ID: 1098524017

View in Genome Browser
Species Human (GRCh38)
Location 12:71465721-71465743
Sequence CTGAGGTAAGTTTCTAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098524017_1098524022 13 Left 1098524017 12:71465721-71465743 CCTCTATTAGAAACTTACCTCAG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1098524022 12:71465757-71465779 GGTAACATAAACTGATTAACTGG 0: 1
1: 0
2: 0
3: 7
4: 113
1098524017_1098524019 -8 Left 1098524017 12:71465721-71465743 CCTCTATTAGAAACTTACCTCAG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1098524019 12:71465736-71465758 TACCTCAGGATTCCTTTTTCAGG 0: 1
1: 0
2: 0
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098524017 Original CRISPR CTGAGGTAAGTTTCTAATAG AGG (reversed) Intronic
902665833 1:17937329-17937351 CTGAAGTCAGTTTCAAATAGTGG - Intergenic
910072555 1:83235855-83235877 CTGAGTTAAGTCTCTAATTCTGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914222971 1:145696848-145696870 TTGAGGTAGGTTTCAATTAGAGG + Intronic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
921833644 1:219756003-219756025 CTGAGGTAAGTACCTAGAAGCGG - Intronic
922010736 1:221583279-221583301 CTTAGGTAAATATCTAAGAGTGG - Intergenic
924075687 1:240333603-240333625 ATGAGCTAAATTTCTAATTGAGG + Intronic
1063711946 10:8487742-8487764 CTGAGATATGTTTCCAATGGAGG + Intergenic
1070898233 10:80004434-80004456 CTTAGGTATGTATCTACTAGGGG - Intergenic
1072474660 10:95748527-95748549 CTGAGATTAGTTTCAAAAAGAGG - Intronic
1077263664 11:1637536-1637558 CTGAAGTAAGATACTAATAATGG + Intergenic
1081435258 11:43020841-43020863 TTGAGGTAGGTTCCAAATAGGGG + Intergenic
1085140788 11:74139788-74139810 CTGTCGTAAGTTTCTGACAGAGG + Exonic
1085585568 11:77701299-77701321 CTGAGGCTAGTTTCTCACAGTGG + Exonic
1086268844 11:85035048-85035070 CAGAGGTCAGTTTGTAATATTGG + Intronic
1087836248 11:102878187-102878209 CTTAGGTAAGCCTCTAAAAGAGG - Intergenic
1088483931 11:110323230-110323252 CTTAGGTTAGTTTCTAAGATAGG - Intergenic
1096612475 12:52811862-52811884 CTGAGGTAGGTCTCAAAGAGGGG + Exonic
1098524017 12:71465721-71465743 CTGAGGTAAGTTTCTAATAGAGG - Intronic
1098549173 12:71744444-71744466 CTGAGGAAAGTTCATAATAGTGG + Intergenic
1099939841 12:89173217-89173239 CTTAAGTAAGTTACTAAGAGAGG - Intergenic
1101586683 12:106091326-106091348 CTGAGCTAAGTTTCTATTCAGGG - Intronic
1102743356 12:115227603-115227625 CTGAGGAGAGCTTCCAATAGAGG + Intergenic
1107952429 13:45475661-45475683 CTGAGTTAGCTTTCTAATAAGGG - Intronic
1108495680 13:51022478-51022500 CTGAGCTATCTTTCTATTAGAGG - Intergenic
1110022208 13:70489875-70489897 CTCAGGGAAGTTTTTTATAGTGG + Intergenic
1110687722 13:78395167-78395189 CCGAGATAAGATTCTTATAGAGG - Intergenic
1110782109 13:79478616-79478638 CTCAAGTAAGTTTCTCCTAGTGG + Intergenic
1111053581 13:82918728-82918750 GTGAGTTAAGTCTATAATAGTGG - Intergenic
1113058843 13:106299252-106299274 CTGAGGTAAATTTCTAATTGTGG - Intergenic
1114926955 14:27414491-27414513 CTAAGATAAATTTCTAAAAGGGG - Intergenic
1116910514 14:50458502-50458524 CAGAGATAATTTTCTAATAGAGG - Intronic
1121187351 14:91986592-91986614 CTTAGGTAGGTGTCTAAAAGAGG + Intronic
1125350446 15:38761606-38761628 CTTAGGTAACTTTTTCATAGTGG + Intergenic
1125703206 15:41707063-41707085 CTATGGTGAGTTTGTAATAGAGG + Intronic
1130435079 15:83889998-83890020 CTGAGTTAAGTTTCTTAAAGAGG + Intronic
1133667516 16:7983707-7983729 TTGAGGTGAGTTTATAAAAGGGG + Intergenic
1139092516 16:63665595-63665617 TTGGGGTAAGGTTCTAACAGAGG - Intergenic
1139738253 16:69012200-69012222 CTGGAGTAAGTTTCTAAAAGTGG + Intronic
1143245283 17:5479691-5479713 CTGATGAAAGTTTCTGATGGTGG - Intronic
1147352842 17:39865242-39865264 CTAATATAATTTTCTAATAGCGG - Intergenic
1153501568 18:5755202-5755224 TTAAGGTAAGTTTATACTAGAGG - Intergenic
1156312230 18:35935281-35935303 CTGAAGTAAGTAATTAATAGAGG - Intergenic
1156558105 18:38090100-38090122 CTGAAGTAAGTTTATAATTTTGG - Intergenic
931843118 2:66175310-66175332 TTGAGGTAAGTTTGTAATTTGGG - Intergenic
932195849 2:69782814-69782836 CTGAGGTAATTTTCTCCGAGTGG - Intronic
937697319 2:124822195-124822217 CTGGAGTAAGGTTCTAATATTGG - Intronic
938391259 2:130908013-130908035 CTTTGGTAAGTATCTAAAAGTGG + Intronic
939314961 2:140536563-140536585 CTGTGGTAAGTGTCCAATATGGG - Exonic
940476961 2:154175173-154175195 ATGAGTTAAGTTCCTAACAGAGG - Intronic
940655532 2:156483856-156483878 CTGAAGAATGTTTCTAATTGAGG - Intronic
941043856 2:160651036-160651058 GTGAGGAAAGTCTCTAACAGAGG - Intergenic
942650012 2:178156462-178156484 ATGAGGTTAATTTATAATAGAGG + Intergenic
945155888 2:206836931-206836953 TTGAGGTAAGTATGTAATACTGG - Intergenic
1170293576 20:14799069-14799091 TTTAGGTAAATTTCTAAAAGAGG - Intronic
1170923879 20:20704926-20704948 CTGAGGTAGGTTTTGAATAATGG - Intronic
1171146736 20:22790837-22790859 CTTGGGTAAATGTCTAATAGTGG + Intergenic
1174715111 20:52749281-52749303 ATGTGGTAGGTTTCTAAAAGTGG + Intergenic
1177619745 21:23572800-23572822 TTGAGGTAATTCTATAATAGAGG - Intergenic
1177658175 21:24047125-24047147 GTGAGGGAAGTTTCTATCAGGGG - Intergenic
951163841 3:19461025-19461047 CTCAGGTATGTTTTTATTAGCGG + Intronic
955271726 3:57506195-57506217 CAGAGGTAAGTGTGTAATGGGGG + Intronic
958114579 3:89199246-89199268 CTGAGGTAATTTTCAGATAATGG + Intronic
959923056 3:111891098-111891120 CTGAGCTATGTTTCAAGTAGAGG + Intronic
964180341 3:153875865-153875887 CTGTGGTAATTTTCTGATATTGG + Intergenic
964997373 3:162900341-162900363 CTGTGATAAGTTGCTAAGAGTGG + Intergenic
966054739 3:175672348-175672370 CTGAGATATCTTTCTAATAAAGG + Intronic
967422965 3:189293897-189293919 CTGAGGCAAGCTTTTAATAAGGG - Intronic
970709391 4:18843931-18843953 CTTATGTAGGTTTGTAATAGAGG + Intergenic
972967448 4:44528853-44528875 CTGAGATAACTTTCTGATATAGG + Intergenic
974397000 4:61350449-61350471 GTGAGGTATGTGTCTAATTGGGG - Intronic
974666707 4:64971039-64971061 CTAAGGTAAGTACCTAATAATGG - Intergenic
975879208 4:78883174-78883196 AGGAGGTAAGTTTCTCATATTGG + Intronic
975979564 4:80141628-80141650 CTGAGGTAAGTGTCTTACAGAGG - Intergenic
977216390 4:94289319-94289341 CTTAGGAAAGTTTTTAACAGGGG + Intronic
978366356 4:107987144-107987166 CTGAGGAAAGGTTCCAATGGAGG + Intergenic
983525277 4:168754471-168754493 CTGAGATAAGATCCTAATTGTGG + Intronic
987970287 5:24934219-24934241 ATAATGAAAGTTTCTAATAGCGG - Intergenic
990225060 5:53640950-53640972 CTCAGGGAAGTTTGTAATAAAGG - Intronic
990982505 5:61614790-61614812 CTCAGGGGAATTTCTAATAGTGG + Intergenic
992116557 5:73543902-73543924 GTGAGATAAATTTCTAGTAGTGG - Intergenic
993499180 5:88645057-88645079 ATGAGGTAGGTTTTTAATTGTGG - Intergenic
994361720 5:98858311-98858333 CTGAGTTAAGTGTCTATCAGAGG + Exonic
1000491223 5:161915907-161915929 CTGAGGTGAGTTTCTTATCAGGG - Intergenic
1003362369 6:5440489-5440511 CTGGGATAAGTTTATAAAAGTGG + Intronic
1003469769 6:6418404-6418426 CTGAGGTAAGATAATAATAAGGG - Intergenic
1003747039 6:9013818-9013840 CTAATTTAAGTTTCTAATATGGG + Intergenic
1005138970 6:22604742-22604764 CTGAGGTGAGTTTTTAACATAGG - Intergenic
1010763563 6:79751943-79751965 CTGAAGTAATTTTGTCATAGAGG - Intergenic
1010818782 6:80389471-80389493 CTGAGGTAAGTGTCTATTCCAGG - Intergenic
1013097575 6:106959777-106959799 CTGAGGAAAGATTCTCATATGGG - Intergenic
1014572641 6:123029259-123029281 ATGAGATACTTTTCTAATAGTGG - Intronic
1015834227 6:137402690-137402712 CTAAGGTCATTTTCTAATAAGGG + Intergenic
1015911632 6:138173861-138173883 CTGAGTTGAATTTCTAATAATGG - Intronic
1016922530 6:149310027-149310049 CTGAGTTAAGTTTATAATCATGG + Intronic
1017556317 6:155574731-155574753 CTGTTTTAAGTTTCTAATAATGG - Intergenic
1018608469 6:165623598-165623620 CTGAAGTAAGTTTAAAATATAGG - Intronic
1019000718 6:168748074-168748096 CTGAGGTTAGTATCTCATTGTGG + Intergenic
1020458611 7:8402600-8402622 CTGAGGTGAGGTGCTAAAAGAGG - Intergenic
1026380103 7:69791000-69791022 CTGGGGTAGGTTTCAATTAGTGG - Intronic
1026747171 7:73022579-73022601 CTGAGGTCAGCTTCTCAGAGAGG + Intergenic
1026750821 7:73050722-73050744 CTGAGGTCAGCTTCTCAGAGAGG + Intergenic
1026754470 7:73078832-73078854 CTGAGGTCAGCTTCTCAGAGAGG + Intergenic
1026758122 7:73106865-73106887 CTGAGGTCAGCTTCTCAGAGAGG + Intergenic
1027033275 7:74907150-74907172 CTGAGGTCAGCTTCTCAGAGAGG + Intergenic
1027089283 7:75286619-75286641 CTGAGGTCAGCTTCTCAGAGAGG - Intergenic
1027092926 7:75314547-75314569 CTGAGGTCAGCTTCTCAGAGAGG - Intergenic
1027096569 7:75342514-75342536 CTGAGGTCAGCTTCTCAGAGAGG - Intergenic
1027290277 7:76701003-76701025 CTGAGTTAAGTCTCTAATTCTGG + Intergenic
1027322778 7:77025166-77025188 CTGAGGTCAGCTTCTCAGAGAGG + Intergenic
1027600483 7:80233949-80233971 CTGAGGTAAATTTCTTTTTGAGG + Intergenic
1027950987 7:84815494-84815516 CTGAGGTAATTTTAGAATAGAGG - Intergenic
1028343127 7:89746878-89746900 CTGAGGCAAGTTTCAGACAGAGG - Intergenic
1029496488 7:100897604-100897626 CTGAGGCAGGTTTCTAAGCGTGG + Intergenic
1030542677 7:110851839-110851861 CAGATGGAATTTTCTAATAGTGG + Intronic
1030864134 7:114677948-114677970 CAGAGGTAAAACTCTAATAGAGG + Intronic
1031908253 7:127485559-127485581 CTCAGGCAACTTTCAAATAGAGG + Intergenic
1032954601 7:136956079-136956101 CTGATGTATATTTTTAATAGGGG + Intronic
1039526588 8:38221911-38221933 CTGAGTTAAGGTGTTAATAGAGG - Intergenic
1045473875 8:102537026-102537048 CGGAGGAAAGTGACTAATAGCGG - Intronic
1045816899 8:106287170-106287192 CTGATATAAGTTTAAAATAGAGG + Intronic
1056328317 9:85500682-85500704 CTGAGGTAAGTTTCAACTGCTGG + Intergenic
1056394477 9:86168868-86168890 CTTAGGAAAGTGTCTAATGGTGG + Intergenic
1058637065 9:107047572-107047594 CTGAGGTAAGCATCTGAAAGCGG - Intergenic
1060457876 9:123817557-123817579 CTGAGGGAAGTTTTCAAAAGGGG - Intronic
1061464494 9:130766856-130766878 CTGATGTAAGTTTCTAAGGGAGG - Intronic
1062086837 9:134653510-134653532 CTGAGGTGAGTTTGGAGTAGGGG - Intronic
1185961192 X:4547113-4547135 CTTAAGTAAGTCTCTGATAGTGG - Intergenic
1187758524 X:22553305-22553327 CTTAGGTAAATATCTAAAAGTGG - Intergenic
1188895730 X:35666036-35666058 CTGAGGTAGGTCTCAATTAGAGG - Intergenic
1192072195 X:67952837-67952859 GTGAGTTAAGTTTCCAATACAGG + Intergenic
1195575728 X:106448350-106448372 CTCAGGTAAATATCTAAGAGTGG - Intergenic
1197186113 X:123589219-123589241 CTTAGTTAATTTTCTATTAGTGG - Intergenic
1199790284 X:151147932-151147954 CTGAAGTAAGTAGCTAAAAGTGG + Intergenic