ID: 1098523519

View in Genome Browser
Species Human (GRCh38)
Location 12:71460650-71460672
Sequence TCAGGGACACGTAATGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098523519_1098523525 -4 Left 1098523519 12:71460650-71460672 CCACAGACATTACGTGTCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1098523525 12:71460669-71460691 CTGAACCGGTGGAAAAGTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1098523519_1098523528 11 Left 1098523519 12:71460650-71460672 CCACAGACATTACGTGTCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1098523528 12:71460684-71460706 AGTGGAGGCAGAATCAGACTGGG 0: 1
1: 0
2: 0
3: 15
4: 215
1098523519_1098523527 10 Left 1098523519 12:71460650-71460672 CCACAGACATTACGTGTCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1098523527 12:71460683-71460705 AAGTGGAGGCAGAATCAGACTGG 0: 1
1: 0
2: 1
3: 9
4: 249
1098523519_1098523522 -7 Left 1098523519 12:71460650-71460672 CCACAGACATTACGTGTCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1098523522 12:71460666-71460688 TCCCTGAACCGGTGGAAAAGTGG 0: 1
1: 0
2: 1
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098523519 Original CRISPR TCAGGGACACGTAATGTCTG TGG (reversed) Intronic
900323926 1:2098374-2098396 GCAGGGACAAGTAGTGGCTGTGG + Intronic
901254211 1:7807245-7807267 TCAGGTACACCATATGTCTGTGG - Intronic
901346602 1:8549789-8549811 TCAGAAACATGTAATTTCTGTGG + Intronic
905838693 1:41154030-41154052 TTAGGCACACATACTGTCTGTGG - Intronic
907424464 1:54370756-54370778 TCAGGAACATGTAGTGCCTGAGG - Intronic
907653038 1:56314316-56314338 TCAGGGACATGTAATGTTACTGG + Intergenic
910910741 1:92231116-92231138 TCAAGAACACGCAAGGTCTGAGG - Intronic
911356226 1:96824042-96824064 TCAGGTAAACAAAATGTCTGTGG + Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
917298323 1:173545452-173545474 CCATGGACACGTAATTTCTCAGG + Intronic
917456905 1:175193133-175193155 GCAAGGACACGTAATGGCGGGGG - Intergenic
921274943 1:213510200-213510222 ACAGGCACAGGTAATGCCTGGGG - Intergenic
1068229440 10:54152804-54152826 TCAGTGGCATGTAATGTCTCAGG - Intronic
1070670754 10:78375697-78375719 TCATGGACAGGCAATGCCTGTGG - Intergenic
1075209146 10:120476180-120476202 TCAGGGACACGTTTTGCCTGGGG + Intronic
1080276799 11:30512279-30512301 TCAAGGCCACTGAATGTCTGAGG - Intronic
1088714467 11:112536670-112536692 TTAGGAACAGGTAATGTCTAGGG - Intergenic
1089718138 11:120383756-120383778 TCATGGACCAGTATTGTCTGTGG + Intronic
1098523519 12:71460650-71460672 TCAGGGACACGTAATGTCTGTGG - Intronic
1099434140 12:82623501-82623523 CCTGGGACATGTAATGTCTTTGG - Intergenic
1100105859 12:91171273-91171295 TGGGGGACATGTAATATCTGTGG + Intronic
1102699193 12:114824278-114824300 ACAGGGACCCATAATGCCTGTGG + Intergenic
1103241184 12:119414488-119414510 TCAGGGAGGCTTAATGGCTGAGG + Intronic
1107402469 13:40082992-40083014 TCAGGGCCTCGAAAGGTCTGCGG - Intergenic
1110881136 13:80574115-80574137 GCAGGAAAAAGTAATGTCTGTGG - Intergenic
1111310095 13:86472931-86472953 TCAGGCACAAGTAATATATGGGG - Intergenic
1111668780 13:91302507-91302529 TCAGAGACATGAAATGGCTGGGG + Intergenic
1114429595 14:22649097-22649119 TCAGAGACAAGTAATGACTGAGG + Intergenic
1116543862 14:46137095-46137117 TCAGGGTCATGTTATGTGTGGGG - Intergenic
1122009406 14:98733496-98733518 ACAGGGCCACGGAATTTCTGAGG + Intergenic
1122406119 14:101502092-101502114 TCAGGGACATGCAAAGTCCGAGG + Intergenic
1123075711 14:105666454-105666476 TCAGGGACAGGGAACGTGTGGGG + Intergenic
1124447905 15:29755049-29755071 TCAGGGACCACTATTGTCTGTGG - Intronic
1130396893 15:83510492-83510514 TCATTGACAGGCAATGTCTGTGG - Intronic
1135627164 16:24006005-24006027 TCAAGGATAAGTAATGTCAGGGG + Intronic
1152385515 17:79971919-79971941 GCAGGGACAAGGAAGGTCTGCGG + Intronic
1152581572 17:81167662-81167684 CCAGGGACCCCTAAGGTCTGAGG - Intergenic
1162421826 19:10569770-10569792 GCAGGGACACCTATGGTCTGGGG + Intergenic
1167510044 19:49891038-49891060 TCTGGGAGACGTGATGTCCGAGG - Exonic
925957613 2:8983076-8983098 TCAGTGACCTGTAAAGTCTGTGG - Intronic
928356353 2:30619807-30619829 TCTGGGACACGAAATGACTAAGG - Intronic
929176520 2:38983217-38983239 TCAGGGACCAGAAATGGCTGAGG - Exonic
930579110 2:53188324-53188346 TCGGGGAAACAAAATGTCTGTGG - Intergenic
930843569 2:55875971-55875993 TCAGGGACATCAAGTGTCTGTGG + Intronic
934138630 2:89022381-89022403 ACAGGGACCTATAATGTCTGAGG + Intergenic
934230617 2:90178182-90178204 ACAGGGACCTATAATGTCTGAGG - Intergenic
938752174 2:134343132-134343154 CCAGGGACAAGTACTGCCTGGGG + Intronic
948023201 2:234754363-234754385 TCAGAGAGAAGGAATGTCTGTGG + Intergenic
948886619 2:240888123-240888145 GCGGGGACATGTGATGTCTGGGG - Intronic
1169426178 20:5498975-5498997 CCAGGGATTCCTAATGTCTGAGG - Intergenic
1172029515 20:31971842-31971864 TCAGGGGCAAGTAGTGTCCGAGG + Intronic
1174486152 20:50862567-50862589 CCAAGGACACCTCATGTCTGAGG + Intronic
1181198007 22:21202020-21202042 TCAGGGACAAGTAGGGGCTGGGG - Intergenic
1181703695 22:24634879-24634901 TCAGGGACAAGTAGGGGCTGGGG + Intergenic
950563508 3:13749707-13749729 TCAGGAACAGATAATGGCTGAGG - Intergenic
961568058 3:127777698-127777720 TCCAGGGCACGTGATGTCTGAGG - Intronic
962457473 3:135578093-135578115 TCAGGAAAAAGGAATGTCTGTGG - Intergenic
963110405 3:141683473-141683495 TCATGAACAAGTAATGACTGAGG - Intergenic
966787237 3:183632605-183632627 TCAGGGAGCAGGAATGTCTGGGG - Intergenic
975518067 4:75268478-75268500 TCAGGGACACCTTATGTCATAGG + Intergenic
977279165 4:95017559-95017581 TCAGTCACAGGTAATGTTTGAGG + Intronic
979626985 4:122856017-122856039 TCAGAGACACATATGGTCTGTGG - Intronic
982140217 4:152310386-152310408 GCAGAGACATGGAATGTCTGTGG + Intergenic
984065228 4:175039131-175039153 TCAGGGACATTTGATGTCTATGG - Intergenic
986319418 5:6615985-6616007 TCAGGGACACTTATTATCTGGGG - Intronic
1000664138 5:163973502-163973524 TCTGAGACACCTAATTTCTGAGG - Intergenic
1002291143 5:178201803-178201825 TCAGTGACGTGTAAAGTCTGAGG - Intergenic
1005853484 6:29841093-29841115 TCAGCTACACATAATGTGTGTGG + Intergenic
1007270245 6:40630681-40630703 TCAGGGCCACCCAAGGTCTGTGG - Intergenic
1007375283 6:41452103-41452125 TCAGTGACACGTCCTGTCAGAGG + Intergenic
1007875559 6:45097208-45097230 TCAGGGACACCTCATATTTGAGG - Intronic
1009514942 6:64603339-64603361 TCAGGGAAACAAAATCTCTGTGG - Intronic
1011133541 6:84075675-84075697 TGTGAGGCACGTAATGTCTGGGG - Intronic
1017535374 6:155341639-155341661 TCAGGAACACATGATGTCAGTGG - Intergenic
1022515208 7:30970824-30970846 CCAGGGACATGTAGTTTCTGCGG + Intronic
1026306787 7:69149354-69149376 TGAGGCACAAGTAAAGTCTGTGG + Intergenic
1027981673 7:85232161-85232183 TGAGGGACAGTTAATTTCTGAGG - Intergenic
1038127343 8:24689489-24689511 TCAGGCAAAAGTAATGTCTGAGG - Intergenic
1046071915 8:109265893-109265915 CCAGGGACCTGTAAGGTCTGTGG + Intronic
1049827402 8:144678435-144678457 TCAGACTCAGGTAATGTCTGTGG - Intergenic
1056534359 9:87515260-87515282 TTTTGGACACATAATGTCTGTGG - Intronic
1058133469 9:101279553-101279575 TCAAGGACAGGTAATATCTTAGG + Intronic
1059936884 9:119320681-119320703 TCAGGGAAAAGCAATGTCAGTGG + Intronic
1188526304 X:31091582-31091604 TCAGGGTCCTGTAAAGTCTGAGG - Intergenic
1194951316 X:100129933-100129955 GCAGGGACAGTTGATGTCTGGGG + Intergenic
1195674321 X:107496291-107496313 CCAGCAACACTTAATGTCTGTGG - Intergenic
1195962443 X:110400026-110400048 TTAGGGACATGTTATGTGTGTGG + Intronic