATAGGGGAGGG + Intergenic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1100806303 12:98287498-98287520 CCCACATGGCAGAAGGGGCAAGG - Intergenic
1102513472 12:113431083-113431105 CCCACAGTGGAGAAAAGGGAGGG + Intronic
1102576332 12:113858412-113858434 AGAACAGTGCAGAGAGGGCAGGG - Intronic
1103547422 12:121712326-121712348 GGCGCAGCGCAGAGAGGGCACGG - Intergenic
1106610001 13:31269783-31269805 CTCACATGGCAGAAAGGGCAAGG - Intronic
1107800623 13:44104870-44104892 GTCACAGTACACAAAGGACATGG + Intergenic
1109446033 13:62441610-62441632 CCCACAGTGCACAGAGGACAAGG + Intergenic
1109765373 13:66888671-66888693 GGCAAAGGGCAGAAAAGGCAGGG + Intronic
1112314004 13:98344874-98344896 GCCACACTGTAAAAAGGGCTGGG - Intronic
1113708334 13:112448066-112448088 GCCACAGTGCAGCGGGGGCGGGG - Intergenic
1113709081 13:112452400-112452422 GCCACAGGGCAGGAAGTGCAGGG + Intergenic
1114280906 14:21192041-21192063 GCCCCAGTTCAGAAGGGGCAGGG - Intergenic
1115019060 14:28652860-28652882 TCCACAATGGGGAAAGGGCATGG - Intergenic
1117436174 14:55717056-55717078 GCCACAGTGGAGAATGGGATTGG - Intergenic
1117533629 14:56683651-56683673 GACACAGTACAAGAAGGGCAAGG - Intronic
1117907859 14:60609279-60609301 GGCAGAGGGCAGAAAGGGAAAGG + Intergenic
1118120965 14:62841915-62841937 GCCACAGTCCAGAAATGAGAAGG - Intronic
1118703736 14:68460673-68460695 GCCACAGAACAGAAAGTGCTGGG - Intronic
1119175387 14:72564658-72564680 GCCAGGCTGCAGACAGGGCAGGG + Intronic
1121359552 14:93244077-93244099 GACACAGTAGAGGAAGGGCAAGG + Intronic
1121659412 14:95623949-95623971 CTCACATGGCAGAAAGGGCAAGG + Intergenic
1122099281 14:99394382-99394404 GCCTCAGTGCCTCAAGGGCAGGG + Intergenic
1122165869 14:99823315-99823337 GCCACAGTGCGGCCAGGGCAAGG - Intronic
1122281263 14:100623800-100623822 GGGACTGAGCAGAAAGGGCAGGG - Intergenic
1122598554 14:102909526-102909548 GCCACAGGCCAAGAAGGGCACGG - Exonic
1122863607 14:104593653-104593675 GCCAAACTGCACAGAGGGCAGGG + Exonic
1122886851 14:104714024-104714046 GCCACAGTGTAGACAGACCAAGG + Intronic
1122894213 14:104747939-104747961 GCCACAGTGCTCAAAAGTCAGGG - Intergenic
1123024650 14:105419139-105419161 GCCTCACTGCGGAAAGAGCACGG + Intronic
1123505752 15:20940743-20940765 GCCAGAGTGTAGAAAGGCAATGG + Intergenic
1123562986 15:21514449-21514471 GCCAGAGTGTAGAAAGGCAATGG + Intergenic
1123599233 15:21951732-21951754 GCCAGAGTGTAGAAAGGCAATGG + Intergenic
1125016567 15:34943148-34943170 GACACAGTACAAGAAGGGCAAGG + Intronic
1125323035 15:38509024-38509046 GCCACAGTGCATGATGGGAATGG - Intronic
1127104458 15:55598090-55598112 GCCAGAGAGCATAAAGAGCAAGG - Intergenic
1127286598 15:57538744-57538766 GGCAGAGTGCAGAGAGCGCATGG - Intronic
1127952548 15:63823543-63823565 GCCCCAGTTGAGAAAGGTCACGG - Intronic
1127983384 15:64050437-64050459 GGCACAGGGCAGAGTGGGCATGG - Intronic
1128082984 15:64867244-64867266 GGAACAGAGCAGAAAGGCCAGGG - Exonic
1129037654 15:72660466-72660488 GCCACAGCCAGGAAAGGGCAGGG - Intronic
1129212233 15:74076759-74076781 GCCACAGCCAGGAAAGGGCAGGG + Intronic
1129398164 15:75264320-75264342 GCCACAGCCAGGAAAGGGCAGGG - Intronic
1129401775 15:75288601-75288623 GCCACAGCCAGGAAAGGGCAGGG - Intronic
1129475361 15:75781292-75781314 GCCACAGCCAGGAAAGGGCAGGG - Intergenic
1129729361 15:77921077-77921099 GCCACAGCCAGGAAAGGGCAGGG + Intergenic
1131050875 15:89347017-89347039 GCCAAACTGCAGAAAGGGACGGG + Intergenic
1202971338 15_KI270727v1_random:241584-241606 GCCAGAGTGTAGAAAGGCAATGG + Intergenic
1132463252 16:65965-65987 GCCCCAGAGCAGATAGGCCAGGG + Intronic
1132557518 16:579087-579109 GCCACAGTGAGGACAGGCCATGG - Exonic
1133129359 16:3667038-3667060 GCCACAGGGCAGAATGGGACAGG + Intronic
1135449473 16:22544979-22545001 GCCACAGAGCAGAAGGTGAATGG - Intergenic
1136014813 16:27389511-27389533 GCCACAGCCAAGAAAGGGCAGGG - Intergenic
1136238836 16:28932094-28932116 TCCAAAGGGCAGAAAGGGAAGGG + Intronic
1137497741 16:48983787-48983809 GCCACAGAGCTGGAAGGGGAGGG + Intergenic
1137624774 16:49900683-49900705 GCCACACAGCAGAAGGAGCAGGG - Intergenic
1138268554 16:55678239-55678261 GCTCCAGGCCAGAAAGGGCAAGG - Intronic
1138395180 16:56698497-56698519 GTCACAGAGCAGAAAGAGAAGGG + Intronic
1139378119 16:66513643-66513665 GCCACCTTGCAGACAGGGGAGGG - Intronic
1139581385 16:67875945-67875967 GCCCCAGTGCAGAGAGCCCACGG + Exonic
1139596628 16:67961975-67961997 GCCTCAGGGGAGAGAGGGCAGGG + Intronic
1140333503 16:74081142-74081164 GCCACAGTGCTGAGAGTCCAGGG + Intergenic
1140788228 16:78364096-78364118 TCCACAGGCCAGGAAGGGCAAGG - Intronic
1141282308 16:82639801-82639823 GCCACAGAGCAGCGAGAGCATGG + Intronic
1141800890 16:86308583-86308605 AGCACAGCACAGAAAGGGCAGGG - Intergenic
1142394663 16:89825214-89825236 GCCACAGTGCAGCACTGGCCGGG - Intronic
1143964818 17:10749641-10749663 GGCACAGAGAGGAAAGGGCAGGG + Intergenic
1143992884 17:10981644-10981666 GACACAGTCCTGAAATGGCAGGG - Intergenic
1144100430 17:11937802-11937824 GCCAAAGTGAAGAAAGGGCAGGG + Intronic
1144329793 17:14213167-14213189 GCCACAGAGCAGAAGGTGGATGG + Intergenic
1144858228 17:18282723-18282745 CCCACAGTGCAACAAGGACATGG - Exonic
1145115161 17:20203140-20203162 TCTACAGTGTAGGAAGGGCACGG - Intronic
1146523943 17:33549885-33549907 GCAATAGTTCACAAAGGGCAGGG - Intronic
1147423232 17:40332703-40332725 GCCCCAGGGCATAAAGGGCGGGG - Intronic
1147921242 17:43918246-43918268 GCGATACTGCAGAGAGGGCAGGG - Intergenic
1148330018 17:46808543-46808565 CCCACAGTGCAGCCTGGGCATGG - Intronic
1149964842 17:61151936-61151958 GACACAGTACCGGAAGGGCAAGG + Intronic
1150090451 17:62319952-62319974 GACACAGTGCAAGAAGGGCAAGG + Intergenic
1151416870 17:73972360-73972382 CCCAAAGTGCAGAAAGGGTGTGG - Intergenic
1151638671 17:75372342-75372364 GGAACAGTGCAGACAGGGAAGGG + Intronic
1151952373 17:77362212-77362234 GCTACAGAGCCCAAAGGGCAGGG - Intronic
1154388918 18:13919833-13919855 GACACAGTACAAGAAGGGCAAGG - Intergenic
1155033591 18:22005090-22005112 ACCACAGTCCAGACAGGGCTTGG - Intergenic
1155067363 18:22279426-22279448 GCCACAGTCTAGCATGGGCATGG - Intergenic
1155169697 18:23258213-23258235 TCCACAGTGGAGAAAGTGCGAGG - Exonic
1157483206 18:48069101-48069123 GCCCCAGCGCAGCCAGGGCAGGG + Intronic
1159204890 18:65236620-65236642 GCTAAACTGCAGAAAGAGCATGG + Intergenic
1159725389 18:71951603-71951625 TCCACAGTTCAGAAAGGTTACGG + Intergenic
1160173498 18:76573423-76573445 GCCACTGTGCAGAAGTGGCCTGG + Intergenic
1160954620 19:1684887-1684909 CCACCAGTGCAGACAGGGCAGGG - Intergenic
1161572355 19:5037511-5037533 GCCACAGTGCAAAAGGCGCCTGG - Intronic
1162011042 19:7815330-7815352 CCCACAGTCCAGAGAGGGGATGG + Intergenic
1162476651 19:10904509-10904531 GTCACAGTGAACAAATGGCATGG + Intronic
1162967053 19:14161010-14161032 GCTGAAGTGCAAAAAGGGCAGGG - Intronic
1163319356 19:16564241-16564263 CCCACAGTGCTAGAAGGGCAAGG + Intronic
1164013717 19:21233403-21233425 GACACAGTACAAGAAGGGCAAGG + Intronic
1164827430 19:31294138-31294160 TGCTCAGTGCAGAAAGGGTAGGG - Intronic
1165727364 19:38122526-38122548 GCCACAGAGAAGCAAGGGCAGGG - Intronic
1165882269 19:39052653-39052675 GCCACAGTGCTCTCAGGGCAGGG - Intergenic
1166272878 19:41727985-41728007 TCCACAGTGCAGACAGTGGAAGG - Intronic
1166486469 19:43218292-43218314 GCCACTGTGGAAAAATGGCATGG + Intronic
1167013021 19:46821542-46821564 ACCACAGCTCAGAAGGGGCAGGG - Intergenic
1167298766 19:48667305-48667327 GCTGCAGTGGAGAAAGGTCAGGG - Intronic
1167428172 19:49440330-49440352 GCCACAGTGCACGAAGGAGATGG - Intronic
1167783135 19:51613516-51613538 GGCACAGGGCAGACAGGGCTGGG + Intronic
1167795517 19:51705642-51705664 GCTACAGTGGAGAGAGGCCAAGG - Intergenic
1168338209 19:55608602-55608624 GCCACAGTCCTGACTGGGCACGG - Intronic
1168348620 19:55662877-55662899 GCCAGAGTGCAGAGAGGACTGGG - Intronic
925052227 2:825084-825106 GCCAACGTGCAGCAGGGGCAGGG + Intergenic
925221685 2:2146924-2146946 TCCACAGAGCAGAAAGGAAAGGG + Intronic
927206990 2:20617143-20617165 ATCAGGGTGCAGAAAGGGCAGGG + Intronic
927733621 2:25498503-25498525 GACACAGTGCAGAATGTGAAGGG + Intronic
928425485 2:31174489-31174511 GCCAGCATGCAGAAAGGGAAGGG - Intronic
928465147 2:31516459-31516481 GCCACAGGGCAGAGAGGGGCTGG - Intergenic
929659743 2:43772107-43772129 GCAACAGTGCAGAAGGGTAAAGG - Intergenic
931245257 2:60487094-60487116 GCCACAAGGCAGGAAGGGGAAGG + Intronic
932084747 2:68747966-68747988 GCCACTGTGCAGAAAATACATGG - Intronic
932140363 2:69271935-69271957 TCCACAGTGCAGAGATGGGATGG - Intergenic
932493352 2:72134838-72134860 GCTGCAGTGCACACAGGGCAAGG - Exonic
932720155 2:74132854-74132876 GCCAAATTGCAGAAAGGACACGG - Intronic
933862917 2:86487890-86487912 GCCACAGTGCAAAACGAGCAAGG - Intronic
934044471 2:88161041-88161063 GCCTGAGTGCAGAAGGAGCAGGG - Intergenic
934474273 2:94582825-94582847 GCGACAATGCAGAATGGGGAGGG + Intergenic
934565764 2:95339902-95339924 GCCACAGGGTAGAAAGGGCCTGG - Intronic
935070382 2:99688780-99688802 GCCACAGTGCAGAGATGCCCAGG - Intronic
935227076 2:101061932-101061954 GCCTCAGTGCAGGTAGGGAAAGG - Intronic
935791716 2:106597612-106597634 GCAACATAGCAGAAAGGCCAAGG - Intergenic
935976990 2:108587802-108587824 GACACAGTGCAGAAGCAGCAAGG - Intronic
936801662 2:116276200-116276222 GCCACAATGCAAAAAGAGTATGG - Intergenic
937435150 2:121874013-121874035 GGCTCAGAGCAAAAAGGGCAGGG - Intergenic
937899806 2:127011249-127011271 GCCCTAGTGCAGAGAAGGCAGGG - Intergenic
937988308 2:127648553-127648575 GGCACGGGGCAGAGAGGGCATGG - Intronic
938083163 2:128380954-128380976 GCCCCAGTTCAGACAGGTCAGGG + Intergenic
938257235 2:129868764-129868786 ACCTGAGTGCAGCAAGGGCAGGG - Intergenic
939475493 2:142681254-142681276 GCTACAGGGGAGAAAGGCCAGGG - Intergenic
940177031 2:150889900-150889922 GACAGAGAGGAGAAAGGGCATGG - Intergenic
941697129 2:168564726-168564748 GCCACACTTCAGAGAGGGCCTGG - Intronic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
943792662 2:191951987-191952009 GACACAGTGCAGTATGAGCATGG + Intronic
944395124 2:199258126-199258148 ACCAAAGCGCAGAACGGGCAAGG - Intergenic
944639413 2:201707829-201707851 GGGACAGTGAAGAAAGGGAATGG - Intronic
946456715 2:219832443-219832465 GGCACAGAGCAGGAAGGGAAAGG - Intergenic
946602621 2:221368864-221368886 GCCACATTTTAGAAAGGACATGG + Intergenic
947988408 2:234467933-234467955 GCAATAGTGCAGAACGGGAAGGG - Intergenic
948476218 2:238221455-238221477 GCCCCAGCTCAGAAGGGGCAGGG + Intergenic
1168812278 20:711818-711840 CCCACAGTCCAGAAGGGGCCTGG + Intergenic
1169869217 20:10233445-10233467 GACACAGTGAAGGAAGGGAAAGG + Intronic
1170040060 20:12030573-12030595 GCAACAGAGCAGAAAGAGCTAGG + Intergenic
1170978575 20:21189615-21189637 GCCAAAGTGGGGAAAAGGCAAGG + Intronic
1171246228 20:23611835-23611857 GGGACAGTGTAGACAGGGCATGG + Intergenic
1172250466 20:33475840-33475862 GCCAGGGTGCAGAGAGGGCCAGG + Intergenic
1172564586 20:35918974-35918996 CCTACAGTACTGAAAGGGCAAGG - Intronic
1172877419 20:38173828-38173850 GCCTCAGTCCTGGAAGGGCAGGG + Intergenic
1172995709 20:39069178-39069200 ACCACAGAGGAGAAAGGGCTTGG - Intergenic
1174197811 20:48785932-48785954 GCCACAGGGCAGAAAGAGCCGGG + Intronic
1174623445 20:51894828-51894850 GCCACAGGGCAGGAAGGGAGTGG - Intergenic
1174910382 20:54601706-54601728 GCCCCAGTGCAGACTGTGCAGGG - Intronic
1175970638 20:62685066-62685088 GCCACAGTGCATGGAGTGCATGG + Intronic
1176965287 21:15205754-15205776 CTCACAGGGTAGAAAGGGCAAGG - Intergenic
1177745778 21:25211492-25211514 GCCAAAGTGGAGAAAGAGCTGGG - Intergenic
1178035761 21:28580771-28580793 TGCACACAGCAGAAAGGGCAGGG - Intergenic
1179248951 21:39656944-39656966 GCCATAGTGCCTGAAGGGCAAGG - Intronic
1180231462 21:46429186-46429208 CCCAGAGAGCACAAAGGGCATGG - Intronic
1180754104 22:18148254-18148276 GCCCCAGTGCAGAATGGACAAGG - Intergenic
1180825047 22:18856059-18856081 GCCACAGTGCAGAGGGAGGAGGG + Intronic
1180856112 22:19046717-19046739 GCCACAGGGCAGGCAGAGCAGGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181095830 22:20504594-20504616 ACCATAGTGCAGAAGGGGGAGGG + Intronic
1181187683 22:21118489-21118511 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1181211515 22:21292004-21292026 GCCACAGTGCAGAGGGAGGAGGG + Intergenic
1181260244 22:21592192-21592214 CCCAGAGTGCAGAAAAGGAAAGG - Intronic
1181500736 22:23314253-23314275 GCCACAGTGCAGAGAGAGGAGGG - Intronic
1181509713 22:23383714-23383736 GCCAGAGTGGGGAAAAGGCAGGG + Intergenic
1181527695 22:23499502-23499524 GGCACAGAGAAGAAAGGGCCAGG + Intergenic
1181705962 22:24649564-24649586 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1184426497 22:44412006-44412028 GCTTCAGTGCAGAAAGAGCCTGG + Intergenic
1184433305 22:44454310-44454332 GCCACAGCTCAGGGAGGGCAGGG + Intergenic
1184525729 22:45021161-45021183 AGCACAGGGCAGAAAGTGCAGGG - Intergenic
1184677276 22:46050581-46050603 GCCAGAGGCCAGAAAAGGCAAGG - Exonic
1184895474 22:47404114-47404136 GCCGCACTGCAGTAAGGGCTGGG + Intergenic
1203215434 22_KI270731v1_random:3427-3449 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1203275192 22_KI270734v1_random:81964-81986 GCCACAGTGCAGAGGGAGGAGGG + Intergenic
949830493 3:8209249-8209271 GGCACAGTGCATAAAGGTCCAGG + Intergenic
950200981 3:11043838-11043860 GACACAGGGGAGAAAGGGCAGGG + Intergenic
950709900 3:14806575-14806597 GCCACAATGCAGAGAGGCTAAGG - Intergenic
953686088 3:45079413-45079435 CACAAAGTCCAGAAAGGGCAGGG + Intergenic
953933263 3:47017769-47017791 TCAACAGTCCAGAGAGGGCAAGG + Intronic
954302031 3:49705268-49705290 GCCACAGGGCTGGGAGGGCATGG - Intronic
954712464 3:52511990-52512012 GGTACAGTGGAGCAAGGGCAGGG - Intronic
954965027 3:54602891-54602913 CTCACATTGCAGAAAGGGCCTGG + Intronic
955358213 3:58249661-58249683 GCAAACGTGCACAAAGGGCAGGG - Intronic
961424988 3:126838013-126838035 TCCACAGTGCAGATGGGGCGGGG + Intronic
961464056 3:127070862-127070884 GCTACAGTTCGGAGAGGGCATGG + Intergenic
961708774 3:128810564-128810586 TGCACACAGCAGAAAGGGCATGG - Intronic
961957599 3:130820010-130820032 GCCACAGTAAAGAAAGGTCATGG - Intergenic
962353088 3:134670003-134670025 CTCTCATTGCAGAAAGGGCAAGG - Intronic
963905651 3:150771657-150771679 GCCAGTTTGCAGAAAGGGGAAGG - Intergenic
966107101 3:176349251-176349273 GCCAGGGTGCAGAGGGGGCAAGG - Intergenic
966554980 3:181248905-181248927 ATCACAGTGGTGAAAGGGCAGGG - Intergenic
966627788 3:182037152-182037174 GCCACAGAGCTGTGAGGGCAAGG + Intergenic
967252053 3:187550178-187550200 GCCACCTAGCAGAAAAGGCAAGG - Intergenic
968357326 3:198119641-198119663 ACCATAATGCAGAAAGGGCCAGG - Intergenic
968603051 4:1519477-1519499 ACCACACTCCAGCAAGGGCAGGG + Intergenic
968714065 4:2141504-2141526 CCAACAGAGCAGACAGGGCAAGG - Intronic
968812396 4:2805867-2805889 GCCAAGGTGCAGAGAGGGAAGGG + Intronic
969302374 4:6304650-6304672 GGCAGAGTCCAGAATGGGCATGG + Intergenic
969431465 4:7157283-7157305 GCCACAGTGCAGTATCTGCAAGG - Intergenic
969437922 4:7199309-7199331 GGCACAGTGCAGGGAGAGCAAGG + Intronic
975630916 4:76401320-76401342 GACACAGTACAAGAAGGGCAAGG + Intronic
975956724 4:79849475-79849497 ACCACAGTCCAGCAAGGGCAAGG + Intergenic
978744009 4:112171284-112171306 GACACAGTACAAGAAGGGCAAGG + Intronic
981780835 4:148427417-148427439 TCCACAGTGAAGAAAGGGGGTGG + Intronic
982266434 4:153542395-153542417 GCCACGTTGCAGAGAGGGCTGGG + Intronic
985578581 5:685026-685048 GTCACAGTCCTGAAAGGTCACGG + Intronic
985774306 5:1832830-1832852 GCCACAGAGCCCACAGGGCATGG + Intergenic
987331625 5:16862253-16862275 TCCACAGTGCACTGAGGGCAGGG - Intronic
988191175 5:27936973-27936995 ACAAAAGTGCAGAAAGGGAAAGG + Intergenic
988586458 5:32511677-32511699 CCCATAGTTCAGAAGGGGCAGGG + Intergenic
989172560 5:38487158-38487180 GCCACAGGGGAGAGAGAGCAGGG - Intronic
989659551 5:43785507-43785529 GCCACAGGGCTGGAAGGGCTGGG - Intergenic
990457736 5:56004393-56004415 ACCACAGAGCAAAAAGGGAATGG + Intergenic
991604322 5:68385050-68385072 TCCACAGTGCAGACAGAGGAAGG + Intergenic
994096509 5:95852243-95852265 TCCACAGTGCAGAAGGGGACTGG - Exonic
997383758 5:133456442-133456464 GCTACACTGAAGAAAGGGGAGGG - Intronic
997675494 5:135709500-135709522 GACTCAGTACAGAAAGGGCAAGG + Intergenic
997716818 5:136048744-136048766 GGCTCAGGGCAGGAAGGGCAAGG + Intronic
998041590 5:138954026-138954048 GTCACAGTGCAGAAAGTGGAAGG - Intronic
998069195 5:139183450-139183472 GCAGCAGAGTAGAAAGGGCAAGG + Intronic
998527537 5:142856431-142856453 CCCACAGTGTTGAAAGAGCAAGG + Intronic
1000003502 5:157162529-157162551 GCCAAAGTGGAGAAAGCCCAGGG - Exonic
1000359571 5:160434535-160434557 GCCACAGGGGAGAGAGGGAAAGG + Intergenic
1001154377 5:169260357-169260379 GCCACATCACAGAAAGGGCAAGG + Intronic
1002453515 5:179332675-179332697 GCCATCGTGCAGAGAGGGGAGGG + Intronic
1002987291 6:2202808-2202830 ACCACAGTGGAGAGAGGGGATGG + Intronic
1003254785 6:4465519-4465541 GCCACAGAGCAGCAAGGTCAAGG - Intergenic
1004080425 6:12386937-12386959 TCACCAGTGCAGAAAGTGCATGG - Intergenic
1006115611 6:31774623-31774645 GCCACTGGGAAGAGAGGGCAGGG + Exonic
1006347817 6:33497729-33497751 GCCCCAGGTCAGAAGGGGCAGGG - Intergenic
1007733276 6:43964895-43964917 GGCCCAGTGCAGATTGGGCAAGG - Intergenic
1007958498 6:45938217-45938239 CACACAGAGCAGAAAGGGGATGG + Intronic
1008435487 6:51470940-51470962 AGGACAGTGCAGAAAGGGCCTGG + Intergenic
1011574916 6:88786940-88786962 CCCACATGGCAGAAGGGGCAAGG - Intronic
1011666674 6:89641361-89641383 GTCACAGTGCAGTAGGGGGAGGG + Intergenic
1012233447 6:96786509-96786531 GTCACAGGGCAGAAAGAGAAGGG + Intergenic
1014778192 6:125534106-125534128 GCCACAGTGTAGAATGGCAATGG - Intergenic
1015004770 6:128265945-128265967 CTCACAGTGCAGAAGAGGCAAGG - Intronic
1017374292 6:153750258-153750280 TCCACAGGGCACAAAAGGCAAGG + Intergenic
1019612971 7:1946165-1946187 GCCAGAATGCACAGAGGGCAGGG - Intronic
1020590941 7:10136220-10136242 CTCACATAGCAGAAAGGGCAAGG - Intergenic
1021028626 7:15701662-15701684 GACACAGTACAAGAAGGGCAAGG - Intergenic
1021068606 7:16209013-16209035 GACACAGGGCAAGAAGGGCAAGG + Intronic
1022410031 7:30132342-30132364 GTCACAGTGGAGAGAGGGGAGGG + Intergenic
1022476851 7:30716589-30716611 GGCTCAGTGCAGAAAGGGGCAGG + Intronic
1022659719 7:32355479-32355501 GACACATTGCAGAAAAGGGAGGG - Intergenic
1023241436 7:38151625-38151647 GCTACACTGCAGAAAGAACAGGG + Intergenic
1023299428 7:38753499-38753521 CCCAGAGTGCAAAAAGGACAGGG + Intronic
1026129297 7:67606905-67606927 GGCACAGTGCAGGAAGGAGAGGG - Intergenic
1026292977 7:69025387-69025409 GCCACGCTGCAGAGTGGGCATGG - Intergenic
1026910511 7:74089208-74089230 GCCACAGAGTAGGAAAGGCAGGG + Intronic
1028334937 7:89640214-89640236 GAAACAGTGGAAAAAGGGCATGG - Intergenic
1029237859 7:99137371-99137393 ACCACAATGAAGAAAGGGGAGGG - Intronic
1029531260 7:101126829-101126851 GGCAGAGGGCAGAAAGGTCAAGG + Intergenic
1030693350 7:112557516-112557538 ACCACAGAGCAGCAGGGGCAGGG - Intergenic
1030819884 7:114083364-114083386 GCCACACTGCAGACACGGCCCGG - Intergenic
1031334025 7:120503578-120503600 GACACAATGCAGAAGGGTCAAGG - Intronic
1032447552 7:131997630-131997652 GACACAGTGCAGACAGGCTAGGG - Intergenic
1032496166 7:132364411-132364433 GCCCCAGTGCAGAGAGGACAAGG - Intronic
1033399956 7:141013278-141013300 GCCACATTCCAAAATGGGCATGG - Intronic
1034099862 7:148441679-148441701 GCCAGAGTCCAGAAATGGGATGG + Intergenic
1034187612 7:149191133-149191155 GACACAGTACAAGAAGGGCAAGG - Intergenic
1034389953 7:150778290-150778312 GCCAGAGTGCAGTCAGGACAAGG - Intergenic
1035155532 7:156909127-156909149 GCCACCGTGCAGAACGCGCGCGG + Intergenic
1035458623 7:159025438-159025460 GACACAGTGCAGACTGGGCGTGG + Intergenic
1036048245 8:5167489-5167511 ACCCCAGTGCCAAAAGGGCAGGG + Intergenic
1036604253 8:10292500-10292522 GGCAGAGTTCAGCAAGGGCAGGG - Intronic
1036642077 8:10590987-10591009 CCCTCACTTCAGAAAGGGCAAGG + Intergenic
1038667073 8:29547162-29547184 AGCACAGTGCAGAAAGGAAATGG + Intergenic
1046285911 8:112092604-112092626 GCCTTAGGGCAGAAGGGGCAGGG + Intergenic
1048340653 8:133536254-133536276 TCCACATTGCAGAAAGGACAAGG - Intronic
1048448487 8:134510916-134510938 GAAACAGTGCAGAAAAGGGACGG + Intronic
1049353391 8:142176056-142176078 GCCGCAGTGCAGGAAGGGCTGGG - Intergenic
1049374153 8:142281131-142281153 GCCACAGCTCAGTCAGGGCATGG + Intronic
1050759681 9:9052159-9052181 CCCACATGGCAGAAGGGGCAAGG + Intronic
1053683804 9:40503309-40503331 GCGACAATGCAGAATGGGGAGGG - Intergenic
1053933778 9:43131595-43131617 GCGACAATGCAGAATGGGGAGGG - Intergenic
1054279916 9:63121643-63121665 GCGACAATGCAGAATGGGGAGGG + Intergenic
1054296898 9:63338775-63338797 GCGACAATGCAGAATGGGGAGGG - Intergenic
1054394918 9:64643281-64643303 GCGACAATGCAGAATGGGGAGGG - Intergenic
1054429565 9:65148481-65148503 GCGACAATGCAGAATGGGGAGGG - Intergenic
1054500816 9:65873050-65873072 GCGACAATGCAGAATGGGGAGGG + Intergenic
1055608679 9:77998128-77998150 GCCCATGTGCAGGAAGGGCAGGG + Intronic
1056702555 9:88923252-88923274 GCTACAGTGCAGAAAAGGCAAGG - Intergenic
1061318905 9:129815485-129815507 GCCACACAGCAGAACGGACATGG + Intronic
1061418071 9:130458754-130458776 GCCACAGTGCACAGAGCGCAGGG - Intronic
1062057042 9:134474156-134474178 GGCAGAGAGCAGAAAGGGCCGGG + Intergenic
1062096446 9:134706307-134706329 ACCACCGTGCAGGAAGGGGAAGG + Intronic
1186178493 X:6949989-6950011 GCCATACTGGAGACAGGGCAAGG - Intergenic
1186188244 X:7042761-7042783 GCCTCACTGCAGAAATGGCATGG - Intergenic
1186840909 X:13484092-13484114 GCCAGAGTGCACAAGGGGTATGG - Intergenic
1187075580 X:15931177-15931199 GCCACAGTGGAAAAAAGGCATGG + Intergenic
1187305391 X:18090816-18090838 GGCTTAGTGCAGAAAGGTCACGG + Intergenic
1187477049 X:19620612-19620634 ACCACAGGGGAGAAAGGGCACGG + Intronic
1188218285 X:27506563-27506585 GCTACAGTGAAGAAAGGCCTAGG - Intergenic
1188542936 X:31269857-31269879 GCCACAGAGCAGAATGGAGAAGG - Intronic
1189356723 X:40315280-40315302 CCCACACTGCAGAAAGGCCAGGG + Intergenic
1189385945 X:40536993-40537015 CTCACATGGCAGAAAGGGCAAGG - Intergenic
1189609350 X:42715242-42715264 GCCACAGTGAGGACCGGGCAAGG + Intergenic
1190594834 X:52042072-52042094 GCCACAGAGGAGAAAAGGGAGGG + Intergenic
1190613990 X:52212001-52212023 GCCACAGAGGAGAAAAGGGAGGG - Intergenic
1190752506 X:53374487-53374509 GCTACAATGCAGAAAAGCCATGG - Exonic
1191105694 X:56770818-56770840 GAGACAGGGCAGAAAGGGGAGGG - Intergenic
1191106687 X:56776220-56776242 GAGACAGGGCAGAAAGGGGAGGG - Intergenic
1191627415 X:63283801-63283823 GCCCAAGGGCAGCAAGGGCAAGG - Intergenic
1194379208 X:93174489-93174511 GCCCCAATTCAGAAGGGGCAGGG - Intergenic
1194508312 X:94760843-94760865 GCCACAGTGAAGAAAACCCAAGG - Intergenic
1195083431 X:101391524-101391546 GACACAGTACAAGAAGGGCAAGG + Exonic
1199215302 X:145254790-145254812 GCAGCAGCGCAGAAAGGGGAAGG + Intronic
1199234983 X:145481233-145481255 CCCACATGGCAGAAGGGGCAGGG + Intergenic
1199464091 X:148116413-148116435 GCCAGAGTACAGAAAGGGCATGG + Intergenic
1199609891 X:149604289-149604311 GCCTCAGGCCAGAAAGGGCAAGG - Intronic
1200080702 X:153575077-153575099 GCCAGGCAGCAGAAAGGGCAGGG + Intronic
1201697576 Y:16842749-16842771 GGCACAGAGCAAAAAGTGCAGGG - Intergenic