ID: 1098516129

View in Genome Browser
Species Human (GRCh38)
Location 12:71378000-71378022
Sequence AGAAGCTACCTGGCCAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098516129_1098516133 18 Left 1098516129 12:71378000-71378022 CCTTAATTGGCCAGGTAGCTTCT 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1098516133 12:71378041-71378063 CTGTGAGTTGTGCTTAAGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 146
1098516129_1098516131 -7 Left 1098516129 12:71378000-71378022 CCTTAATTGGCCAGGTAGCTTCT 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1098516131 12:71378016-71378038 AGCTTCTGTTTTGCTTCCGTTGG 0: 1
1: 0
2: 1
3: 13
4: 178
1098516129_1098516134 19 Left 1098516129 12:71378000-71378022 CCTTAATTGGCCAGGTAGCTTCT 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1098516134 12:71378042-71378064 TGTGAGTTGTGCTTAAGAAAGGG 0: 1
1: 0
2: 0
3: 13
4: 201
1098516129_1098516135 26 Left 1098516129 12:71378000-71378022 CCTTAATTGGCCAGGTAGCTTCT 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1098516135 12:71378049-71378071 TGTGCTTAAGAAAGGGCAAGTGG 0: 1
1: 0
2: 1
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098516129 Original CRISPR AGAAGCTACCTGGCCAATTA AGG (reversed) Intronic
900875802 1:5341689-5341711 AGAAGCTTGCTGGCCAGCTAGGG - Intergenic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906712797 1:47944101-47944123 GGAAGCTACCTGGGGAATAAAGG + Intronic
908269172 1:62406420-62406442 ACAACCTTCCTGGCCAAGTAGGG + Intergenic
908286959 1:62616209-62616231 AGAAGATACCGTGCCAAATAAGG - Intronic
912181473 1:107224047-107224069 AGAAGTTAACTGGTCCATTAGGG - Intronic
913112469 1:115668844-115668866 AGAAGCTCCCAGGCCTTTTAAGG + Intronic
913177713 1:116290264-116290286 AGAAGCTACCTGGTCATAGAGGG + Intergenic
915603411 1:156936622-156936644 AGAAGCTCCCTGGCAAAATGGGG - Intronic
918119416 1:181524817-181524839 AGAAGGCAGCTGCCCAATTAGGG - Intronic
919328184 1:196135854-196135876 GGAAGCTTCCAGGCCAAATAAGG + Intergenic
921661678 1:217810375-217810397 AGAAACTACCTGGCCAAGGCAGG + Intronic
923301911 1:232649111-232649133 TGAAGCTACCTGGCCAGTCGGGG - Intergenic
924227667 1:241935333-241935355 AGAAGCTACTTGGTCATTTGTGG - Intergenic
1063461231 10:6216156-6216178 AAAAGCTACCTGGCGAAAGAAGG + Exonic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1073369273 10:102972344-102972366 AGAAGCTTCCTGGCCAGGCACGG + Intronic
1073399631 10:103246033-103246055 AACAGCGACCTGGCCAATTTAGG + Exonic
1075583600 10:123641162-123641184 AGAAGCTACCTACAAAATTAGGG - Intergenic
1081509486 11:43755007-43755029 AGAAGCTTCCTGGCCACAAATGG - Intronic
1083878287 11:65536194-65536216 AGAACCTACCAGGCCAGCTAGGG - Intronic
1091514387 12:1164129-1164151 AGAAGCTGCTTGGTCAGTTAAGG + Intronic
1094688757 12:32747979-32748001 TGAAGCTACCTTGACAATCAGGG + Intronic
1096896503 12:54826122-54826144 AGAAGCTTCCAGGCCACTTGTGG + Intergenic
1097408043 12:59215410-59215432 AGAAGTTCCCTGGCCATTAAGGG + Intergenic
1098101042 12:67017689-67017711 AGAAGCTTCCTAGCCTCTTAAGG - Intergenic
1098137308 12:67416281-67416303 AGAAGCAACCTGGCCAGGCACGG - Intergenic
1098516129 12:71378000-71378022 AGAAGCTACCTGGCCAATTAAGG - Intronic
1102133836 12:110555694-110555716 AGAAGCAACCGGGCTAACTAGGG + Intronic
1102560048 12:113755451-113755473 CGAAGCTACAAGGCCACTTAAGG - Intergenic
1103228903 12:119311438-119311460 AAAAGCTACCTAGCCAAGCATGG - Intergenic
1106844578 13:33724398-33724420 AAAAGCTACCTCCCCAAATATGG - Intergenic
1107568342 13:41629769-41629791 AGAAGCTACCTGTGCAATAAAGG - Intronic
1114530379 14:23391704-23391726 AGAAGCTACATGGCCAGGTCTGG - Intronic
1118377670 14:65191219-65191241 AGAAGATACCTGGGGAATCAAGG + Intergenic
1119932569 14:78562455-78562477 AGAAGCTGCCAAGCCAGTTAAGG - Intronic
1125077133 15:35632699-35632721 AGGTGCTACCTGGCAATTTAGGG + Intergenic
1128616854 15:69117026-69117048 AGAGGCTACCCAGCCAATAATGG - Intergenic
1138733243 16:59219871-59219893 AGAATCAACCTGGCTAATGAAGG - Intergenic
1138776115 16:59725917-59725939 AGATGCCACCTGGCCACTTGGGG - Intronic
1144375821 17:14640060-14640082 AGAAGATAACTGGTCATTTAGGG + Intergenic
1153149177 18:2070618-2070640 AGAAGCCACCTGGCTCATCAGGG + Intergenic
1154021973 18:10671353-10671375 AAAAGCTACCTTGCAAGTTAAGG - Intronic
1154486424 18:14875280-14875302 AGAAGCTACATGGCCATGTCAGG + Intergenic
1160117616 18:76096610-76096632 AGAAGCTCCCTGGACAAATCTGG + Intergenic
1166903033 19:46081030-46081052 ACAAGATAACTGGCCAATTGTGG - Intergenic
925128721 2:1479347-1479369 TGAAGCAACCTGGCAAATTGTGG - Intronic
925667881 2:6281015-6281037 ATCACTTACCTGGCCAATTAAGG + Intergenic
925772757 2:7299473-7299495 ATATGCAACCTGGTCAATTAAGG - Intergenic
933543577 2:83680039-83680061 AGAAGCTACCAAGTCAACTAAGG - Intergenic
937061847 2:118986256-118986278 AGATGCAACCTGGCAAATTTAGG - Intronic
937394050 2:121519131-121519153 AGGACCTACTTGGCCATTTAGGG + Intronic
941152434 2:161931406-161931428 AACAGCAACCTGGCCAATTTAGG - Intronic
941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG + Intronic
943551395 2:189344829-189344851 AGCAGCTACCTGCCCATTTTTGG - Intergenic
945451787 2:210002698-210002720 AACAGCGACCTGGCCAATTTAGG + Exonic
947474544 2:230431055-230431077 CCATGCTACCTGGCCAAATAGGG + Intronic
948111937 2:235463419-235463441 AGAACCTACCTGGTCAACTCAGG - Intergenic
1169476858 20:5939641-5939663 GGAAGCTTCATGGCCAATAATGG + Intronic
1170447332 20:16441764-16441786 AGAAGGTAGCTGGCAAATGAAGG - Intronic
1170529329 20:17274472-17274494 AGAAGCTACCAGGTCAGGTAGGG - Intronic
1171017939 20:21558568-21558590 AGAAGCTACCAGGCTGCTTATGG + Intergenic
1171994964 20:31723770-31723792 GGAAGCTACCGGGCCGATGAAGG - Intronic
1172723401 20:37016634-37016656 AGAAGCAACCTGGCCAGGCATGG + Intronic
1173209392 20:41020372-41020394 AGAAGCTACCTGGCCAGGCACGG + Intergenic
1173726995 20:45305140-45305162 TGCAGCTACCTGCCCAATTTAGG - Intronic
1174418751 20:50385482-50385504 AGAAGCCACCTGTCCCATGAGGG - Intergenic
1175386708 20:58600594-58600616 GGAAGATACGTGGCCCATTAGGG + Intergenic
1176794875 21:13364099-13364121 AGAAGCTACATGGCCATGTCAGG - Intergenic
1176972404 21:15281859-15281881 AGAAGCTAACTGGCCAGTTGTGG - Intergenic
1178485492 21:33017607-33017629 AAAAGCTACCTGGCTCTTTATGG - Intergenic
1178717438 21:34978991-34979013 AGAACCTACCTGGCCCAGGATGG - Intronic
1179392121 21:41003541-41003563 AGGAGCTACTTGCCCACTTATGG + Intergenic
1180636399 22:17265895-17265917 CGAAGTTCCCTGGCCAACTAAGG + Intergenic
1182339621 22:29608935-29608957 CAATGCTACCTGGCCAATTTAGG + Intronic
1182444300 22:30381131-30381153 AGAAGCTCCCTGACCTCTTATGG + Intronic
1183554228 22:38512749-38512771 AGAATCTAACTGGCTAACTAAGG + Intergenic
1184412664 22:44333771-44333793 CAAGGCCACCTGGCCAATTAGGG - Intergenic
950842355 3:15979702-15979724 AGAAGCTGCCAGGTCAATTAAGG + Intergenic
952404264 3:32991580-32991602 GGAAGCTGCATGGCCATTTAAGG - Intergenic
953205881 3:40828592-40828614 AGAAGCTGCCAGGCCACTTGAGG + Intergenic
956848858 3:73209546-73209568 GGAAGCTGCCAGGCCAGTTAAGG + Intergenic
959267389 3:104159814-104159836 AAATGCTACCTAGGCAATTATGG - Intergenic
960143599 3:114174627-114174649 AGAAACTACCTGAACAATCACGG - Intronic
960143675 3:114175580-114175602 AGAAACTACCTGAACAATCACGG + Intronic
962110316 3:132438785-132438807 AGAAGCTACTTTGCCAGCTAAGG - Intronic
962953380 3:140242238-140242260 AGAAGAAACCTGGCCATTTCAGG + Intronic
964143803 3:153434190-153434212 AGAAGCTACCTGCCCATACATGG + Intergenic
966242649 3:177771752-177771774 TGAAATTACCTAGCCAATTAGGG + Intergenic
969073961 4:4562224-4562246 AGGAGCTGCCTGTCCACTTAGGG + Intergenic
976821888 4:89216061-89216083 AGAAACTGCCAGGCCAGTTAAGG - Intergenic
978465563 4:109005144-109005166 GGAAGCTTCCTTGCCAATCATGG + Intronic
980385578 4:132085419-132085441 AGATGCCACCTGGCCACTTTGGG - Intergenic
980850851 4:138379613-138379635 AGAAGCTACCTGCCAAAGAATGG - Intergenic
982148368 4:152424155-152424177 AGCAGCTTCCTGGCCAGGTACGG - Intronic
983061839 4:163169409-163169431 AGAAGATACTTGGAAAATTAAGG + Intergenic
985120325 4:186634010-186634032 AGTTGCTTCCTGGACAATTAGGG - Intronic
986583579 5:9291431-9291453 TGAAGCTTCCAGGCCAGTTAAGG - Intronic
986757353 5:10850602-10850624 AGAATCTACCTGGCCCAACATGG - Intergenic
987046426 5:14113426-14113448 AGAAGCTGCCAGGCCAGTGAAGG + Intergenic
988400945 5:30759577-30759599 AGAAAATACCTTGCCAATAAGGG + Intergenic
990191333 5:53263470-53263492 TGCAGCTACCTGGCCATTTCTGG + Intergenic
992459845 5:76950619-76950641 AGAAGCTATCTGGAAAAATATGG + Intergenic
996120978 5:119671753-119671775 AGAAGCAACCAGGCCACTTCTGG - Intergenic
997555799 5:134797535-134797557 AGAAGCTGCCCAGCCAGTTAAGG + Intronic
1002510235 5:179711131-179711153 AGAAGCTTCTTGGCCACGTATGG + Intronic
1005019304 6:21402333-21402355 AGCAGCCACCTGGCCACATATGG + Intergenic
1007191394 6:40022092-40022114 AGAAGCCACTTGGCCTGTTAGGG + Intergenic
1007678709 6:43619426-43619448 AGAAGCTACATAGCTAGTTAGGG - Intronic
1011738824 6:90338995-90339017 AGACTCTACCTGGCCACTTTGGG + Intergenic
1013644158 6:112119209-112119231 TGAAGCTACCTGGAAAATCAAGG - Exonic
1013987518 6:116213434-116213456 CGAAGCTGCCAGGCCATTTAAGG + Intronic
1015086155 6:129294230-129294252 AGAACCTCCCTGACCAATTCAGG - Intronic
1015736615 6:136406986-136407008 AAAACTTACCTTGCCAATTATGG + Intronic
1018246742 6:161831098-161831120 AGCAGCTAACTGGCCCATAAAGG + Intronic
1019927502 7:4203006-4203028 TGAAGCTCGCTGGCCACTTAGGG + Intronic
1021606004 7:22410244-22410266 AGAAGTTACCAGGCAAGTTATGG + Intergenic
1025252247 7:57359504-57359526 AGAAGCCACCTGTCCCATGAGGG + Intergenic
1027837362 7:83262596-83262618 AGAAGGCAACTGGGCAATTAAGG - Intergenic
1028620229 7:92817763-92817785 AGAAGCTACCAGACTAATAAGGG + Intronic
1030158077 7:106477042-106477064 AGCAGCTACCTGGTCACTTTAGG + Intergenic
1033007855 7:137586932-137586954 AGAAGCTACCAGATCAAATAAGG + Intronic
1034930574 7:155158563-155158585 TGAAGCCACCAGTCCAATTACGG + Intergenic
1035715426 8:1750644-1750666 TGAAGCTTTCTGGCCAATCAAGG - Intergenic
1037550782 8:19969281-19969303 AGAAGCTGCCAGGCCAGTTAAGG - Intergenic
1043067012 8:75586275-75586297 GGAAGATACCTGGCTAATAAAGG - Intergenic
1045697062 8:104821273-104821295 AGATGCTCCCTGGCCATCTAGGG + Intronic
1047016115 8:120725096-120725118 AGAACCCACTTGGCCAAGTATGG + Intronic
1047170873 8:122491157-122491179 AGAAGCTTCCAGGCCTCTTAAGG + Intergenic
1050073640 9:1841547-1841569 AGAAGCTCCCAAGCCAGTTAAGG + Intergenic
1051562144 9:18453888-18453910 AGAAACTCCCAAGCCAATTAAGG + Intergenic
1052344536 9:27396032-27396054 ACAAGGTGCCTGGCCACTTAAGG + Intronic
1052630544 9:31032342-31032364 TGAGGCTACCAGGCAAATTAGGG + Intergenic
1053127731 9:35596501-35596523 AGAACCTACCTGGGCAATATAGG + Intergenic
1053912504 9:42921189-42921211 AGCAGCGACCTGGTCAATTGTGG + Intergenic
1055979491 9:81988184-81988206 AGAAGCTCACTGCCCAATTTGGG - Intergenic
1061718375 9:132535968-132535990 AGAAGCTACCTGTAGAATGAGGG - Intronic
1185966518 X:4611685-4611707 AAAAGAAACCTCGCCAATTAGGG - Intergenic
1187374864 X:18742959-18742981 AGAAGCTGCCAGGCCTCTTAAGG + Intronic
1187673886 X:21696736-21696758 ATAAACTGCCTGGCCAGTTAAGG + Intergenic
1188389976 X:29608248-29608270 AGAAGCTTCCAGGCCTCTTAAGG + Intronic
1188633093 X:32392733-32392755 GGAAGCTGCCAGGCCACTTAAGG - Intronic
1189263067 X:39691791-39691813 GGAAGCCACCAGGCCAATTAAGG + Intergenic
1193463938 X:81824291-81824313 AGAAGCTACCTGGGGTAGTAAGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic