ID: 1098519265

View in Genome Browser
Species Human (GRCh38)
Location 12:71417310-71417332
Sequence CTCTAACAGCTGGAGCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098519265_1098519270 1 Left 1098519265 12:71417310-71417332 CCCTGTTGCTCCAGCTGTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1098519270 12:71417334-71417356 TACAATGGTGCATCAAATGAGGG 0: 1
1: 1
2: 0
3: 25
4: 109
1098519265_1098519269 0 Left 1098519265 12:71417310-71417332 CCCTGTTGCTCCAGCTGTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1098519269 12:71417333-71417355 TTACAATGGTGCATCAAATGAGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098519265 Original CRISPR CTCTAACAGCTGGAGCAACA GGG (reversed) Intronic
901579048 1:10225358-10225380 CCCGAGCAGCTGGAGCTACAGGG - Intronic
902654242 1:17856665-17856687 CTCCAACAGCTGGAGCAGAATGG - Intergenic
904498719 1:30902124-30902146 CTCAGCCAGCTGGGGCAACAGGG + Intronic
905744469 1:40402783-40402805 CACTAACATTTGCAGCAACATGG + Intronic
908199946 1:61784090-61784112 TTAAAACAGCTGAAGCAACAGGG - Intronic
908218045 1:61975494-61975516 CTCAAAGAGCTGGAGAAAAAAGG - Intronic
908918641 1:69163239-69163261 CTCTTAGTGCTGGAGCATCATGG - Intergenic
909270033 1:73611770-73611792 ACCTAACAGCTTGAGAAACATGG + Intergenic
910125791 1:83840821-83840843 GTCTTAGAGCTGGAGCAACCTGG + Intergenic
910872081 1:91843233-91843255 CGCTAACAGGTGGAGCAATTAGG + Intronic
914945694 1:152063609-152063631 CTCCAACAGCTGGATCAAGATGG - Intergenic
917097026 1:171408905-171408927 CTCTAAGAGATAGAGCAAGAGGG + Intergenic
917988500 1:180347555-180347577 TTCTACCAGCTGGGCCAACATGG - Intronic
920122202 1:203667150-203667172 CGAGACCAGCTGGAGCAACATGG - Intronic
920409174 1:205745296-205745318 CTCTCTCAGCCTGAGCAACATGG + Intronic
920942293 1:210495054-210495076 CTCTCACTGCTGGAGAGACAGGG - Intronic
920969338 1:210729705-210729727 CTCTGACAGCCTGAGGAACAAGG - Intronic
923130458 1:231070357-231070379 CTCTGTCATCTGCAGCAACATGG + Intergenic
1063596661 10:7441602-7441624 ATCTGAAAGCCGGAGCAACATGG - Intergenic
1064082705 10:12321425-12321447 CACGACCAGCTGGACCAACATGG + Intergenic
1064770539 10:18718153-18718175 CTCGACCAGCTTGGGCAACATGG - Intergenic
1065524728 10:26608602-26608624 CTCTACCAGCCTGACCAACATGG + Intergenic
1067412518 10:46077294-46077316 CTCAAACACCTGGAGCCACTGGG + Intergenic
1069204241 10:65661768-65661790 ATCCAACAGATGGAGCAACTGGG + Intergenic
1070086441 10:73242375-73242397 CTATAACAACTGGATCAATATGG + Exonic
1071724511 10:88183954-88183976 CTCAAACAGTTGCAGCAAAATGG - Intergenic
1072531291 10:96321878-96321900 TTATCACAGCTGGAGCTACATGG + Intronic
1073903816 10:108253387-108253409 TTGTAACAACTGGAGAAACAGGG + Intergenic
1075588960 10:123677714-123677736 CTCTCACAGCTGGGGCTTCACGG + Intronic
1076344204 10:129769224-129769246 CTCTGACAGCCGCAGCAGCAGGG + Intergenic
1081180280 11:39976652-39976674 CTATCACAGCCGGAACAACATGG + Intergenic
1083742842 11:64720318-64720340 CACCAACAGATGGAGCAGCAAGG + Intronic
1084636222 11:70394658-70394680 CAAGACCAGCTGGAGCAACATGG - Intergenic
1084811484 11:71614401-71614423 CTCTGACAGCGGGAGCAAGGTGG - Intergenic
1084854379 11:71972761-71972783 CTCTAGGACCTAGAGCAACATGG + Intronic
1084879760 11:72162595-72162617 CTAGAACAGCTTGGGCAACATGG + Intergenic
1086215534 11:84375007-84375029 GTCTACCAGCTGGAGAAACTGGG - Intronic
1090508443 11:127345169-127345191 CTCTAACTACTGGAGAAAAATGG - Intergenic
1090947214 11:131441557-131441579 CAGTAACAGATGGAGGAACAAGG - Intronic
1092864814 12:12750987-12751009 CAACAACAGCTGGGGCAACATGG - Intronic
1094672349 12:32582769-32582791 CACCAACATCTAGAGCAACAAGG - Intronic
1095291492 12:40484372-40484394 CAGTATCAGCTGGAGTAACAGGG + Exonic
1095291566 12:40484909-40484931 CCATATCAGCTGGAGTAACAGGG + Exonic
1095291569 12:40484939-40484961 GACTATCAGCTGAAGCAACAGGG + Exonic
1095291853 12:40486911-40486933 GACTATCAGCTGAAGCAACAGGG + Exonic
1095292127 12:40488711-40488733 CACTATCAGCTGAAGCAACAGGG + Exonic
1095292258 12:40489671-40489693 CAGTATCAGCTGGAGTAACAGGG + Exonic
1095292261 12:40489701-40489723 GACTATCAGCTGAAGCAACAGGG + Exonic
1095292344 12:40490271-40490293 GACTATCAGCTGAAGCAACAGGG + Exonic
1095292421 12:40490898-40490920 CACTATCAGCTGGAGTGACAGGG + Exonic
1097688381 12:62712006-62712028 CTCTAGCTGCAGGAGCAGCAGGG - Intronic
1098519265 12:71417310-71417332 CTCTAACAGCTGGAGCAACAGGG - Intronic
1098918836 12:76284408-76284430 CCCTTAGAGCTGGACCAACAGGG + Intergenic
1102129382 12:110513923-110513945 CTCAATCAGCCTGAGCAACATGG - Intronic
1103257810 12:119557605-119557627 GTCTATCAGCTGGAGCCAAAGGG + Intergenic
1106291347 13:28365866-28365888 CTGTATCAGATGGACCAACAGGG + Intronic
1106729674 13:32527258-32527280 CTCTAACAGATGGAGAAATTAGG + Intronic
1107991460 13:45822140-45822162 CTGAGACAGCTGGTGCAACAGGG + Intronic
1108709555 13:53019050-53019072 CTCTTAGAGATGGAGCAACCTGG + Intergenic
1110691720 13:78437855-78437877 TTCTAACAGCTAAATCAACAAGG - Intergenic
1114809458 14:25880349-25880371 CTATAACAGATGGAGCAAAAAGG - Intergenic
1115638724 14:35317279-35317301 CTCTCTCTGCTAGAGCAACAAGG - Exonic
1118252196 14:64172387-64172409 CTGGAACAACTGGAGCAGCAAGG + Intronic
1118641926 14:67800592-67800614 CTATAACAACTGGATCAATATGG - Intronic
1121308445 14:92922151-92922173 CCCAAAGAGCTGGAGCATCAGGG + Intergenic
1121310401 14:92932575-92932597 CTCCAAACGCTGGAGCAAGATGG + Exonic
1122283778 14:100639121-100639143 CTCTAGCATCTGGCACAACAGGG + Intergenic
1124112947 15:26808951-26808973 CTCTAATATCTGGATCACCACGG - Intronic
1124533698 15:30526134-30526156 ATCTGACAACTGGAGGAACAAGG + Intergenic
1124587944 15:31026447-31026469 CTCTATCAGTTGGAGCCAAACGG + Intronic
1124764957 15:32481510-32481532 ATCTGACAACTGGAGGAACAAGG - Intergenic
1126012332 15:44314984-44315006 CTATACCAGCTGGATCAAAATGG - Intronic
1126129809 15:45329501-45329523 TTCTACCAGCCTGAGCAACAGGG + Intergenic
1126152426 15:45535635-45535657 CTCTAACAGCTGGGGCTCCTTGG + Intergenic
1126567794 15:50117835-50117857 CTCTATCATTTGCAGCAACATGG + Intronic
1126943945 15:53797343-53797365 AACAAACAGGTGGAGCAACATGG + Intergenic
1127689776 15:61384171-61384193 CTCTTCCAGGTGGAGCCACATGG + Intergenic
1131676520 15:94675731-94675753 CTCTAAGAACTGGAGCCAAATGG + Intergenic
1132565368 16:620004-620026 CTGTGAGAACTGGAGCAACATGG + Intronic
1136035373 16:27535687-27535709 CAATAACAGCTTGACCAACATGG + Intronic
1136510224 16:30733455-30733477 CTCTAAGAGCTGCAGAAACCTGG - Intronic
1136709870 16:32228246-32228268 CGAGACCAGCTGGAGCAACATGG + Intergenic
1136758039 16:32701165-32701187 CGAGACCAGCTGGAGCAACATGG - Intergenic
1136810067 16:33169210-33169232 CGAGACCAGCTGGAGCAACATGG + Intergenic
1136816543 16:33279290-33279312 CGAGACCAGCTGGAGCAACATGG + Intronic
1137417724 16:48299709-48299731 CCCAAGCAGCTGGAACAACATGG + Exonic
1138007845 16:53354644-53354666 ATCTGACAACTGGAGGAACAAGG - Intergenic
1139070437 16:63374588-63374610 CTCTAAGATCTGGAACAACAAGG + Intergenic
1139333508 16:66213202-66213224 CTCTACCAGCCTGGGCAACATGG + Intergenic
1139638964 16:68277285-68277307 CTCGACCAGCTTGACCAACATGG - Intronic
1140398796 16:74652771-74652793 CTCTAACTCCTGGAATAACAAGG + Intronic
1141214575 16:82011380-82011402 CACTCACAGCTGCAGGAACAAGG + Exonic
1203060190 16_KI270728v1_random:961514-961536 CGAGACCAGCTGGAGCAACATGG - Intergenic
1142817255 17:2436115-2436137 CACTAACAGCTGCAGCAAACTGG - Intronic
1143135971 17:4712423-4712445 CTCTGACAGCTGGAGCATATAGG - Intronic
1143136263 17:4714383-4714405 CTCTGACAGCTGGAGCATATAGG - Intronic
1145918078 17:28588446-28588468 ATTGAACAGCTGGAGGAACATGG + Intronic
1147727728 17:42577265-42577287 CTGGAGCAGCTGGCGCAACAAGG - Exonic
1147862457 17:43531501-43531523 TTCTACCAGCTTGATCAACATGG + Intronic
1148606487 17:48933205-48933227 CTCTGCCAGCTGCAGCACCACGG + Exonic
1149206539 17:54254275-54254297 CGCTACCAGCTTGGGCAACACGG - Intergenic
1150121312 17:62605495-62605517 CCCAAGCAGCTGGAGCTACAGGG + Intronic
1150168952 17:62971657-62971679 CTCTAACCCCTGGACCATCATGG + Intergenic
1150617704 17:66784900-66784922 TTCCACCAGCAGGAGCAACATGG - Intronic
1154129556 18:11724961-11724983 CTCTGACACCTCGAGCACCATGG + Intronic
1156677740 18:39550904-39550926 CTCCAACACATGGAGAAACATGG + Intergenic
1158334382 18:56399658-56399680 CTTTTACAGCTGGAGAAACTGGG - Intergenic
1162051460 19:8036428-8036450 CTCTTTCAGCTGCAGAAACACGG - Intronic
1163087758 19:14994531-14994553 CTCTAACCCCTGGAGAAAGATGG - Intronic
1165429657 19:35765267-35765289 GTTTTACAGCTGGAGAAACAAGG - Intronic
1166287700 19:41842227-41842249 TGATAACAGCTGGGGCAACATGG - Intronic
1168586387 19:57597062-57597084 CTTTACCAGCCTGAGCAACATGG + Intergenic
1168608318 19:57777601-57777623 ATGTAACAGCAGAAGCAACAAGG - Intronic
925473586 2:4188772-4188794 CTCTGGCAGATGCAGCAACAAGG + Intergenic
926666292 2:15527503-15527525 CTCTGGCAGATGCAGCAACAAGG - Intronic
927193657 2:20533606-20533628 CGCGAACAGCTTGGGCAACACGG - Intergenic
928429772 2:31207565-31207587 CGATACCAGCTGGGGCAACATGG + Intronic
928997741 2:37312489-37312511 CTATAAGAGCTGGAACAAGAAGG - Intronic
929411963 2:41706969-41706991 CTCGAACAGCTTGAGCAACTTGG - Intergenic
932186833 2:69704550-69704572 CTGTGTCAGCTGGAGCAACAGGG + Intronic
932546472 2:72716017-72716039 CTCTAACAGGAGGAGCAAATAGG - Intronic
936346186 2:111677150-111677172 CACTGACTGCTGGAGCACCACGG + Intergenic
938813918 2:134880161-134880183 CTCTAAAAGCTGGAACACAATGG - Intronic
939735162 2:145835083-145835105 CCCTATCATTTGGAGCAACATGG - Intergenic
942403911 2:175632626-175632648 TTTTAACATCTGGAGCTACATGG + Intergenic
943154232 2:184152243-184152265 CCCTTACAGATGGAGCAATAGGG - Intergenic
944178744 2:196863405-196863427 TTCTATCATCTGCAGCAACATGG + Intronic
945468165 2:210195782-210195804 TTCTAACATCTGGAGGGACAAGG + Intronic
946000278 2:216476511-216476533 CCAGAACAGCTTGAGCAACATGG - Intronic
946490174 2:220141300-220141322 CCCTAATAGCTGAAGCAACCTGG - Intergenic
948810436 2:240472560-240472582 CTCTAAGACCTTGAGGAACAGGG - Intergenic
1169708649 20:8536525-8536547 CTCAAACAGTTGCAGCAAGATGG + Intronic
1172747708 20:37225747-37225769 ATCTACCAGCTGGAAGAACAAGG - Exonic
1177019721 21:15838974-15838996 CTATAACAGCTAGAGAAGCATGG + Intronic
1177404298 21:20645726-20645748 CACTAACAGCCGGGGCACCATGG + Intergenic
1177885767 21:26743498-26743520 CTCTAACAAAAGGAGCAAAAAGG + Intergenic
1179011711 21:37561619-37561641 CACCAACAGCGGGAGCAGCAGGG - Intergenic
1179074039 21:38101241-38101263 CTCTAACGTCTAGTGCAACATGG - Intronic
1179407144 21:41135764-41135786 CAGCAACAGCTGGAGCAAAAGGG - Intergenic
1180984114 22:19894100-19894122 CTCTAACAAATGCTGCAACATGG + Intronic
1184825434 22:46947457-46947479 ATCTAACAGGTGGGGCAATAAGG + Intronic
951554377 3:23905956-23905978 CAAGACCAGCTGGAGCAACATGG + Intronic
951716535 3:25654031-25654053 CTCTAAGATCAGGAGGAACAAGG + Intronic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
955169370 3:56548473-56548495 CTGTCACAGCTGGAGCATCAGGG + Intergenic
957499370 3:81034088-81034110 CACTAACAGCTTGAACAAGAAGG + Intergenic
957946490 3:87069691-87069713 CTCTAATAGCTGGAAAAGCAAGG + Intergenic
959710631 3:109382590-109382612 CTGTAACAACTGGACCCACACGG + Intergenic
964393867 3:156224505-156224527 CTCACAGAGCTGGAGAAACAAGG + Intronic
964894954 3:161584478-161584500 CTTTAACAGCTGGAGTCAAATGG - Intergenic
965246685 3:166280622-166280644 CTCTAGCAGCTGGAAAAGCATGG - Intergenic
966479584 3:180391257-180391279 CTTAAACAGCTTAAGCAACAAGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967116718 3:186347615-186347637 CACTTCCAGCTTGAGCAACACGG - Intronic
967734027 3:192933419-192933441 CAAGAACAGCTTGAGCAACATGG - Intergenic
969734167 4:8975849-8975871 CTCTGACAGCGGGAGCAAGGTGG - Intergenic
972323614 4:37994663-37994685 CTTTAAAAGCAGCAGCAACAAGG - Intronic
972728153 4:41764647-41764669 ATCTGACAGCTGGAACAACTGGG - Intergenic
973911269 4:55583167-55583189 CAAGACCAGCTGGAGCAACATGG - Intronic
978515231 4:109561384-109561406 CTCAGACAGCTGGAGGAAAAGGG - Intronic
978807378 4:112814646-112814668 CTCTCTCAGCCTGAGCAACATGG - Intergenic
979663468 4:123285203-123285225 TTCTGACAGATGGAGCAAAAAGG - Intronic
980299125 4:130965193-130965215 TTGTCACAGCTGGAGCAACTAGG - Intergenic
981751923 4:148100897-148100919 CTCTGACATCTGCTGCAACATGG + Intronic
982741520 4:159061838-159061860 CTGAAACAGCAGGAGCACCATGG + Intergenic
982841135 4:160187946-160187968 CGAGACCAGCTGGAGCAACATGG - Intergenic
982863091 4:160479213-160479235 CTCTTCCAGCCTGAGCAACATGG + Intergenic
983366950 4:166803476-166803498 CTCAAAAAGCAGGAGCAACTAGG + Intronic
985294416 4:188419784-188419806 CTTTAACAGATGGAGCTAAAGGG - Intergenic
988171175 5:27658287-27658309 CTTTAACAACAGGAGTAACAGGG - Intergenic
992526870 5:77620113-77620135 CTCAAGGAGCTGGAGCAAAAGGG - Intronic
992639374 5:78755608-78755630 CTTCAACAGATGGAGCTACATGG + Intronic
996693301 5:126364897-126364919 CTCCCACACCTGGAGCACCAGGG - Intronic
996893549 5:128453257-128453279 CTTTAACAGCTGGAACACGATGG - Intronic
999166469 5:149553273-149553295 CCCTAGTAGCTGGAGCTACAAGG - Intronic
1000499246 5:162028075-162028097 ATCTAAAAACTGGAACAACAAGG + Intergenic
1000599299 5:163252978-163253000 CTCTCACCTCTGGAGAAACACGG - Intergenic
1000625865 5:163537549-163537571 CGAGACCAGCTGGAGCAACATGG - Intergenic
1001715725 5:173814267-173814289 CTCTAAAAGCAGCAGAAACAAGG - Intergenic
1002146668 5:177188857-177188879 CTTTAACAGCTTGGGCAACGTGG + Intronic
1004094100 6:12535647-12535669 CTCTAACAGGGGGAGAAAGAGGG - Intergenic
1004726940 6:18320010-18320032 CGAGAGCAGCTGGAGCAACATGG - Intergenic
1005473834 6:26188181-26188203 CTGTAGCTGCTGGAGAAACAAGG - Intergenic
1013154731 6:107482441-107482463 CTACAACTGCTGCAGCAACAAGG + Intergenic
1013237148 6:108207192-108207214 CCCTAAAATCTGGAGAAACAGGG - Intergenic
1015648943 6:135431967-135431989 CTCTACCCACTGGAGTAACATGG + Intronic
1015686720 6:135871391-135871413 CCCAAACAGCAGAAGCAACAGGG + Intronic
1017223604 6:151994598-151994620 CTGTCACAGATGGAACAACAAGG - Intronic
1018895428 6:168013281-168013303 CCCTACCAGCTGGAGGAACCTGG - Intronic
1019854495 7:3590981-3591003 CTCTACCAGCCTGGGCAACATGG - Intronic
1020041363 7:5005125-5005147 CTGTGTCAGCTGGAGCAACAGGG + Intronic
1021170497 7:17393519-17393541 CTTTATCAGCAGCAGCAACATGG - Intergenic
1023465560 7:40450572-40450594 CTCGACCAGCCTGAGCAACAAGG + Intronic
1024540858 7:50474053-50474075 GTCTCACAGCAGGACCAACAGGG + Intronic
1024779919 7:52836070-52836092 TTCTATCAACTGGAGGAACAGGG - Intergenic
1025741069 7:64196127-64196149 CTCTAACAGCTGGAACTCCTTGG + Intronic
1027153210 7:75747749-75747771 CCCAAACATCTGGAGAAACATGG - Intergenic
1029355064 7:100045663-100045685 CTCTACCAGCCTGGGCAACATGG + Intergenic
1033278858 7:139991856-139991878 CTCTAGCAGGTGGGGCAAGAGGG + Intronic
1035174729 7:157042181-157042203 CTGGAACAGCTGGAGCCACAGGG - Intergenic
1035477174 7:159152099-159152121 CTCTGCAAGCTGGAGCACCAGGG + Intergenic
1038355840 8:26828534-26828556 CTCTATCAGCTGGGGAAAGAAGG + Intronic
1038986333 8:32815372-32815394 TTCTATCATCTGCAGCAACATGG + Intergenic
1039474781 8:37833953-37833975 CTCTACCAGCTGGGGGGACAGGG - Exonic
1039647607 8:39304746-39304768 CTCCAGAAGATGGAGCAACAAGG - Intergenic
1039765556 8:40624539-40624561 CACTATAGGCTGGAGCAACAAGG - Intronic
1039934070 8:42024737-42024759 CTCTATCATTTGCAGCAACACGG - Intronic
1041594327 8:59629435-59629457 CTCTAGCAGCTGGACCAAAAGGG + Intergenic
1042908234 8:73796641-73796663 CTGTAACAGCTAGATCAACAGGG + Intronic
1045102618 8:98860852-98860874 CGAGAACAGCTTGAGCAACATGG + Intronic
1045617913 8:103939388-103939410 TTGTCACAGCTGGAGCAACTGGG + Intronic
1046473506 8:114710533-114710555 CTCTAGAAGATGCAGCAACAAGG - Intergenic
1048188119 8:132263205-132263227 CTGTAAGAGCTGGAGCATCCAGG - Intronic
1050388992 9:5117091-5117113 CTCTAAAAGATGTGGCAACAAGG + Intronic
1051286347 9:15501348-15501370 CTCGAAGAGCTGGATCAGCAGGG - Intronic
1053437684 9:38087615-38087637 AACTAACAGCCTGAGCAACATGG - Intergenic
1060990184 9:127844627-127844649 CAATACCAGCTTGAGCAACATGG - Intronic
1187911942 X:24119326-24119348 CTAGACCAGCTGGAGCAACATGG - Intergenic
1191850127 X:65580143-65580165 CTCAAACACCTGCAGCAACTTGG - Intergenic
1193723354 X:85013379-85013401 CTCTAGGAACTGGAGAAACAAGG - Intronic
1195769086 X:108329872-108329894 CTCTTTCAGCTTGAGCAACAGGG + Intronic
1198053328 X:132969790-132969812 CTAGAACAGCTTGGGCAACACGG - Intergenic
1198222149 X:134612655-134612677 CTCTAAGCCCTGGAGCCACAGGG + Intronic
1198776324 X:140183240-140183262 CACTTACAGTTGGAGCAATATGG - Intergenic
1199885303 X:152015394-152015416 CTGTAGCAGCTGTAGCACCAAGG - Intergenic
1200013543 X:153140165-153140187 CTCTAACAGAGGGAGAGACAGGG + Intergenic
1200026058 X:153259753-153259775 CTCTAACAGAGGGAGAGACAGGG - Intergenic
1201010646 Y:9546598-9546620 CCCTCACAGCTGCAGCAACGTGG + Intergenic