ID: 1098523568

View in Genome Browser
Species Human (GRCh38)
Location 12:71461039-71461061
Sequence GCCACAGCATCCACATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098523562_1098523568 7 Left 1098523562 12:71461009-71461031 CCCAGGAATTGTTCCTTATCCAC 0: 1
1: 0
2: 1
3: 6
4: 143
Right 1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG 0: 1
1: 1
2: 2
3: 12
4: 175
1098523564_1098523568 -6 Left 1098523564 12:71461022-71461044 CCTTATCCACTCTCCTTGCCACA 0: 1
1: 0
2: 4
3: 22
4: 315
Right 1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG 0: 1
1: 1
2: 2
3: 12
4: 175
1098523563_1098523568 6 Left 1098523563 12:71461010-71461032 CCAGGAATTGTTCCTTATCCACT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG 0: 1
1: 1
2: 2
3: 12
4: 175
1098523561_1098523568 21 Left 1098523561 12:71460995-71461017 CCATGACAGATCTTCCCAGGAAT 0: 1
1: 0
2: 0
3: 12
4: 239
Right 1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG 0: 1
1: 1
2: 2
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098523568 Original CRISPR GCCACAGCATCCACATTTGG AGG Intronic
900765932 1:4505370-4505392 GTCACTGCATCCCCATGTGGTGG - Intergenic
904038308 1:27570404-27570426 GCCTCAGTATCCCCATTTGAAGG - Intronic
904594289 1:31633284-31633306 GCCTCAGGATCCACATTGGGAGG + Exonic
904859199 1:33522121-33522143 GCCCCAGACTGCACATTTGGGGG - Intronic
906538456 1:46565696-46565718 GGCACAGCATCCAGTTCTGGTGG - Intronic
907550557 1:55301297-55301319 GCGACTGCAGCCACATTTGAAGG + Intergenic
908194538 1:61736048-61736070 GCCTCAGCATCCCAAATTGGTGG - Intergenic
909633587 1:77791676-77791698 GCCTCAGCCTCCTGATTTGGTGG + Intronic
909750252 1:79150813-79150835 GTTACAGCATCCACATGTGCGGG + Intergenic
913216204 1:116622973-116622995 GCCACAGCATGCTGAATTGGTGG + Intronic
913598100 1:120396798-120396820 GCCACAGCACCCCAATGTGGGGG - Intergenic
914089229 1:144482522-144482544 GCCACAGCACCCCAATGTGGGGG + Intergenic
914309382 1:146451693-146451715 GCCACAGCACCCCAATGTGGGGG - Intergenic
914592729 1:149121444-149121466 GCCACAGCACCCCAATGTGGGGG + Intergenic
915628926 1:157137284-157137306 CCCTCAGCATCCACATTAGCAGG + Intronic
918941200 1:191000499-191000521 GCCACATCAGCCTCCTTTGGGGG + Intergenic
919365283 1:196651875-196651897 GTCACAGCATTAACATTTAGTGG + Exonic
919470536 1:197973594-197973616 GTCACAGCATCCAGAGTTGTAGG + Intergenic
919695099 1:200566715-200566737 GCCTCAGCGTCCACAGTAGGTGG + Intronic
920008686 1:202852189-202852211 GCCTCAGCCTCCCCATGTGGTGG - Intergenic
920978497 1:210808948-210808970 CCCAAAGAATCCACATTTGGAGG - Intronic
921639515 1:217535462-217535484 GCCTCAGCCTCCACAGTAGGTGG + Intronic
922719501 1:227893124-227893146 ACCGCAGCACCCACATTTTGGGG + Intergenic
923472008 1:234299688-234299710 GCCTCAGCCTCCAGAGTTGGTGG - Intronic
1063105881 10:2991704-2991726 GCCACAGCCTCCAGAGTAGGTGG - Intergenic
1066704396 10:38162060-38162082 GCCACATCATCTTCATTTGAAGG + Intergenic
1066973247 10:42337596-42337618 GCCACAGTCTTCACATTTGTAGG + Intergenic
1068302557 10:55163145-55163167 GCCCTAGCCTCCACATTTTGTGG + Intronic
1070105310 10:73425826-73425848 GACACACCATCCAGATTTGGTGG - Exonic
1071433596 10:85626019-85626041 GCACCAGCATTCTCATTTGGGGG - Intronic
1071436202 10:85650130-85650152 GTCACAGCACCCAGTTTTGGAGG + Intronic
1075633130 10:124013308-124013330 GCCACAGCATCTGCATGTGACGG + Intronic
1080763970 11:35278717-35278739 GCCTCAGAAGCCACATTTTGTGG - Intronic
1083202035 11:61126482-61126504 ACCACAGCTTCCACAAGTGGAGG - Exonic
1083630463 11:64092495-64092517 GACACAGCATCCACGATGGGAGG + Intronic
1083946168 11:65924350-65924372 GCCACAACACCCAGCTTTGGGGG + Intergenic
1084358666 11:68655685-68655707 CCCACAGCATCCAGCTATGGAGG - Intergenic
1086111723 11:83206616-83206638 CTCACAGCATCCTCATATGGTGG - Intronic
1086606357 11:88701035-88701057 GCCACAGAATCCAGATTTGTAGG - Intronic
1086923210 11:92611520-92611542 GCCTCAGCATCCCAAGTTGGTGG + Intronic
1088821502 11:113461174-113461196 GCCACAGGATCCTCATTTACAGG + Intronic
1090397596 11:126429443-126429465 CCCACAGCATCTCCATATGGAGG - Intronic
1091133036 11:133162592-133162614 GCCACATCAACCCGATTTGGTGG + Intronic
1093824209 12:23662533-23662555 GGCTCAGCAACCACATTTTGTGG + Intronic
1096127407 12:49130167-49130189 GTCACAGCTTCCTCCTTTGGAGG + Intronic
1096839930 12:54373984-54374006 GCTACACCATCCCCATTTGTTGG + Exonic
1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG + Intronic
1102521949 12:113483421-113483443 GCCTCAGTTTCCACATTTGAGGG + Intergenic
1103267613 12:119644171-119644193 GCCACAGCATCCATTTATGTTGG - Intergenic
1103751873 12:123169713-123169735 GCCTCAGCCTCCACAGTTGCTGG + Intronic
1103797407 12:123513880-123513902 GCCACAGCAGCCACACGTGTGGG + Intronic
1104485756 12:129150122-129150144 GCCCCAGCACCCACATATGTGGG - Intronic
1104571752 12:129932151-129932173 GCAACAGCCACCACATTTTGTGG - Intergenic
1110655101 13:77988513-77988535 GACACAGCAGCCACATTGAGGGG - Intergenic
1112902376 13:104373989-104374011 GCAGCAGCACCCACACTTGGAGG - Intergenic
1113164215 13:107419542-107419564 GCCTCAGCATCCTCACCTGGTGG - Intronic
1113647279 13:112007536-112007558 GCTGCAGCAGCCACATTTCGAGG - Intergenic
1115895233 14:38078905-38078927 CCAAGAGCATCCACCTTTGGGGG + Intergenic
1118290735 14:64519661-64519683 GCCACAGCATCCAGAGTAGCTGG - Intronic
1118329007 14:64801434-64801456 GCCACAGCATCCCCACCAGGAGG + Intronic
1121283122 14:92713717-92713739 AACACAGCACCCACAGTTGGAGG + Intronic
1122292971 14:100689322-100689344 GGCACAACACACACATTTGGCGG + Intergenic
1127282964 15:57507687-57507709 GCCACAGCATCCAGAGGTGAGGG - Intronic
1128614276 15:69097154-69097176 GAAACAGCATCCCAATTTGGAGG - Intergenic
1130524373 15:84691321-84691343 GCCTCAGCATCCCAAATTGGTGG + Intronic
1131345124 15:91639560-91639582 GCCACAGCAGCTACATTGGAGGG + Intergenic
1133538411 16:6724322-6724344 GCCTCAGCCTCCCCAGTTGGTGG + Intronic
1135765337 16:25172853-25172875 GCCAGAGCATCCCCATTTCAGGG - Intronic
1136139944 16:28282024-28282046 GCCTCAGCTTCCCCATCTGGGGG + Intergenic
1136596077 16:31250884-31250906 GCCCCAGCATCAGCATTTGGGGG - Intergenic
1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG + Intergenic
1144351037 17:14396621-14396643 GACACAGCATCCACATTTCTTGG - Intergenic
1145724666 17:27107498-27107520 GCCCTAGCCTCCACATTTTGTGG - Intergenic
1145795120 17:27650997-27651019 GCCACAGCATCCTCGTCTGAGGG - Intergenic
1146908870 17:36635213-36635235 GCCATAGCATCTCTATTTGGTGG + Intergenic
1147028226 17:37608366-37608388 ACAACAGCACACACATTTGGAGG - Intronic
1149613121 17:57972404-57972426 GGCACAGTGGCCACATTTGGAGG - Intronic
1149968313 17:61190410-61190432 GCCTCAGCATCCACAGTAGCTGG - Intronic
1151126777 17:71853868-71853890 GCCTCAGCATCCCCAGTAGGTGG + Intergenic
1152477371 17:80526915-80526937 GACACTGCATCCAAATTAGGCGG - Intergenic
1152626586 17:81390498-81390520 GCCACAGCTTCTGCCTTTGGAGG - Intergenic
1156015568 18:32543070-32543092 GCCACCGCACCCAGCTTTGGAGG + Intergenic
1157204365 18:45686282-45686304 CCCACAGCATCAACATCTGTGGG - Intergenic
1158668966 18:59457475-59457497 ATCACAGCAGCCACATGTGGTGG - Intronic
1159056971 18:63475984-63476006 CCCACAGCTTCTTCATTTGGCGG - Intergenic
1160463820 18:79059214-79059236 GCCACTGCATCTCCATATGGCGG + Intergenic
1163250646 19:16124630-16124652 GCCCCAGAACCCACATGTGGGGG - Intronic
1163587281 19:18170822-18170844 GCGACAGGATTCAAATTTGGGGG - Intronic
1163922375 19:20303276-20303298 GCCACAGTCTTCACATTTGTAGG - Intergenic
1163946808 19:20544742-20544764 GCCACATCGTTCACATTTGTAGG + Exonic
1164020065 19:21294024-21294046 GCCACATTCTCCACATTTGTAGG + Exonic
1164029004 19:21383490-21383512 GCCACATCCTTCACATTTGTAGG - Intergenic
1164029018 19:21383658-21383680 GCCACATTATTCACATTTGTAGG - Intergenic
1164029032 19:21383824-21383846 GCCACATTCTCCACATTTGTAGG - Intergenic
1164112431 19:22180604-22180626 GCCACATCCTTCACATTTGTAGG + Exonic
1164166858 19:22686482-22686504 GCCACATTCTCCACATTTGTAGG - Intergenic
1164238407 19:23359643-23359665 GCCACATTCTCCACATTTGTAGG + Exonic
1165226038 19:34355891-34355913 GTCACAGCATCCACATTTGGTGG - Intergenic
1166137298 19:40785567-40785589 GCCAAACCACCCACATCTGGTGG + Intronic
1166365249 19:42274891-42274913 GCAACAGCTTCCACATCTTGGGG + Intronic
1167301830 19:48682266-48682288 ACCACTGCACCTACATTTGGTGG - Intergenic
1167555073 19:50189387-50189409 GCCACAGCAGGAACATTTTGAGG - Intronic
927100682 2:19785531-19785553 GCCAGAGCCTCCCCATTTAGGGG + Intergenic
929176207 2:38979091-38979113 GCCACAGCCTCCAGAGTAGGTGG + Intergenic
930740922 2:54831850-54831872 TCCACAGCATCCACACTGTGGGG - Intronic
931688746 2:64817407-64817429 GCCTCAGCCTCCACAGTAGGTGG - Intergenic
938578124 2:132622277-132622299 GCCTCAGCCTCCACAGTAGGTGG - Intronic
939996266 2:148923068-148923090 GCCACAGCATTCACATTTGAAGG - Intronic
940440172 2:153706109-153706131 GCCTCAGCCTCCACATTAGCTGG + Intergenic
940915620 2:159251968-159251990 GCCACAGCAGCCCCAGCTGGAGG + Intronic
941990465 2:171551069-171551091 GCCTCAGCATCCACAGTAGCTGG + Intronic
942183318 2:173401534-173401556 GCCACACATTCCACCTTTGGAGG + Intergenic
944029269 2:195214274-195214296 GCCACAGTATCAGCATTTTGGGG + Intergenic
945062048 2:205917744-205917766 GCCACAGGTACCACATTTTGGGG + Intergenic
946430508 2:219624662-219624684 GCCACACCACCCAGATTTGGAGG - Intergenic
946898854 2:224353512-224353534 GCCTCAGCATCCAAATTAGCTGG + Intergenic
947860180 2:233353091-233353113 GCCACAGGAGCCACATTTCAGGG - Intergenic
1169250265 20:4055184-4055206 GCCACAGCCTCCCAATTAGGTGG - Intergenic
1171071180 20:22069984-22070006 GACACAGAATCAGCATTTGGGGG - Intergenic
1173653974 20:44686203-44686225 GACTCAGCAGCCACATGTGGTGG - Intergenic
1175144586 20:56886072-56886094 GTCACAGCATGCTCCTTTGGGGG + Intergenic
1175296989 20:57915304-57915326 ACCACAGCAGGCAGATTTGGTGG + Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1181952700 22:26566052-26566074 GCCACAGCAGCCACATTTCGAGG + Intronic
1183230857 22:36581121-36581143 GCCACAGCAGACACATTCGATGG + Intronic
949386709 3:3510950-3510972 CTCACAGCAACCACATGTGGTGG + Intergenic
950109598 3:10410554-10410576 GCCACCGCATCCACGCTGGGGGG - Intronic
951780679 3:26359975-26359997 GCCTCAGCCTCCCTATTTGGTGG + Intergenic
953756089 3:45647119-45647141 GGCACAGCATACATTTTTGGGGG - Intronic
954365139 3:50141657-50141679 GCCTCAGCCTCCAGATTAGGTGG + Intergenic
956853751 3:73255934-73255956 GCCACAGAATCCATTTCTGGCGG + Intergenic
960234272 3:115263449-115263471 GCCTTAGCATCCTCATTTGTAGG - Intergenic
960662890 3:120080174-120080196 ACCTCAGCATCCACATTAGTTGG - Intronic
962370312 3:134815987-134816009 GCCCCAGCATTTACCTTTGGTGG - Intronic
968398949 4:271165-271187 GCCACATCCTTTACATTTGGGGG + Exonic
972904285 4:43725841-43725863 TCCACAGCATCTACATTTAATGG - Intergenic
979933914 4:126668234-126668256 ATCACAGCATACACATTTGGAGG + Intergenic
981769425 4:148290334-148290356 ACCACAACATACAAATTTGGTGG + Intronic
991168265 5:63588896-63588918 GCCTCAGCATCCACTTAAGGTGG + Intergenic
992126995 5:73652467-73652489 GGCACGGTATGCACATTTGGGGG + Intronic
992152979 5:73924832-73924854 ACCACAGCATCCTCCTTTGGAGG + Intronic
992188133 5:74263653-74263675 ACCACAGCATCCACTGTTTGTGG - Intergenic
995224132 5:109685254-109685276 GCCTCAGCCTCCACAGTAGGTGG + Intergenic
995995527 5:118293552-118293574 GCCACAGCATTCTCATTACGTGG + Intergenic
1003162193 6:3645881-3645903 GCCTCAGCCTCCAGATTTGCTGG + Intergenic
1003653923 6:7988043-7988065 ACCTCAGAATCCACCTTTGGAGG + Intronic
1005755590 6:28923047-28923069 GCCTCAGCACTCAGATTTGGAGG - Intronic
1009815248 6:68725029-68725051 GCACCACCAACCACATTTGGGGG + Intronic
1010811504 6:80305682-80305704 TCCACAACATCTACATGTGGGGG - Intronic
1018707845 6:166475963-166475985 GCTTCAGCATACAAATTTGGGGG - Intronic
1020237615 7:6368607-6368629 GCCTCAGCCTCCACAGTAGGTGG + Intergenic
1020373855 7:7462742-7462764 GCCACAGCATCCCCAGTAGCTGG - Intronic
1024875282 7:54015098-54015120 GCCTCAACATACACATTTCGGGG + Intergenic
1025632816 7:63291507-63291529 GCCACATTATTCACATTTGTAGG + Intergenic
1025649881 7:63456677-63456699 GCCACATTATTCACATTTGTAGG - Intergenic
1025707195 7:63877080-63877102 GCCACATTTTCCACATTTGTAGG - Intergenic
1025792959 7:64709206-64709228 GCCACAGACTTCACATTTGTAGG - Exonic
1025792970 7:64709375-64709397 GCCACATTATTCACATTTGCAGG - Exonic
1025805798 7:64832915-64832937 GCCACATCGTTCACATTTGTAGG - Intronic
1025822318 7:64978470-64978492 GCCACATTCTCCACATTTGTAGG + Exonic
1027460109 7:78441308-78441330 GCCACAGATTCCACATTTCGTGG - Intronic
1028708792 7:93883260-93883282 GAGACAGCATGCACACTTGGGGG + Intronic
1034084102 7:148307856-148307878 GCCTCAGCATCCCCATTAGCTGG - Intronic
1034505739 7:151489129-151489151 GCCACAATATCCACTTTTAGAGG + Intronic
1034593094 7:152160547-152160569 TCCGCAGCATCCACATCAGGTGG - Intronic
1034941918 7:155236346-155236368 ACCACAGGAGCCACACTTGGGGG - Intergenic
1035695060 8:1589869-1589891 GCAACACCATTTACATTTGGGGG + Intronic
1036526003 8:9535369-9535391 GCCTCAGCCTCCCCATTAGGTGG - Intergenic
1036661322 8:10710960-10710982 GCCCCGGCTTCCTCATTTGGAGG - Intronic
1038307607 8:26418928-26418950 GCCAAAGAATCCATATTTTGGGG + Intronic
1041183034 8:55268656-55268678 GCAACAGCATCAACGTTTGTTGG + Intronic
1041772496 8:61486849-61486871 GCCTCAGCATACACAGTTGGTGG - Intronic
1042203018 8:66300044-66300066 GCAACAGCACCCACATTTTGAGG - Intergenic
1047071350 8:121347408-121347430 GCCATAGTAGCCAGATTTGGTGG - Intergenic
1047212559 8:122851627-122851649 GCCACATCATCAACATTTCCTGG + Intronic
1053077610 9:35147728-35147750 GCCACATTCTCCACATTTGTAGG + Intergenic
1055991659 9:82112711-82112733 GCCACTGCATCCTCATTCAGTGG - Intergenic
1057007831 9:91576249-91576271 GCCACAGCATATTAATTTGGGGG - Intronic
1057620873 9:96633586-96633608 GCCTCAGCCTCCACAGTAGGTGG - Intergenic
1059280061 9:113125245-113125267 GCCACTACAACCACCTTTGGTGG - Intergenic
1060377402 9:123129105-123129127 GCCACAGCCTCCAAAATTGCTGG - Intronic
1185803880 X:3039373-3039395 GCCTCAGCCTCCACAATTGCTGG + Intergenic
1186439575 X:9574162-9574184 GCCACAGCAAGCAAATTTTGTGG - Intronic
1188777980 X:34245443-34245465 GTCAAAGAGTCCACATTTGGAGG + Intergenic
1189833656 X:44999811-44999833 GCCTCTGCATCAACCTTTGGAGG + Intronic
1195177329 X:102323487-102323509 CCCACAGAGTCCACCTTTGGAGG - Intronic
1195181535 X:102363606-102363628 CCCACAGAGTCCACCTTTGGAGG + Intronic
1197948211 X:131863323-131863345 ACCACAGCTTCTACATCTGGAGG + Intergenic
1199385074 X:147214221-147214243 GCCTCAGCATCCAGATTAGCTGG - Intergenic
1199798383 X:151225177-151225199 ATCACTGCATCCACATTTGTAGG - Intergenic
1201485721 Y:14492639-14492661 GCCACAGCCTCCACAGTAGCTGG + Intergenic