ID: 1098515964

View in Genome Browser
Species Human (GRCh38)
Location 12:71376888-71376910
Sequence TCCAGCTGGCCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 13, 1: 7, 2: 9, 3: 26, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098515964_1098515973 16 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515973 12:71376927-71376949 GGCTTGGCGGACACCGCACTCGG 0: 1
1: 12
2: 280
3: 408
4: 380
1098515964_1098515970 0 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515970 12:71376911-71376933 GTTCCGGGTGTGCGTGGGCTTGG 0: 4
1: 622
2: 645
3: 410
4: 296
1098515964_1098515975 25 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515975 12:71376936-71376958 GACACCGCACTCGGAGCGGCCGG 0: 1
1: 12
2: 75
3: 404
4: 508
1098515964_1098515968 -6 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515968 12:71376905-71376927 GCTGGAGTTCCGGGTGTGCGTGG 0: 2
1: 455
2: 397
3: 439
4: 569
1098515964_1098515969 -5 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515969 12:71376906-71376928 CTGGAGTTCCGGGTGTGCGTGGG 0: 3
1: 437
2: 380
3: 422
4: 453
1098515964_1098515974 21 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515974 12:71376932-71376954 GGCGGACACCGCACTCGGAGCGG 0: 1
1: 12
2: 69
3: 152
4: 202
1098515964_1098515972 3 Left 1098515964 12:71376888-71376910 CCGGCGCTTGCGGGCCAGCTGGA 0: 13
1: 7
2: 9
3: 26
4: 121
Right 1098515972 12:71376914-71376936 CCGGGTGTGCGTGGGCTTGGCGG 0: 3
1: 446
2: 516
3: 364
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098515964 Original CRISPR TCCAGCTGGCCCGCAAGCGC CGG (reversed) Intronic
900003980 1:32077-32099 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900023707 1:202596-202618 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG + Intronic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
915004368 1:152622994-152623016 TCCAGCTGTGCCCCAAGCTCTGG - Exonic
915321334 1:155057966-155057988 CACAGCTTGCCCGCCAGCGCAGG - Exonic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG + Exonic
922581804 1:226703646-226703668 TGCTGCGGGCCCGCTAGCGCTGG - Intronic
922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG + Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG + Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070305489 10:75236497-75236519 TCCATCTGGCCCCCAAAAGCAGG - Intergenic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1077392646 11:2307184-2307206 CCCTGCTGGCCCCCAAGCACAGG - Intronic
1077764561 11:5144445-5144467 TCGCGCTGGTCAGCAAGCGCTGG - Intergenic
1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG + Intergenic
1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG + Intronic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1084259110 11:67963300-67963322 TCCAGCCGGCAGGCAAGTGCTGG - Intergenic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1091377404 12:34128-34150 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG + Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1094500670 12:31018265-31018287 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1103322090 12:120098169-120098191 TCCAGCTGGGCCGGGCGCGCCGG - Intronic
1104572594 12:129938215-129938237 TCCAGCTGGCTCACCAGAGCTGG + Intergenic
1105274425 13:18906330-18906352 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1119303685 14:73590698-73590720 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG + Intronic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1135590313 16:23700599-23700621 TCCGGCTGGCCCCCGAGTGCAGG + Exonic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG + Intergenic
1149058279 17:52390606-52390628 TCCTGCTGACCCACAAGCCCAGG - Intergenic
1151854452 17:76710957-76710979 CCCAGCTGGCCCGCACTCGGCGG - Intronic
1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG + Intergenic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1154466114 18:14643585-14643607 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1155003286 18:21706549-21706571 TCCCGCTGGCCCGTGATCGCGGG - Intronic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1160635732 19:73686-73708 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1160904191 19:1444919-1444941 GGCAGCTGACCCGCAAGCGCCGG - Intergenic
1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG + Exonic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
927515626 2:23670183-23670205 TCCAGTTAGCCCGCGAGCTCAGG - Intronic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
930104919 2:47632134-47632156 TCAAGCAGGCCTGCAAGGGCGGG + Intergenic
933060846 2:77735002-77735024 GCCGGCCGGCCCGCAAGCCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
943191799 2:184686283-184686305 TCCAGGGGGCCAGCAAGAGCTGG - Intronic
945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG + Intergenic
945134901 2:206616641-206616663 TCCAGCTGGCCCTCAGTCGGTGG + Intronic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1169204754 20:3733264-3733286 TCAAGCTGGCCCGGAAGACCAGG - Intronic
1171561901 20:26134415-26134437 TCCAGCTGGCCAACAATTGCTGG + Intergenic
1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG + Intergenic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG + Intronic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG + Intergenic
1184587027 22:45454812-45454834 TCCAGGTGGCCAGCAATGGCTGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
952925261 3:38315452-38315474 CCCAGCTGGCCAGCAGGCTCAGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
961455661 3:127022694-127022716 TCCAGCTGTCCAGCAGGCACAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG + Exonic
968495013 4:910576-910598 TCCCGCAGGCCGGCTAGCGCAGG - Intronic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002790740 6:435800-435822 GCCAGTTGGCCCGCAAGTCCCGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1004338227 6:14783826-14783848 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1006558360 6:34888423-34888445 TTCAACTGGCCCGAAACCGCGGG + Intergenic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG + Intronic
1012733545 6:102910904-102910926 GCCGGCGGGCCCGCAAGCCCGGG - Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG + Intronic
1019102514 6:169642654-169642676 TCTAGCAGGCCCCCAAGGGCAGG - Intronic
1022505396 7:30906252-30906274 CCCTGCTGGCCCGAAAGGGCAGG - Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG + Intergenic
1030711712 7:112757627-112757649 TCCAGGTGGCCCTCATGGGCAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1036562248 8:9906901-9906923 TCCATCTGGCCCGGGCGCGCTGG - Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1044853550 8:96452364-96452386 TCTTGCTGGCCAGCAAGCGCCGG - Intergenic
1044895126 8:96883605-96883627 TCTAGCTGGCCTGGAACCGCAGG + Intronic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG + Intergenic
1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG + Intronic
1049886674 9:31859-31881 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1053015314 9:34658572-34658594 TCCAGCTGGCTCGCAGGCGTCGG - Exonic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic