ID: 1098520439

View in Genome Browser
Species Human (GRCh38)
Location 12:71430067-71430089
Sequence GAGAAGACCCTCTCATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098520436_1098520439 -3 Left 1098520436 12:71430047-71430069 CCTTAGAGCTCATGAAGCCAGAG 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 152
1098520435_1098520439 20 Left 1098520435 12:71430024-71430046 CCATAAGCTTCAGGTTTGCTTGT 0: 1
1: 0
2: 1
3: 17
4: 202
Right 1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 152
1098520434_1098520439 21 Left 1098520434 12:71430023-71430045 CCCATAAGCTTCAGGTTTGCTTG 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 152
1098520433_1098520439 22 Left 1098520433 12:71430022-71430044 CCCCATAAGCTTCAGGTTTGCTT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098520439 Original CRISPR GAGAAGACCCTCTCATCCCA GGG Intronic
903014845 1:20355183-20355205 CAGAGGACCCCCTGATCCCATGG - Intergenic
903052228 1:20609898-20609920 GAGAGGTCCCCATCATCCCATGG + Intronic
905170399 1:36106544-36106566 GAGCAGACCCTCCCCTCCCTCGG - Intronic
906130895 1:43454919-43454941 GAGAAACCCATGTCATCCCAAGG + Intergenic
909600057 1:77451826-77451848 GACAAGACCCTCCTACCCCAGGG + Intronic
909992494 1:82240144-82240166 CAGAAGACCATCTACTCCCATGG - Intergenic
911056277 1:93711025-93711047 GAGAACACCCAGTCAGCCCATGG - Intronic
911864624 1:103002238-103002260 CAGAAGCCCCTCTCTTCCCAGGG - Intronic
913129790 1:115828884-115828906 GATGAGACCCTCGCGTCCCAGGG - Intergenic
915075584 1:153306122-153306144 GGGAAGACCCAGCCATCCCAGGG + Intronic
917540014 1:175902914-175902936 GATAAGACCCTTTCCTCCAAGGG + Intergenic
917741389 1:177964850-177964872 GATAAGAACCTCCCTTCCCAGGG + Intronic
919513107 1:198490939-198490961 TAGCAGACCCTTTCATTCCAGGG - Intergenic
919669656 1:200327362-200327384 GAGAAGACACCCCCATCCCATGG + Intergenic
919732369 1:200921486-200921508 GAGAACACCCCCTCCACCCAAGG - Intergenic
920075093 1:203330319-203330341 GAGATGGCCCTTTTATCCCAGGG - Intergenic
922516334 1:226210828-226210850 CCCAAGACCCTTTCATCCCATGG + Intergenic
924821080 1:247491392-247491414 GAGAAGACCATCACCTACCACGG + Intergenic
924905938 1:248452796-248452818 GAGAAGACCCTCCATGCCCATGG - Exonic
924921951 1:248639238-248639260 GAGAAGACCCTCCATGCCCATGG + Exonic
1063512910 10:6663606-6663628 GAGGAAACCCTCTTTTCCCAAGG - Intergenic
1066686486 10:37986606-37986628 CAGAAGATCACCTCATCCCAGGG - Intergenic
1068797380 10:61098478-61098500 GAGAGGACCCTCTAATCCTAGGG + Intergenic
1071973371 10:90930655-90930677 GAGAGGACCTTTTCATCCCCTGG - Intergenic
1075377950 10:121994647-121994669 GAGAAGGCCCTCTCTTCCAGAGG - Intronic
1075978767 10:126719489-126719511 GAGCACACCCTCTGAGCCCAAGG + Intergenic
1076313719 10:129526281-129526303 GGGAAGCCCCTCTCATCCTCAGG - Intronic
1077268059 11:1661790-1661812 GAAAAGACCCTCCCCTCCCCGGG + Intergenic
1077272860 11:1689944-1689966 GAAAAGACCCTCCCCTCCCCGGG - Intergenic
1077398171 11:2336848-2336870 CAGAAGACCCCCTCAAACCAGGG - Intergenic
1077544656 11:3164266-3164288 GGGCAGACCCGCTCAGCCCAAGG + Intronic
1080787853 11:35492312-35492334 AGGAAGAACCTCTCATCTCAAGG + Intronic
1083912523 11:65718631-65718653 GAGAAGCCCCTCTCAGACCTTGG + Exonic
1088517719 11:110656612-110656634 CAGCAAACCCTCTCATCCCCAGG - Intronic
1089764436 11:120752517-120752539 GAGAAGACCCTCTGGGCTCAGGG - Intronic
1090910106 11:131111269-131111291 GAGAAGAGCTGCTCACCCCAGGG - Intergenic
1095876954 12:47089724-47089746 GATAAGACACTGTCATCCCCAGG + Intronic
1097473269 12:60021835-60021857 GAAAAGACCCAGTCCTCCCAGGG - Intergenic
1097683742 12:62672970-62672992 CAGAAGACCCCCTCATTTCACGG + Intronic
1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG + Intronic
1098726445 12:73973955-73973977 GGGAAGGCCCTCTTAACCCATGG - Intergenic
1099438404 12:82670336-82670358 GAGAATCCCCACTAATCCCATGG - Intergenic
1100299483 12:93294051-93294073 GAGGAGAGCCTTTCATCCGAAGG + Intergenic
1100739768 12:97579152-97579174 GAGAAGATTTTCTCATCACATGG + Intergenic
1101871851 12:108572060-108572082 GAGAAGATCATCTCCACCCAGGG + Intergenic
1102718399 12:114994962-114994984 GAAAACAGCCTTTCATCCCAGGG - Intergenic
1105017995 12:132797901-132797923 AAGAAAATCCTCTCATCCCTAGG + Intronic
1107709870 13:43141185-43141207 GAGAACACTGTCTCTTCCCAGGG - Intergenic
1109081159 13:57903159-57903181 TAGAAGACCGTCACATCCAAGGG + Intergenic
1111184766 13:84719812-84719834 GAGAGGACCCTCTTATCATAAGG + Intergenic
1111959879 13:94798529-94798551 GAGAAGACCCACTCAGCACTTGG + Intergenic
1111984307 13:95050228-95050250 GAGAAGACCCTCAGACTCCACGG + Intronic
1115434302 14:33355686-33355708 GAGAAGTTTCTCTCATCTCAGGG + Intronic
1117720240 14:58622193-58622215 TAGAATACCCTGTCCTCCCAGGG - Intergenic
1117816133 14:59599666-59599688 GGGAAGTCCATCTCATCTCAGGG + Intronic
1121087101 14:91154996-91155018 GAGAAGGCCCTCTAGGCCCAGGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122903088 14:104789991-104790013 GAGATGACGCTCACCTCCCAAGG + Intronic
1202947398 14_KI270726v1_random:41523-41545 GGGAAGTGCCTCTGATCCCAGGG + Intergenic
1125479966 15:40073101-40073123 GGGAAGAGCCTGGCATCCCAGGG + Intergenic
1127672727 15:61211415-61211437 TAGAAGACACTGGCATCCCAAGG + Intronic
1127872194 15:63082946-63082968 GAGAAGCCCCTCCCCTTCCAAGG - Intergenic
1128526230 15:68414257-68414279 GAGAAGCCTCTGTCATTCCAAGG - Intronic
1136281900 16:29218223-29218245 GAGACGACCCTCACATCCCAGGG + Intergenic
1137291239 16:47053372-47053394 GAGAAGACCACCACTTCCCAGGG - Intergenic
1137571253 16:49567773-49567795 CAGAAGACCCTCCCTTCCCATGG + Intronic
1140950284 16:79810414-79810436 GGGCAGAGCCCCTCATCCCAAGG + Intergenic
1142086274 16:88184139-88184161 GAGACGACCCTCACATCCCAGGG + Intergenic
1143147003 17:4782915-4782937 GAGAAGAGCGTCACATTCCAGGG - Exonic
1145932705 17:28697521-28697543 GAGAAGCCCATCCCCTCCCATGG + Intronic
1146673602 17:34758235-34758257 GAGAACACCACCTCCTCCCAGGG - Intergenic
1146824219 17:36009306-36009328 CAGCAGAGCCTCTCCTCCCATGG + Intergenic
1148468184 17:47877405-47877427 TGGAAGACCCTCTGATCCCAGGG - Intergenic
1150529185 17:65959040-65959062 GAGAGGAGCAACTCATCCCAGGG + Intronic
1151697170 17:75723642-75723664 GAGAAGCCCTTCTCAGGCCAAGG - Intronic
1152266617 17:79298675-79298697 GAGATGACCCTCGGATCTCAGGG - Intronic
1155007625 18:21741997-21742019 GAAAAGACCCTCTACCCCCAAGG + Intronic
1155568658 18:27165472-27165494 GACTAAATCCTCTCATCCCATGG + Intronic
1156651063 18:39227882-39227904 CAGCAGCCCCTCTCATCACAGGG + Intergenic
1157340206 18:46771490-46771512 GAGAAGGCCCACTCTTGCCAGGG - Intergenic
1158666930 18:59440743-59440765 GGGAAGATCATCTCACCCCAAGG + Intronic
1159885527 18:73900605-73900627 GAGGAGACACACTCATCCCCTGG + Intergenic
1159974429 18:74692693-74692715 GAAAACACCCTCTAACCCCAGGG - Intronic
1161055148 19:2187219-2187241 GACAACACCCACTCATCCGAGGG - Intronic
1161090658 19:2358369-2358391 GAGAAGAGCCTGTGACCCCATGG - Intergenic
1162890818 19:13731910-13731932 GAGAAGACCATCGCCTTCCAGGG + Exonic
1164779447 19:30880730-30880752 GAGAAGACCCACTCAAGTCATGG + Intergenic
1165894181 19:39131618-39131640 GGGAACACTCTCCCATCCCAGGG + Intronic
1165995653 19:39841738-39841760 AAGAAGTCCCTCTCAGCTCAGGG + Intronic
925838892 2:7972314-7972336 GAGAAAACACTCTCATCTGAAGG - Intergenic
926405146 2:12543847-12543869 CAGAAGGCCCTCCCGTCCCAGGG + Intergenic
928201437 2:29250034-29250056 GAGAAGTCCCTCTCCTTCCCAGG + Intronic
929724236 2:44407453-44407475 GAGAAAACCCACTCATGCCAAGG - Intronic
932081216 2:68716734-68716756 GAGATGACCCTAAGATCCCACGG - Intronic
937865864 2:126751531-126751553 GTGAAGGGCCTCTCATGCCAGGG + Intergenic
938631024 2:133167828-133167850 GGGAAGACACTTTCTTCCCATGG - Intronic
942355917 2:175109882-175109904 GAGAAGACCCTAAAAACCCAAGG - Intronic
945581086 2:211595461-211595483 TACAAGACCCTCTCATCCTCTGG - Intronic
949052808 2:241906131-241906153 GGGAAGCTCCTGTCATCCCAGGG + Intergenic
1169813708 20:9634360-9634382 GAGAAGACAGTATCACCCCAGGG - Intronic
1172040895 20:32044939-32044961 GAGATGTCTCTCTCAACCCATGG + Intergenic
1172403220 20:34667968-34667990 GAGAGGACCATATCATCTCAGGG + Intronic
1176138323 20:63534707-63534729 GAGAAGCCCCTGCCCTCCCAGGG + Intronic
1179485897 21:41710620-41710642 GACCAGACCCTCTCAGCCCGTGG + Intergenic
1180099752 21:45579005-45579027 GAGGTGACCCTCTCCTCCCCCGG - Intergenic
1180950090 22:19717032-19717054 CAGGAGAGCCTTTCATCCCAGGG - Intronic
1183476674 22:38039486-38039508 GGGCAGATCCTCTCTTCCCAGGG + Intronic
1183567811 22:38628731-38628753 TACAAGCCCCTCTGATCCCATGG - Intronic
1185095384 22:48803522-48803544 AAGGAGACCCTCTGATCCCAAGG - Intronic
951836526 3:26989298-26989320 GACAAGAGCCTCTCATAACATGG + Intergenic
952884465 3:38003941-38003963 GAGGAGCTCCTCCCATCCCAGGG + Intronic
953742246 3:45547799-45547821 GAGGAGGCCATCTGATCCCATGG + Exonic
955690854 3:61589416-61589438 GAGAAGACCCTTGTATCTCATGG - Intronic
960487893 3:118275691-118275713 GAGAAGACCCTCTAAGGCAATGG - Intergenic
960992494 3:123321095-123321117 GAGGGGACCCTCTGAGCCCAGGG - Intronic
961333678 3:126157596-126157618 CAGGAGGCCCTCTCTTCCCAGGG + Intronic
962406646 3:135106323-135106345 GAGATGCCCCTCTCGTACCAAGG - Intronic
962606466 3:137036396-137036418 GTGAAGACCCTCCCCTCCCTGGG - Intergenic
964229067 3:154441432-154441454 GAAAATAACCTCTCATCCCAAGG + Intergenic
970870135 4:20807337-20807359 GTGAAGACCCTGTAATCACATGG + Intronic
971165549 4:24179340-24179362 GTGCAGCTCCTCTCATCCCAGGG + Intergenic
973737455 4:53886551-53886573 GAGAAGCTCCTCTCTTCACATGG - Intronic
975485248 4:74928259-74928281 GATAAGACCCTCAAAACCCAAGG + Intergenic
979920146 4:126486703-126486725 GAAATGATCTTCTCATCCCAGGG - Intergenic
987219222 5:15772419-15772441 GACAAAACCCTCTCTTTCCATGG + Intronic
994474916 5:100254743-100254765 GAGTTAACCCACTCATCCCATGG - Intergenic
996263110 5:121499108-121499130 GAGGAGAACATCTCATACCAGGG + Intergenic
999320001 5:150608474-150608496 GGTAAGAGCCTCTCCTCCCATGG + Intronic
1001436793 5:171705494-171705516 GACGTGACCCTCTCCTCCCAGGG + Intergenic
1001554083 5:172624538-172624560 TAGCAGATCCGCTCATCCCAGGG + Intergenic
1002088843 5:176792822-176792844 GAGGGGACCCTGTCATCCCCAGG - Intergenic
1003134997 6:3428179-3428201 GCAGAGACCCTCTCATGCCAAGG + Intronic
1006277907 6:33020995-33021017 AAGCAGACTCTCTCATACCAAGG + Intergenic
1007803598 6:44419512-44419534 GAGAAGTCACTCTCATGCAATGG - Exonic
1011699683 6:89943904-89943926 GAGGAGACCCTCAGATCCCAGGG + Intronic
1012015159 6:93840951-93840973 GATAAGGCCCACTCATACCAAGG + Intergenic
1012032253 6:94086489-94086511 GAGAAAGGCCTCTCATGCCATGG - Intergenic
1012379718 6:98605660-98605682 GAGAATACCCTGTCCTCCGATGG + Intergenic
1021470904 7:21001656-21001678 GAAAAGTCCCTCTCATCCTCAGG + Intergenic
1022774340 7:33509593-33509615 CAGAAGAGCCTCTCAGCTCAAGG + Intronic
1025959298 7:66205823-66205845 GAGACGAGGGTCTCATCCCAGGG - Intronic
1026288881 7:68988050-68988072 GTGCTGACTCTCTCATCCCAGGG - Intergenic
1026327143 7:69320584-69320606 AAGAGGAGCCTCTCAACCCATGG + Intergenic
1027404164 7:77842073-77842095 GAAATGACCCTCTTATCCAAGGG + Intronic
1029327671 7:99823753-99823775 GAGAGGAGCCTCCCAACCCAGGG + Intergenic
1029690455 7:102177866-102177888 GAAAAGTCCCTGTCTTCCCAGGG - Intronic
1029694514 7:102204115-102204137 GGGAAGAGGGTCTCATCCCAGGG - Intronic
1032195381 7:129785656-129785678 GAAAAGACCGTCCCATCCCCGGG - Intergenic
1032958156 7:136997984-136998006 GAGAAAACACCCTTATCCCAAGG + Intronic
1034437504 7:151070185-151070207 GAGAAGTCCTTCTCATCACTTGG - Exonic
1039333260 8:36562119-36562141 GACAAGACCCTCTCTTGGCATGG - Intergenic
1039414231 8:37379851-37379873 GAGAAGCCCCGCCCAGCCCAAGG + Intergenic
1045491206 8:102670871-102670893 GAAAAGACCCTCACAGCCCAGGG + Intergenic
1046232264 8:111373476-111373498 CAGAAGCCCCTCCCATCACAGGG + Intergenic
1048980648 8:139702082-139702104 GAGCAAACTCTCTCCTCCCAGGG + Intronic
1049241045 8:141537491-141537513 GAGAAGAGCCCCTTCTCCCACGG - Intergenic
1053518596 9:38753854-38753876 GAGAAGACTATTTGATCCCAGGG - Intergenic
1056076490 9:83046733-83046755 GAGACGACTGTGTCATCCCAGGG + Intronic
1059517777 9:114911753-114911775 GAAAAGACCTTAACATCCCAAGG - Intronic
1060750065 9:126163052-126163074 GGGGAGACCCTCGCCTCCCATGG + Intergenic
1061526578 9:131169770-131169792 GACATGCCCCTCTCATCACATGG - Intronic
1062027608 9:134347701-134347723 GAGAAGGACCTCTCAGGCCAGGG + Intronic
1186443860 X:9608902-9608924 GAGGAGAAACTCTCTTCCCAAGG - Intronic
1186776871 X:12873637-12873659 TAGAAGTCCCCCTCTTCCCAGGG + Intronic
1192139562 X:68636147-68636169 ATGAAGTCCCTCTCCTCCCAAGG + Intergenic