ID: 1098527868

View in Genome Browser
Species Human (GRCh38)
Location 12:71507429-71507451
Sequence CTGTGTCTGTGCATGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1517
Summary {0: 1, 1: 0, 2: 9, 3: 192, 4: 1315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098527868 Original CRISPR CTGTGTCTGTGCATGTGTCT GGG Intronic
900150525 1:1177140-1177162 GTGTGTCTGTGCATGTTTATAGG + Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900489201 1:2938385-2938407 GTCTGTGTGTGCATGTGTGTGGG - Intergenic
900489205 1:2938469-2938491 CTCTGTGTGTGCATGTGTGGGGG - Intergenic
900575669 1:3381241-3381263 CTGGGTGTGTGCTTGTGTGTGGG - Intronic
900593574 1:3470406-3470428 CAGTGTGTGTGCATGGGTGTGGG + Intronic
900596452 1:3482287-3482309 CTCTGTGTGTGCGTGTGTGTTGG + Intergenic
900710088 1:4108054-4108076 CTGTGTGTGTGTGTGTGTTTGGG - Intergenic
900836449 1:5008413-5008435 CTGTGTCTGTCTGTCTGTCTAGG + Intergenic
900978211 1:6030692-6030714 ATGTGTGTGTGTATGTGTGTAGG + Intronic
901117450 1:6859300-6859322 TTGTGTCAGTGCCTGTGTGTGGG + Intronic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901929050 1:12585091-12585113 CTGTGTGAATGTATGTGTCTGGG + Intronic
902244599 1:15112357-15112379 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
902463599 1:16599498-16599520 GTGTGTGTGTGTATGTGTGTGGG - Intronic
902511927 1:16971401-16971423 GTGTGTGTGTGCATGTGTGACGG - Intronic
902538368 1:17135051-17135073 GTGTGTATGTGCATGTGGGTGGG - Intergenic
902606124 1:17570303-17570325 CTGGGTCAGGGCATGTGTGTGGG + Intronic
902689848 1:18104093-18104115 GTGTGTGTGTGCCTGTGTGTGGG + Intergenic
902772848 1:18655793-18655815 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
903265146 1:22153729-22153751 ATGTGTGTGTGAATGTGTGTTGG + Intergenic
903325151 1:22564957-22564979 CTGTGTGTGTGCTTGTGTGTAGG - Intronic
903325177 1:22565232-22565254 CTGTGTCTGTGTGTGTTTGTTGG - Intronic
903345034 1:22678454-22678476 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
903634744 1:24804368-24804390 GTATGTGTGTGCATGTGTGTGGG + Intronic
903659980 1:24970972-24970994 CTGTGTGTGTGAGTGTGTGTAGG + Intergenic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
903659987 1:24971130-24971152 ATGTATGTGTGCATGTGTGTGGG + Intergenic
903668086 1:25020128-25020150 ATGTGTGTATGCATGTGTGTAGG - Intergenic
903745920 1:25586588-25586610 GTGTGTGTGTGTATGTGTTTTGG + Intergenic
904036774 1:27563340-27563362 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904609713 1:31718749-31718771 CTGTGTCTGTGCCTGTGGTGGGG - Intergenic
904825211 1:33269833-33269855 CTCTTTCTGTCCATTTGTCTAGG + Intronic
904839696 1:33364355-33364377 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
904973515 1:34437470-34437492 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
905107421 1:35572840-35572862 CAGTGTCAGTGCGTGTGTTTAGG - Intergenic
905174370 1:36126646-36126668 GTGTGTGTGTGCATGCGTGTAGG + Intergenic
905225009 1:36473234-36473256 CTGTGTCTCTTCCTGTCTCTGGG + Intronic
905267157 1:36762402-36762424 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
905267163 1:36762530-36762552 CTGTGTCTGTGTAGGAGTGTGGG - Intergenic
905345842 1:37310544-37310566 AAGTGTCTGTGAATGTGTCTGGG - Intergenic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
905353500 1:37364162-37364184 CTGTGTGTGTGTGTGTGTCTAGG - Intergenic
905394181 1:37656771-37656793 CTCTGTGTGTCCATGTGTGTTGG + Intergenic
905624986 1:39483630-39483652 CTGTGTCTTTGCTTCTCTCTTGG - Intronic
905772955 1:40650043-40650065 CTGTGACTGAGAATGTATCTAGG - Intronic
905872970 1:41415579-41415601 TTGTGTCTGTCCAAGTGCCTTGG + Intergenic
906633061 1:47388701-47388723 GTGTGTCTGAGAATGTGTATTGG - Intergenic
906758349 1:48344632-48344654 GTGTGTCACTGCATGTCTCTTGG - Intronic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907281176 1:53348122-53348144 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
907662980 1:56410584-56410606 GTGTGTCTGTGGGTGTGTGTAGG + Intergenic
907786864 1:57620991-57621013 GTGTGTGTGTGTTTGTGTCTGGG + Intronic
907805046 1:57810437-57810459 CTGTGTGTGTGTATTTGTGTGGG + Intronic
908178817 1:61583787-61583809 CTGGCTCTGTGCATGTATTTGGG + Intergenic
908433492 1:64081803-64081825 GTGTGTTTGTGTATGTGTGTGGG - Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909178499 1:72390140-72390162 GTGTGTCTGTGCATGTGAGATGG - Intergenic
909347299 1:74606002-74606024 GTGTGTCTGTGTGTGTGTGTGGG + Intronic
909351021 1:74653373-74653395 GTGTGTGTGTGTCTGTGTCTGGG + Intronic
909456884 1:75860150-75860172 GTGTGTCTTTGCATGTGTGATGG + Intronic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910739869 1:90503408-90503430 GTGTGTGTGTGCGTGTGTATAGG - Intergenic
910839531 1:91547887-91547909 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
910921178 1:92348954-92348976 CTTTATATGTGCATGTCTCTGGG - Intronic
911035424 1:93540064-93540086 CCGTGTGTGTGTATGTGTGTGGG + Intronic
911139464 1:94483310-94483332 GTGTGTGTGTGTATGTGTGTCGG - Intronic
911279763 1:95909642-95909664 ATGTTTCTGAACATGTGTCTGGG - Intergenic
911664509 1:100538629-100538651 CTGTGTGTGTGTGTGTGTGTTGG + Intronic
911941614 1:104054726-104054748 CTGAGCCTGTACATTTGTCTGGG + Intergenic
912040905 1:105389003-105389025 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912285555 1:108364967-108364989 GTGTGTCTGTGTGTGTGTCCAGG + Intergenic
912436881 1:109668280-109668302 CGCTGTCTGTGCGTGTGGCTGGG + Intronic
912557398 1:110525999-110526021 ATGTCTCTGTGTATGTGTGTGGG - Intergenic
912751296 1:112290228-112290250 CTGTGTCTCTGCATGTGAGATGG - Intergenic
913448361 1:118973763-118973785 GTGTGTGTGTGTATGTGTGTAGG - Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
913937403 1:125066879-125066901 GTGCGTGTCTGCATGTGTCTGGG + Intergenic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
914750222 1:150529932-150529954 CTGTGTGTGTGCATTTTTCTGGG + Intergenic
914864568 1:151415808-151415830 CTGTGTGTGTGCATTTTTCAAGG - Intronic
914893202 1:151646831-151646853 CTGTGTGTGTGCGTGTGTCAAGG + Intronic
915212500 1:154320998-154321020 ACGTGTCTGTGCACGTGTGTAGG - Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915319405 1:155047957-155047979 GTGTGTGTGTGCAGGTGTGTAGG - Intronic
915328413 1:155093244-155093266 TTGTGTTTGTGTATGTGTCTGGG - Intergenic
915494856 1:156274828-156274850 CTGTGTCTCTCCCTGTGTCCTGG - Intronic
915593816 1:156885133-156885155 CTGAGTCTCTGCATGGATCTGGG - Intergenic
915776040 1:158487444-158487466 CTGAGTCTCTGCCTTTGTCTTGG - Intergenic
916257248 1:162801645-162801667 TTGGGTGTGTGCATGTGTGTAGG + Intronic
916351552 1:163854823-163854845 ATGCATCTGTGCATGTGTGTGGG - Intergenic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917112005 1:171557907-171557929 GTGGGTCTGTGCCTGAGTCTGGG - Exonic
917677107 1:177330095-177330117 GTGTGTGTGTGCGTGTGTGTGGG - Intergenic
917712018 1:177694757-177694779 CTGTGTCTCTGCATGTGAGATGG - Intergenic
917757168 1:178113474-178113496 TTGTGTATGTGTATGTGTGTGGG + Intronic
917767295 1:178235612-178235634 GTGTGTCTGTGTGTGTGTATGGG + Intronic
917791755 1:178503637-178503659 GTGTGTATGTGCGTGTTTCTTGG - Intergenic
918167027 1:181959967-181959989 GTGTGTCTTTGCATGTGACATGG + Intergenic
918754573 1:188322441-188322463 GTGTGTGTGTGCTTGTGTGTGGG + Intergenic
918770810 1:188557407-188557429 GTGTGTGTGTGCATGTGAGTTGG + Intergenic
918902342 1:190439533-190439555 GTGTGTGTGTGTATGTGTATGGG + Intronic
919408388 1:197212785-197212807 GTGTCTCTGTTCACGTGTCTGGG - Intergenic
920302085 1:204995342-204995364 GTGTGTGTGTGTATGTGTGTCGG + Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920498619 1:206472560-206472582 GTGTGTGTGTGTATGTGTGTAGG - Intronic
920543995 1:206800590-206800612 ATGTGAGTGTGCATGTGTTTAGG + Intronic
920634078 1:207681842-207681864 CTATTTGTGTGCATGTGTGTTGG + Intronic
920693994 1:208167825-208167847 CTGAGTCTGTGTATGTGTGTGGG - Intronic
920754626 1:208717278-208717300 GTGTGTCTGTGAGGGTGTCTGGG - Intergenic
921268270 1:213444170-213444192 CTCTCTCTGTGCATGTCTGTTGG + Intergenic
921327905 1:214005964-214005986 ATGTGTCTGTGTCTGTGTGTGGG + Intronic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921853488 1:219955204-219955226 CTTTGTGTGTGCATGTGTTTCGG - Intronic
921931607 1:220758833-220758855 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
922058216 1:222062534-222062556 CTTTGTATGTGCAACTGTCTTGG - Intergenic
922746382 1:228046552-228046574 TTGTGTGTGTGCATGTGCATGGG + Intronic
922881890 1:228987232-228987254 CTGTGTGTGTGTATGCGTGTGGG - Intergenic
923038103 1:230299742-230299764 CTGTGCCTGTGCATTTGGCAAGG + Intergenic
1062775321 10:140096-140118 ATGTGTGTGTGTGTGTGTCTGGG - Intronic
1062831395 10:608275-608297 CTGTGTGTGTGTGTGTGTGTAGG - Intronic
1062973954 10:1669715-1669737 CTGTGTGTCTGTGTGTGTCTAGG - Intronic
1063054563 10:2490334-2490356 CTGTGTGTGCGCATGTGTGGTGG - Intergenic
1063144873 10:3287969-3287991 ATGTGTGTGTGCACGTGTGTGGG + Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1063853844 10:10224343-10224365 GTGTGTGTGTGTACGTGTCTAGG + Intergenic
1064120683 10:12615718-12615740 GTGTGAGTGTGCATGTGTGTGGG + Intronic
1064283907 10:13975520-13975542 CTGTGTCTGTGTGTTTGTGTGGG + Intronic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1066467840 10:35669085-35669107 GCGTGTGTGTGCATGTGTGTAGG + Intergenic
1066482899 10:35814084-35814106 GTGTGTATGTGCATGTGTTCGGG - Intergenic
1066723701 10:38367339-38367361 TTGGGTGTGTGCATGTGTGTAGG + Intergenic
1067046584 10:42988666-42988688 CTGTGGCTGTGCATCTGGCCTGG + Intergenic
1067105810 10:43365592-43365614 CTGTGTGTGTGTGTGTGTATGGG - Intergenic
1067328093 10:45288833-45288855 CTGAGGCTGTGCATGGGTCAAGG + Intergenic
1067438173 10:46293464-46293486 GTGTGTGTATGCATGTGTGTGGG + Intronic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1067471809 10:46543194-46543216 CTGTGGCTGTGTCTGGGTCTTGG - Intergenic
1068275936 10:54796774-54796796 CTGTGTCTGTCTCTGTCTCTCGG + Intronic
1068395316 10:56453955-56453977 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068865621 10:61892596-61892618 CTATATCAGTGCATGTATCTGGG - Intergenic
1068881223 10:62051064-62051086 ATCTCTCTGTGCCTGTGTCTTGG + Intronic
1070508445 10:77138084-77138106 GTGACTCTGTGCATGTGTGTGGG - Intronic
1070522702 10:77268307-77268329 GTGTGTGTGTGCCTGTGTGTAGG - Intronic
1070761307 10:79026146-79026168 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1071058177 10:81535366-81535388 ATGTGTGTGTGTATGTGTGTGGG + Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071319001 10:84433424-84433446 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071496469 10:86170666-86170688 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071682105 10:87716661-87716683 CTGTGTTTGTGCCTTTGCCTGGG + Intronic
1071876614 10:89850018-89850040 GTGTGTATGTGTGTGTGTCTAGG + Intergenic
1071907111 10:90186588-90186610 CTCTGTCTGGGCATGAATCTTGG - Intergenic
1071935861 10:90529641-90529663 CTGTGTGTGTGTGTGTGTGTGGG + Intergenic
1072320449 10:94244593-94244615 CTCTCTCTGTGCATGTGTGTAGG - Intronic
1072484109 10:95837990-95838012 CTGTGTGTGTGGGTGTGTGTGGG - Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1072870366 10:99112940-99112962 GTGTGTGTGTGTATGAGTCTAGG - Intronic
1072945464 10:99806095-99806117 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1073217063 10:101842307-101842329 CTGTGCATGTGCATGTTCCTGGG - Intronic
1073677000 10:105659295-105659317 GTGTGTGTGTGCATGGGTTTGGG + Intergenic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074005001 10:109412770-109412792 CTGTGTGTGTGTGTGTGTTTTGG + Intergenic
1074023274 10:109607056-109607078 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1074027828 10:109654605-109654627 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1074114199 10:110443503-110443525 GTGTGTCTGTGCCTGTGAGTGGG + Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074303404 10:112253150-112253172 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1074509087 10:114096900-114096922 ATGTGTGTGTGCATGTGTTGGGG + Intergenic
1074654042 10:115561669-115561691 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
1074707499 10:116148108-116148130 GGGTGTGTGTGCATGTGTGTGGG + Intronic
1074825799 10:117215170-117215192 CTGTGTCTCTGCCTCTGTCTTGG - Intergenic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074869100 10:117563142-117563164 GTGTGTCTGTGGGTGTGTGTGGG + Intergenic
1074869135 10:117563402-117563424 GTGTGTCTGTGGGTGTGTGTGGG + Intergenic
1074869159 10:117563599-117563621 GTGTGTCTGTGGGTGTGTGTGGG + Intergenic
1074869173 10:117563704-117563726 GTGTGTGTATGGATGTGTCTGGG + Intergenic
1075082638 10:119394063-119394085 GTGTGTCTGTGGGTGTGTGTGGG + Intronic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075137911 10:119802456-119802478 TTGTGTATATGCATGTGTCAAGG - Intronic
1075167591 10:120083347-120083369 ATGTCTCTGTGCGTGTGTGTGGG + Intergenic
1075813374 10:125245195-125245217 GTGTGCCTGTGCATTTTTCTGGG + Intergenic
1075913117 10:126142893-126142915 TTGTGTGTGTGCATGTGCATGGG + Intronic
1076058198 10:127392521-127392543 CCGTGCCTGTGTATGTGTGTGGG - Intronic
1076253207 10:128999250-128999272 GTGTGTGTGCGCATGTGTTTAGG - Intergenic
1076535835 10:131176285-131176307 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535840 10:131176377-131176399 TGGTGTGTGTGCATGTGTTTTGG - Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535843 10:131176455-131176477 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535844 10:131176491-131176513 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535852 10:131176679-131176701 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535859 10:131176767-131176789 CTCTGTGTGTCCATGTGTCTTGG - Intronic
1076535862 10:131176877-131176899 GTCTGTGTGTGCATGTGTTTTGG - Intronic
1076535863 10:131176911-131176933 GTGTCTGTGTGCATGTATCTTGG - Intronic
1076535864 10:131176945-131176967 CTCTGTGTGTACACGTGTCTTGG - Intronic
1076610688 10:131724028-131724050 GTGTGTGTGTGCGTGTGTGTGGG - Intergenic
1076689132 10:132211970-132211992 CTGTGTCTCAGCATGTGTGAAGG - Intronic
1076934193 10:133556516-133556538 CACTGTCCGTGGATGTGTCTGGG - Intronic
1077142944 11:1032722-1032744 GGGTGTGTGTGCATGTGTGTTGG + Intronic
1077251472 11:1562762-1562784 GTGCGTCTGTGCATGGCTCTGGG - Intronic
1077418007 11:2434337-2434359 GTGTGTGTGTGAATGTGTGTAGG + Intergenic
1077918848 11:6628528-6628550 CAGCCTCAGTGCATGTGTCTGGG - Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078267614 11:9766669-9766691 CGGTGTGTGTGTATGTGACTTGG + Intergenic
1078408506 11:11092361-11092383 GTGTGTATGTGTATGTGGCTAGG - Intergenic
1078823643 11:14906497-14906519 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1078863542 11:15275721-15275743 TTGTGTCAGTGCATTTTTCTAGG - Intergenic
1078874727 11:15381496-15381518 GTGTTTGTGTGCATGTGTGTTGG + Intergenic
1079028302 11:16966310-16966332 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1079383113 11:19956355-19956377 GTGTGTGTGTGTATGTGTGTCGG - Intronic
1079801140 11:24870468-24870490 CTGTGTGTGTGTGTGTGTGTAGG - Intronic
1080275561 11:30499654-30499676 ATGTGTGTGTGTATGTGTCAAGG - Intronic
1080619429 11:33974664-33974686 CTGTGTGTGTGTGTGTGTGTTGG - Intergenic
1080885072 11:36360074-36360096 CTGTGTGTGTGTGTGTGTGTGGG - Intronic
1081351161 11:42054079-42054101 ATGTGTGCGTGCATGTGTGTTGG - Intergenic
1081409060 11:42734127-42734149 CTTTGTCCGTGCCTGTGTCCTGG - Intergenic
1081676957 11:44975611-44975633 CTGACTCAGTGGATGTGTCTAGG + Intergenic
1081750703 11:45508832-45508854 CTGTGTCTGTGCCTTTGCTTGGG + Intergenic
1081831542 11:46120106-46120128 GTGTGTTGGTGCATTTGTCTTGG - Intronic
1082127605 11:48451698-48451720 GTGTGTCTTTGCATGTGACATGG + Intergenic
1082134450 11:48531796-48531818 GTGTGTCTGTGCATGTGAGATGG + Intergenic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1083008804 11:59374295-59374317 GTGTGTCTGTGCATGTGAGATGG - Intergenic
1083056627 11:59827444-59827466 GTGTGTCTGTGTGTGTGTATGGG - Intergenic
1083256227 11:61497177-61497199 CTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1083557438 11:63642071-63642093 GTGTGTATGTGTATGTCTCTAGG - Intronic
1083626148 11:64073090-64073112 CAGCCTCTTTGCATGTGTCTGGG - Intronic
1083766538 11:64844165-64844187 GTATGTGTGTGCATGTGTCGGGG + Intronic
1084009940 11:66341963-66341985 CTGTGTATGTGCTTGTGTGTAGG + Intronic
1084182162 11:67452256-67452278 CTGGGTCTGCGCCGGTGTCTGGG - Exonic
1084219556 11:67668905-67668927 CTGTGTGTCTGTATGTGTATGGG + Intronic
1084219596 11:67669496-67669518 CTGTGTGTCTGCGTGTGTATGGG + Intronic
1084230061 11:67745479-67745501 GTTTTTCTGTGCATGTGTATGGG - Intergenic
1084439245 11:69161939-69161961 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1084523481 11:69680907-69680929 GTCTGTGTGTGCATGTGTGTGGG - Intergenic
1084564051 11:69919702-69919724 CTGTGTGTATGCATGTGTGGTGG - Intergenic
1084609163 11:70190772-70190794 CTGTGTGTGTGCATATGTGCCGG + Intergenic
1084609169 11:70190971-70190993 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609171 11:70191015-70191037 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609173 11:70191099-70191121 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609176 11:70191223-70191245 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084622114 11:70279701-70279723 CCTTTTCTGTGTATGTGTCTAGG + Intronic
1084676229 11:70637075-70637097 ACGTGTGTGTGCATGTGTATGGG + Intronic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1084932811 11:72570648-72570670 CTGTGTCTGGGCAGCTGTGTGGG - Intergenic
1085153379 11:74270046-74270068 GTGTGTATGTGTGTGTGTCTTGG - Intronic
1085443561 11:76583541-76583563 ATATGTGTGTGCATGTGTGTTGG - Intergenic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1085850307 11:80111595-80111617 ATGTGTCTTTGCATGTGAGTTGG - Intergenic
1085941316 11:81209067-81209089 CTGTGTCTGATCTTGTGGCTTGG - Intergenic
1086158987 11:83699926-83699948 GTGTGTGTGTGCATGTGTGGTGG - Intronic
1087013208 11:93532630-93532652 CTGTGTCTGTGTATGAGTCAGGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1088003169 11:104907225-104907247 CTGTGTGTTTGTATGTGTATGGG - Intergenic
1088010887 11:104999593-104999615 GTGTGTGTTTGCATGTGTGTGGG - Intronic
1088691846 11:112335057-112335079 ATGAGTCTGTGAATTTGTCTTGG + Intergenic
1088697740 11:112382849-112382871 CTGTCTCTGAGCCTGTGGCTGGG - Intergenic
1088867793 11:113865224-113865246 CTTTGTGTGTGCGTGTGGCTGGG + Intronic
1088920589 11:114257661-114257683 GTGTGTCTGTGTGTGTGTGTCGG - Intergenic
1088996167 11:114999235-114999257 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1089121297 11:116137525-116137547 CTGTGTCTGTGCTGGAGTCAGGG + Intergenic
1089188251 11:116635620-116635642 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1089210408 11:116796779-116796801 ATGTGTATTTTCATGTGTCTTGG - Intergenic
1089499535 11:118924320-118924342 CTGTGTCTGTGTCTGTGTCTGGG - Intronic
1090102567 11:123815526-123815548 TTGTGTGTGTGTATGTGTATGGG + Intergenic
1090641887 11:128736835-128736857 CTGTGTGTATGCAGGTGTGTGGG + Intronic
1090816236 11:130298828-130298850 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1090916289 11:131165954-131165976 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1091147432 11:133291844-133291866 TGGTGTGTGTGCATGTGTGTGGG - Intronic
1091196978 11:133739375-133739397 GTGTGTTTGTGTATGTGTGTGGG + Intergenic
1091710853 12:2739125-2739147 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1091926860 12:4358355-4358377 ATGTGTATGTGCGTGTGTTTTGG + Intergenic
1092229341 12:6767993-6768015 CTGTGTCTGTGCATGGCTGTCGG + Intronic
1092389101 12:8059744-8059766 CTCTATCTGTGGATGTATCTGGG - Exonic
1092441481 12:8508824-8508846 CTGTGGCTCTGTATCTGTCTGGG - Intergenic
1092630752 12:10373706-10373728 GTGTGTGTGTGCATATGTTTAGG + Intronic
1092870128 12:12798830-12798852 GTGTGTCTGTGGGTGTGTATTGG - Intronic
1093229969 12:16531999-16532021 ATGTGTCTGTCAATGAGTCTAGG + Intronic
1093545653 12:20343290-20343312 CTGTGTATGTGCATATGTGTTGG - Intergenic
1093782065 12:23148084-23148106 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1093894623 12:24562462-24562484 CTGTGTGTGTGCGTGTGTGCCGG + Intergenic
1093987280 12:25550104-25550126 TTGTGTGTGTGTATGTGTATTGG + Intronic
1094697496 12:32834997-32835019 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1094862063 12:34478545-34478567 GTGTGTCTCTGCATGTGAGTTGG - Intergenic
1095038796 12:37421089-37421111 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1095405713 12:41864877-41864899 CTTTGTCTGTGCCTATGTCCTGG - Intergenic
1095441168 12:42239493-42239515 CTGTTTCTGTCCATCTTTCTAGG + Intronic
1095594011 12:43938488-43938510 AAGGGTGTGTGCATGTGTCTTGG + Intronic
1095683773 12:45008836-45008858 GTGTGTCTGTGTGTGTGTGTAGG - Intergenic
1095686055 12:45035131-45035153 CTGCCTCTGTGCATGTGTTTTGG - Intronic
1095731925 12:45515286-45515308 GTGTGTGTGTGCATGTCTATGGG - Intergenic
1096124901 12:49111975-49111997 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1096747978 12:53740898-53740920 CTGTGTATCTGCATGTGTGCAGG + Intergenic
1096773047 12:53948677-53948699 GTGTGTGTGAGCATGTGTTTCGG + Intergenic
1096901722 12:54889891-54889913 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
1097310009 12:58108896-58108918 TTGTGTGTGTGCGTGTGTGTAGG + Intergenic
1097371875 12:58793312-58793334 TTATGTGTGTGCATGTGTCAGGG + Intronic
1098270281 12:68763391-68763413 CTGTGTCTGTGTCTGTGTGATGG + Intronic
1098484296 12:71003051-71003073 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1098733574 12:74068172-74068194 GTGTGTCTTTGCATGTGTGATGG - Intergenic
1098974169 12:76885057-76885079 GTGTGTCTGTGTATTTCTCTGGG + Intergenic
1099018346 12:77372583-77372605 GTGTGTCTATGCCTCTGTCTGGG - Intergenic
1099514995 12:83586331-83586353 GTGTGTCTCTGCATGTGAGTTGG - Intergenic
1100354555 12:93817309-93817331 CTGTGTGTGTGCTTGTGTTGTGG + Intronic
1101609952 12:106282156-106282178 GTGTGTGTGTGTATTTGTCTTGG - Intronic
1101660678 12:106762837-106762859 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
1101915853 12:108895301-108895323 ATGTGTGTGTGCATGTGTGAGGG + Intronic
1102041816 12:109805809-109805831 GTGTGTCTGTGCATGAGTGTGGG - Intronic
1102237879 12:111305988-111306010 CTGTGTGTGTCCATGTTCCTGGG + Intronic
1102328673 12:112011322-112011344 GTGTATGTGTGAATGTGTCTGGG - Intronic
1102465461 12:113128241-113128263 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1102536742 12:113587347-113587369 ATGTGTGTGAGCCTGTGTCTAGG + Intergenic
1102766428 12:115437414-115437436 GAGTGTGTGTGCATGTGTGTTGG - Intergenic
1102835289 12:116052068-116052090 GTGTGTGTGTGTATGTGTGTAGG - Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103409774 12:120702630-120702652 GTGTGTGTGTGTCTGTGTCTGGG - Intergenic
1103564964 12:121810842-121810864 CCGTGTCTGTCCATCTGTCTGGG + Intronic
1103907223 12:124333994-124334016 GTGTGTGTGCGCATGTGTGTGGG + Intronic
1103950133 12:124545931-124545953 GTGTGGCTTTGCATGTGTCCTGG - Intronic
1103954461 12:124568430-124568452 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
1104424637 12:128665610-128665632 GTGTGTGTGTGCCTGTGTTTGGG - Intronic
1104752252 12:131247226-131247248 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105016488 12:132788894-132788916 CTGGGTCGGGGCCTGTGTCTGGG - Intronic
1105040056 12:132954928-132954950 TTGTTTCTGTGCTTGTGTTTGGG - Intronic
1105405622 13:20129807-20129829 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1105880956 13:24606526-24606548 CTGTGGTTTTGCATTTGTCTGGG - Intergenic
1106100671 13:26693362-26693384 ATGTTTCTTTGCATGTGTGTAGG + Intergenic
1106122852 13:26875858-26875880 ATGTATGTGTGCGTGTGTCTGGG + Intergenic
1106227458 13:27795760-27795782 GTGTGTCTGTGTGTGTGTGTAGG - Intergenic
1107308047 13:39044251-39044273 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1107394677 13:40003170-40003192 CTGTGTGTGTGTCTGTGTGTGGG - Intergenic
1107637789 13:42410298-42410320 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108010059 13:45997452-45997474 CTTTGCCTGTGTATGTGTTTTGG - Intronic
1108959893 13:56213601-56213623 GTGTGTTTGTGTATGTGTGTGGG - Intergenic
1109195543 13:59374403-59374425 GTGTGTATGTGCACGTGTATGGG - Intergenic
1109209629 13:59519945-59519967 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1109301076 13:60590817-60590839 CTGTGTCTGGGTCTGGGTCTGGG - Intergenic
1109301078 13:60590823-60590845 GTGTGTCTGTGTCTGGGTCTGGG - Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109618332 13:64866546-64866568 CTGTGTCTGTGCAAAGCTCTTGG + Intergenic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110407149 13:75163166-75163188 CTTTCTCTGTGTGTGTGTCTTGG - Intergenic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1110720679 13:78758071-78758093 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1110820850 13:79914396-79914418 ATGTGTATGTGGGTGTGTCTTGG + Intergenic
1111001196 13:82185412-82185434 ATGTGTCTGTGCATGTGATTGGG + Intergenic
1111006023 13:82250110-82250132 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1111358587 13:87144589-87144611 GTGTGTCTGTGTGTGTGTCTGGG - Intergenic
1111454952 13:88468860-88468882 CTGTGTCTCTTCCTTTGTCTTGG + Intergenic
1111836865 13:93399045-93399067 GTGTGTCTGTGTGTGTGTGTAGG - Intronic
1112267655 13:97940148-97940170 CTGTCTCTGTGAATTTGACTAGG - Intergenic
1112439337 13:99414509-99414531 GTGTGAGTGTGCATGTGTTTGGG - Intergenic
1112619932 13:101044790-101044812 GTGTGTCTTTGCATGTGAGTTGG + Intergenic
1112676491 13:101708012-101708034 GTGTGTGTTTGCATGTGTGTAGG - Intronic
1112855467 13:103764456-103764478 GTGTGTCTGTGTGTGTGGCTGGG - Intergenic
1112977071 13:105333525-105333547 ATGTGTCTGTGTGTGTGTTTTGG + Intergenic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1113784241 13:112994114-112994136 CACTGTCTGTGCCGGTGTCTCGG + Intronic
1113784282 13:112994319-112994341 CACTGTCTGTGCCGGTGTCTCGG + Intronic
1113784298 13:112994398-112994420 CACTGTCTGTGCCAGTGTCTCGG + Intronic
1113962779 13:114134264-114134286 GTATGTCTGTGCATGTGTATGGG - Intergenic
1113964030 13:114142355-114142377 GTGTGTCAGTGTATGTGTATGGG - Intergenic
1114599840 14:23945714-23945736 GTGTGTCTTTGCATGTGTGATGG - Intergenic
1114669946 14:24405074-24405096 GTGTGTGTGTGTATGTGTGTTGG + Intronic
1114670971 14:24410836-24410858 CTGTGTGTACGCATGTGTGTAGG - Intronic
1114992613 14:28306335-28306357 GTGTGTGTGTGCATGTGTGAAGG + Intergenic
1115066348 14:29266049-29266071 GTGTGTCTGTGTATGTGTGGTGG - Intergenic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1115971129 14:38945911-38945933 CTGTGTTTGTGTATGTGTGGTGG - Intergenic
1116258827 14:42595055-42595077 GTGTGTGTGTGCGTGTGTGTGGG + Intergenic
1116296157 14:43113071-43113093 GTGTGTATGTGTGTGTGTCTAGG - Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1116729967 14:48608947-48608969 GTGTGTCTCTGCATGTGTGATGG - Intergenic
1117524505 14:56584016-56584038 GTGTGTGTGTGTATGTGTTTAGG + Intronic
1117771257 14:59136447-59136469 AAGTTTCTGTGCATGTTTCTGGG - Intergenic
1117959445 14:61148483-61148505 GTGTGTGTGTGCACGTGTGTGGG + Intergenic
1118065759 14:62188617-62188639 CTGTGTTTGTGGATCTCTCTGGG + Intergenic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118188568 14:63559708-63559730 GTGTGTTTGTGTATGTGTATGGG + Intergenic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118766217 14:68911032-68911054 CTGTGTTTGTGCCTGTGAATTGG + Intronic
1118954437 14:70467146-70467168 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1119488357 14:75007836-75007858 GTTTGTGTGTGCATGTGTTTTGG + Intronic
1119615789 14:76098245-76098267 CTGTGTGTGTGTGTGCGTCTGGG + Intergenic
1119635874 14:76273067-76273089 CTCTGTGTGTGCATGTGTGTGGG - Intergenic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1120454276 14:84712262-84712284 CTGTCTCACTGCATGTGTCCAGG + Intergenic
1120486851 14:85124904-85124926 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1120522011 14:85534609-85534631 CTGTGTGTGTGCGTGTGTTTGGG + Intronic
1120950841 14:90040399-90040421 AGGTCTCTGTGCATGTGTCCTGG + Intronic
1121148515 14:91607716-91607738 GACTGTCTGTGCATGTGTATGGG + Intronic
1121301620 14:92876145-92876167 GTATGTGTGTGCATGTGTGTGGG - Intergenic
1121702238 14:95963270-95963292 GTGTGTATGTGCCTGTGTGTGGG - Intergenic
1121741019 14:96252439-96252461 CTGGGTCTGTGCATGTGCCCTGG + Intronic
1121871398 14:97411298-97411320 ATGTGTCTGTGTATGTGTGAAGG - Intergenic
1122178622 14:99938737-99938759 CTGGGTGTGCGCATGTTTCTTGG - Intronic
1122198213 14:100105609-100105631 CTCTTTCTTTGCATGTGCCTTGG + Intronic
1122266768 14:100550314-100550336 CTGGGCCTCTGCATCTGTCTCGG + Intronic
1122324345 14:100873703-100873725 GTGTCCCTGTGCATGTGTGTTGG + Intergenic
1122774076 14:104109572-104109594 ATGTGTGTATGCATGTGTGTGGG + Intronic
1122850582 14:104526890-104526912 AAGTGTGTGTGCATGTGTGTGGG - Intronic
1122986771 14:105215463-105215485 GTGTGTGTGTGCATGTGTTCTGG - Intronic
1123055897 14:105570054-105570076 TTGTGTGTGTGAATGTGTATAGG - Intergenic
1123079440 14:105685253-105685275 CTGTCTCTGTATGTGTGTCTAGG + Intergenic
1123080323 14:105690191-105690213 TTGTGTGTGTGAATGTGTATAGG - Intergenic
1123125975 14:105946265-105946287 ATGTGTGTGTGCGTGTGTCTTGG - Intergenic
1123780790 15:23625966-23625988 CTGTGTCTGACCATGTGGTTGGG + Intronic
1124108776 15:26767168-26767190 GTGTGTCTGTGCTTGGCTCTAGG - Intronic
1124237774 15:28004478-28004500 CTGTGTGTGTGTCTGTGTGTGGG - Intronic
1124237789 15:28004631-28004653 GTGTGTCAGACCATGTGTCTGGG - Intronic
1124250822 15:28105594-28105616 GGGTGTGTGTGCATGTGTGTAGG + Intergenic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124250903 15:28106140-28106162 GTGTGTGTGCGCATGTGTGTGGG + Intergenic
1124250906 15:28106163-28106185 GTGTGTGTATGTATGTGTCTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124250926 15:28106309-28106331 GTGTGTGTATGCATGTGTGTGGG + Intergenic
1124448191 15:29758698-29758720 CTGTGTGTGTGTATGTGTTGCGG + Intronic
1124504225 15:30259349-30259371 GTGTGTCTGTGTATGTATTTAGG - Intergenic
1124739329 15:32279294-32279316 GTGTGTCTGTGTATGTATTTAGG + Intergenic
1124815123 15:32982571-32982593 ATGTGTCTGTGAAGGTGTTTTGG + Intronic
1124919050 15:34006728-34006750 CTCTGTCTCTGCATTTGTGTAGG - Intronic
1125028500 15:35053740-35053762 TGGTGTCAGTGTATGTGTCTAGG + Intergenic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125194606 15:37031843-37031865 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1125797530 15:42414519-42414541 CTGTGTGTGTGCAAGTGTGCAGG - Exonic
1127188942 15:56509048-56509070 CTGTGTCTTTGCATGTGAGATGG - Intergenic
1127193936 15:56563650-56563672 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1127312072 15:57761308-57761330 CTATCTCTGTGCACGTGCCTGGG - Intronic
1127550925 15:60037714-60037736 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1127630031 15:60819742-60819764 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1127899092 15:63328085-63328107 CTGAGTCTGGGTATGTGGCTGGG - Exonic
1127931164 15:63598456-63598478 CAGTGTCTATGTCTGTGTCTGGG - Intronic
1127990987 15:64117107-64117129 ATGTTACTGTGCTTGTGTCTTGG + Intronic
1128039884 15:64562893-64562915 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1128339620 15:66811875-66811897 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1128585261 15:68843879-68843901 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1128596580 15:68957136-68957158 CTGTGCCTGTTCATGTTTCTGGG + Intronic
1128747767 15:70126525-70126547 GTGTGGCTGTGCCTGTGACTTGG + Intergenic
1129135629 15:73547849-73547871 CTTTGCCTGTGCCTGTGTCCTGG - Intronic
1129232099 15:74202690-74202712 GTGTGTCTGTGGGTCTGTCTAGG - Exonic
1129295423 15:74597502-74597524 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1129326619 15:74803248-74803270 CTGTGTCTGTGAGTGGGGCTGGG + Intergenic
1129936274 15:79452767-79452789 CTGTGTGCGTGTCTGTGTCTAGG + Intronic
1130138440 15:81201270-81201292 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1130140577 15:81222729-81222751 GTGTGTCTGTGAGTGTGTGTTGG - Intronic
1130182301 15:81642869-81642891 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
1130572075 15:85055698-85055720 GTGTGTCTCTGCATGTGAGTTGG + Intronic
1130865330 15:87928847-87928869 GTGTGTCTGTGTGTGTGTTTGGG + Intronic
1131627473 15:94137071-94137093 CTCTGGCTGTGCCTGTGTTTCGG + Intergenic
1132023025 15:98381155-98381177 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1132052888 15:98625005-98625027 GTGTGTGTGTGCATGATTCTAGG + Intergenic
1132097227 15:98996536-98996558 GTGTGTGTGTGCATATGTATAGG + Intronic
1132225795 15:100140448-100140470 CTGTGTGTGTGTGTGTGTCTTGG - Intronic
1132580358 16:681910-681932 CTGTGTGTGTGCACGTGGCGTGG + Exonic
1133039220 16:3051201-3051223 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1133424122 16:5672873-5672895 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134107856 16:11496724-11496746 GTGTGCCTATGCATGTGTCCAGG + Intronic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1134341389 16:13350020-13350042 GTGTGTCTGTGAGTGTGTTTTGG + Intergenic
1134346312 16:13394975-13394997 TTGTGTGTGTGCATGTGTAGGGG + Intergenic
1134598880 16:15517853-15517875 GTGTGTGTGTGGATGTGTGTGGG + Intronic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135227220 16:20671436-20671458 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1135608481 16:23843950-23843972 GTGTGTGTGTGCATGTGTGATGG - Intronic
1135612141 16:23877604-23877626 CTCTTTCTGTGCATTTGTCTGGG + Intronic
1135803631 16:25522347-25522369 GTGTGTGTGTGTATGTGTATGGG - Intergenic
1135845491 16:25914635-25914657 GTGTGTGTGTGCACGTGTGTGGG + Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1135918155 16:26624514-26624536 CTGTGTCTGTGTGTGTGTGCTGG - Intergenic
1136020905 16:27439179-27439201 GCGTGAGTGTGCATGTGTCTGGG - Intronic
1136033163 16:27518184-27518206 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1136134056 16:28243705-28243727 CTGTGTGTGTGTGTGTGGCTTGG + Intergenic
1136134399 16:28246065-28246087 CTTTGTGTGTGTGTGTGTCTGGG - Intergenic
1136300373 16:29330065-29330087 CTGTGTCTGTGGGTGGGTCAGGG + Intergenic
1136475685 16:30511719-30511741 CTCTGTGTGTGCATGAGTTTGGG - Intronic
1137074578 16:35945940-35945962 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1137075595 16:35957246-35957268 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1137273086 16:46915841-46915863 ATGTGTCTGTGTATGTGTGTAGG - Intronic
1137458384 16:48635773-48635795 GTGTGTATGTGCGTGTGTGTGGG + Intergenic
1137562280 16:49510619-49510641 CTGTGTCTGTGTCTATGTCTGGG + Intronic
1138248763 16:55486373-55486395 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1138902569 16:61291879-61291901 GTGTGTCTGTGTGTGTGTGTGGG + Intergenic
1138975541 16:62202820-62202842 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1139453939 16:67056512-67056534 GTGTGTGTGTGTATGTGTGTAGG + Intronic
1139553737 16:67692604-67692626 TTGTTTCTGTGCATGTGTGTGGG - Intronic
1139594701 16:67950874-67950896 GGGTGTCTGTGCATGTGACCTGG + Intronic
1139705932 16:68740549-68740571 TTGTATCTGAGCATGCGTCTGGG + Intronic
1140334803 16:74095208-74095230 GTGTGTCTGTGTGTGTGTGTAGG - Intergenic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1140889216 16:79270824-79270846 CTCTGTCTGTGTCTGTGTATAGG - Intergenic
1140896097 16:79325588-79325610 GTGTGTGTGTGTTTGTGTCTGGG - Intergenic
1140946143 16:79770196-79770218 GTGTGTTTGTGCACGTGTATGGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141520923 16:84578698-84578720 CTGTGTGTGTGCACCTGTGTGGG - Intronic
1141759699 16:86019825-86019847 GTGTGTGTGTGCATGTGTTCAGG - Intergenic
1141888396 16:86909299-86909321 CTTTGTTTGTGAATGTGTATTGG - Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141929003 16:87188385-87188407 GTGTGCGTGTGCATGTGTGTGGG + Intronic
1141983454 16:87564332-87564354 TTGTGTGTGTGCGTGTGTGTTGG + Intergenic
1142007840 16:87698487-87698509 CTGCCTCTGTGCATGTCTCATGG - Intronic
1142062100 16:88036831-88036853 CTGTGTCTGTGGGTGGGTCAGGG + Intronic
1142144462 16:88487145-88487167 CAGGGTCTCTGGATGTGTCTGGG - Intronic
1142224180 16:88869617-88869639 GTGTGTCTGTGCCTGTGTGTTGG + Intergenic
1142273875 16:89105587-89105609 CAGTTTCTGTGCCTGTGACTGGG + Intronic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1142410618 16:89914406-89914428 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410642 16:89914605-89914627 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410646 16:89914649-89914671 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410651 16:89914685-89914707 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410668 16:89914859-89914881 TTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142951458 17:3484502-3484524 TTGTGTATGTGTATGTGTTTGGG + Intronic
1143011800 17:3870066-3870088 CTCTGTCTGTGCCTCTGTCCTGG - Intronic
1143168081 17:4908983-4909005 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1143168087 17:4909045-4909067 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
1143411275 17:6710770-6710792 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1143446770 17:7014536-7014558 CTGTGTCTGTGCTTGAGTGGGGG + Exonic
1143679091 17:8462808-8462830 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1143772294 17:9176391-9176413 CTGTGTCTGTGTATATTTCAGGG + Intronic
1143809681 17:9461231-9461253 CTGTGTATCTGCTTGTGTTTTGG - Intronic
1143865525 17:9919999-9920021 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1144074872 17:11708342-11708364 CTGTGTGTCTGTCTGTGTCTTGG + Intronic
1144080563 17:11760366-11760388 CTTTGTTTGTGCATGTGTGCCGG + Intronic
1144107554 17:11999274-11999296 ATGTGTATGTGCATTTTTCTTGG - Intergenic
1144142277 17:12361437-12361459 CTGTGTCTGTGTGTGTGTGTAGG - Intergenic
1144201809 17:12948713-12948735 GTGTGTGTGTGTATGTGTGTTGG - Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144655399 17:17032105-17032127 CTGTGTCTGTGCATGTCCAGAGG - Intergenic
1144778743 17:17797501-17797523 CTGTTTCTGTGCCCTTGTCTGGG - Exonic
1145234886 17:21201435-21201457 CTGTGACTGTGCCAGTGTCACGG + Intronic
1145904814 17:28510309-28510331 GTATCTCTGTGCATGTGTCTGGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146341971 17:32027469-32027491 CTGTGTGTGTGCTTGTGTGTGGG + Intronic
1146374700 17:32286163-32286185 CTGTGGCTGTGGATGAGCCTGGG - Intronic
1146404880 17:32528461-32528483 GTGTGTGTGTGTATGTGTGTCGG + Intronic
1146553541 17:33803329-33803351 CTGTGTATGTGTATATGTGTGGG + Intronic
1146733021 17:35212150-35212172 CTGTGTATGAGCAAGTGTGTTGG + Intergenic
1146969846 17:37063722-37063744 GTATGTATGTGCATGTGTATCGG + Intergenic
1147141990 17:38465318-38465340 CTGTGTGTGTGTGTGTCTCTGGG + Intronic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147455217 17:40533573-40533595 GTGTGTGTGTGTGTGTGTCTCGG + Intergenic
1147533320 17:41300447-41300469 ATATGTGTGTGCATGTGTGTGGG + Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585518 17:41652062-41652084 GTATGTGTGTGCATGTGTGTTGG - Intergenic
1147585521 17:41652101-41652123 GTATGTGTGTGCATGTGTGTTGG - Intergenic
1147608802 17:41789256-41789278 ATGTGTGTGTGCATGTGTGGAGG - Intergenic
1147951361 17:44109777-44109799 CTGTGTGTGTGCGTGTGAATGGG - Intronic
1148335186 17:46836118-46836140 GTGTGTGTGTGTGTGTGTCTCGG + Intronic
1148570089 17:48661437-48661459 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1149514419 17:57269318-57269340 GTGTGTCTGTGCGGGTGTATGGG + Intronic
1150359937 17:64522978-64523000 CCGTGTGTGTGTATGTGTATTGG + Intronic
1150556023 17:66254787-66254809 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1151178219 17:72306468-72306490 GTGTGTCTGTGTGTGTGTGTTGG - Intergenic
1151412304 17:73939248-73939270 CTGTGTGTGTGTGTGTGTGTAGG - Intergenic
1151497146 17:74465252-74465274 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497156 17:74465638-74465660 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497161 17:74465754-74465776 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497163 17:74465804-74465826 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497165 17:74465858-74465880 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497167 17:74465906-74465928 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151847962 17:76671402-76671424 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1151929049 17:77219296-77219318 CCGAGTCTGTGCAGGTGCCTGGG + Intergenic
1152056241 17:78029804-78029826 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152330881 17:79672000-79672022 CTATGTATTTGCATGTGTATAGG - Intergenic
1152504922 17:80742939-80742961 CTGTGTGTGTGTGTGTGTATAGG - Intronic
1152575419 17:81138240-81138262 ATGTCTCTGTGCATGTGTGTGGG - Intronic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1152582020 17:81170187-81170209 ATGTGTCTTTGCATATGTGTAGG + Intergenic
1152997018 18:417037-417059 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1153045708 18:854067-854089 CTGAGTCTGCTCAAGTGTCTTGG + Intergenic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153769054 18:8400876-8400898 ATGTGTGTGTGCATGTGTTGGGG + Intronic
1153793331 18:8599575-8599597 CTGTGTCACTGCATGGGACTTGG + Intergenic
1153960351 18:10134958-10134980 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153961648 18:10145269-10145291 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1154351864 18:13590007-13590029 GTGTGGCTGTGCATGTGTATGGG + Intronic
1155073843 18:22338436-22338458 CTGTCTCTGTGCCTCTCTCTGGG - Intergenic
1155705309 18:28803109-28803131 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1156012192 18:32508297-32508319 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1156476271 18:37407503-37407525 ATGTGTGTGTGCATGTGTACAGG + Intronic
1157174928 18:45442902-45442924 ATGTGTCTGTGCATGGGGATTGG + Intronic
1157336110 18:46738731-46738753 CTGGGGCTGTGCCTGTTTCTCGG + Intronic
1157498813 18:48175499-48175521 CAGTGTATGTGCATGTGTATGGG + Intronic
1157539001 18:48485852-48485874 GTGTGGCTGTCCATGTGGCTTGG - Intergenic
1157625377 18:49046257-49046279 CTGTGTCTGTGTATATGTTGTGG - Intronic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1159027533 18:63198990-63199012 GTGTGTCTGTGTATGTCTGTGGG - Intronic
1159027536 18:63199120-63199142 CTGTGTCTGTGCCTGTACATGGG - Intronic
1159228271 18:65569798-65569820 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1159520919 18:69522223-69522245 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1159592124 18:70346830-70346852 GTGTGTCTGTGCATGTGAGATGG + Intronic
1160523235 18:79520843-79520865 GTGTGTCTGTGTATGTGTGGGGG + Intronic
1160523286 18:79521132-79521154 GTGTGTCTGTGTGTGTGTGTAGG + Intronic
1160523443 18:79521995-79522017 GTGTGTCTGTGCATGTGTGGGGG + Intronic
1160603595 18:80033292-80033314 CTGTGTGTGTGTGTGTGTGTGGG - Intronic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1160921910 19:1524615-1524637 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1161227968 19:3156159-3156181 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1161313116 19:3606098-3606120 CTGTGTCTGTGCGTGTGTGGTGG - Intronic
1161420214 19:4172436-4172458 CTGTGTCTGTCTGTCTGTCTGGG - Exonic
1161420230 19:4172602-4172624 CTGTGTCTGTCTGTTTGTCTGGG - Exonic
1161420240 19:4172692-4172714 CTGTGTCTGTCTGTCTGTCTGGG - Exonic
1161614119 19:5260629-5260651 CTGTGTCTGTGTCTGTGGCCAGG - Intronic
1161702416 19:5802684-5802706 GTGTGTCTGTGTGTGTGTGTGGG + Intergenic
1161933406 19:7356119-7356141 ATGTGTGTGTGTATGTGTGTTGG - Intronic
1162015266 19:7842163-7842185 CTGTGTGTGTGAATGTGCATGGG + Intronic
1162188352 19:8924414-8924436 ATGTGTGTGTGCGTGTGTGTTGG - Intronic
1162468448 19:10857252-10857274 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1162738876 19:12762526-12762548 GTGTGTCTGTGAATGTGTGGTGG - Intergenic
1163068274 19:14815805-14815827 GTGTGTGTGTGTCTGTGTCTGGG + Intronic
1163076176 19:14893821-14893843 GTGTGTGTGTGCACGTGTGTGGG - Intergenic
1163148449 19:15397926-15397948 CTGTTTCAGGGCTTGTGTCTGGG - Intronic
1163163870 19:15481973-15481995 GAGAGTCTGTGCATGTGTCAAGG - Intronic
1163687027 19:18717537-18717559 CTGTGTTTCTGCCTGTGTGTGGG + Intronic
1164150588 19:22547083-22547105 TTGTGTGTGTGCCTGTGTGTAGG - Intergenic
1164380328 19:27731003-27731025 CTGTGTGTGTGTTTGTGTGTGGG - Intergenic
1164440275 19:28271825-28271847 GTGTGTCTCTGCATGTGTGATGG - Intergenic
1164519480 19:28967630-28967652 TTGTGAGTGTGCATGTGTGTGGG + Intergenic
1164675862 19:30100985-30101007 GTGTGTCTGTGGATGCTTCTTGG - Intergenic
1165072716 19:33264816-33264838 GTGTGTCTGTGCATGGGCCTGGG - Intergenic
1165073661 19:33269347-33269369 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1165076032 19:33280380-33280402 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1165153796 19:33775636-33775658 ATGTGTCTGTGTGTGTGTCTGGG + Intergenic
1165157986 19:33799417-33799439 CAGTGTCTGTGGATGTGTGAAGG + Intronic
1165174402 19:33916881-33916903 CTGTGTATATGCATGCCTCTGGG - Intergenic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165391122 19:35539560-35539582 GTGTGTATTTGCATGTGTGTGGG - Intronic
1165428192 19:35756976-35756998 CTGTGCCTGTGCAGCCGTCTTGG - Exonic
1165510870 19:36266110-36266132 GTCTGTCTTTGCATGTGTCGTGG + Intergenic
1166699993 19:44876899-44876921 CTGAGTCTGTTCATATGTCTAGG - Intronic
1166721097 19:44996417-44996439 CTGGATGTGTTCATGTGTCTGGG - Intergenic
1167072605 19:47229645-47229667 CTGTGTGTGTGTGTGTGTGTTGG - Intronic
1167109705 19:47452474-47452496 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1167140383 19:47646420-47646442 GTGTCTGTGTGCATGTGTGTCGG - Intronic
1167359302 19:49021451-49021473 GTGTGTCTGTGTCTGTGTGTTGG + Intergenic
1167608957 19:50496932-50496954 CTGTGTCTGTTTGTGTGTATTGG + Intergenic
1167615157 19:50528942-50528964 CTGTGCCTGGGCATGAGGCTGGG + Intronic
1167664764 19:50817631-50817653 CTCTGTCTTAGCATGTCTCTGGG + Intergenic
1167924018 19:52809014-52809036 ATATGTGTGTGCATGTGTGTGGG + Intronic
1167929187 19:52850104-52850126 ATATGTGTGTGCATGTGTGTGGG + Intronic
1168104599 19:54158999-54159021 GTGTTTGTGTGTATGTGTCTAGG + Intronic
1168425856 19:56238065-56238087 GTGTGTCTCTGTGTGTGTCTAGG - Intronic
1168499046 19:56878048-56878070 CTGTGTGTGTGTCTGTGTCCTGG + Intergenic
924991836 2:319150-319172 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
925237530 2:2292599-2292621 CTATGTCTGTGCACCTGTCCCGG - Intronic
925383828 2:3447985-3448007 CTGTGTGTGTGCGTGTGGTTTGG - Intronic
925420467 2:3706554-3706576 GTGTGTGTGTGTATGTGTTTAGG + Intronic
925513463 2:4653311-4653333 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
925708335 2:6712707-6712729 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
925853939 2:8111275-8111297 CTGTGTCTGTGAGGGTGTTTTGG - Intergenic
926075332 2:9938178-9938200 CCGTGTCAGTGCAGGTGCCTGGG - Intergenic
926392204 2:12404866-12404888 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
926491950 2:13535278-13535300 CTGTGTGTGTGTGTGTGTCAAGG - Intergenic
926764013 2:16306687-16306709 GTGTGTCTGTGTATGTGTTAAGG + Intergenic
927155777 2:20220350-20220372 GTGTGTGTGCGCATGTGTATGGG - Intronic
927516298 2:23673716-23673738 CTGTGTATGTGCCTGTGTAGGGG - Intronic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928015602 2:27654056-27654078 CTGTGGTTGTGCATGTCTTTGGG - Intronic
928094694 2:28396785-28396807 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
928136558 2:28692315-28692337 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928447389 2:31345434-31345456 CTGAGTCTGTGCTAGTGTTTGGG - Intronic
928488593 2:31757700-31757722 CTGTGTCTTTGCATGTGAGATGG + Intergenic
928664929 2:33540588-33540610 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928923695 2:36554106-36554128 CTGTCTGTGTGCATGTGTTGTGG - Intronic
928937674 2:36696734-36696756 GTGTGTGTGTGTATGTGTGTGGG + Exonic
929536221 2:42786053-42786075 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
929778255 2:44941906-44941928 GTGTGTGTGTGGATGTGTGTGGG + Exonic
929949161 2:46393202-46393224 CTGTGAGTGTGCATGTATGTTGG - Intergenic
930160056 2:48145752-48145774 CTGTGTGTTTGCATATGTGTTGG - Intergenic
931061504 2:58534388-58534410 CTCTGTGTGTGCGTGTGGCTTGG + Intergenic
931985971 2:67742853-67742875 CTGTGTCTCTGCATGTGAGATGG + Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932224748 2:70030712-70030734 CTCTGTATGTGTATGTGTGTTGG + Intergenic
933104104 2:78300348-78300370 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
933176298 2:79177405-79177427 GTGTGTGTGTGTATGTGTTTAGG - Intergenic
933253261 2:80052345-80052367 TTGTATATGTGCATGTGGCTGGG - Intronic
933308558 2:80632275-80632297 CTGTGTGTGTGTGTGTGTGTTGG - Intronic
933320495 2:80770395-80770417 CTATGTATGTGCGTGTGTGTGGG - Intergenic
933440676 2:82309663-82309685 CTGTGTGTGTGTTTGTGTGTTGG - Intergenic
933782028 2:85809423-85809445 ATGTATGTGTGTATGTGTCTGGG - Intergenic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
934092443 2:88564548-88564570 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
934120459 2:88832871-88832893 CTGTGTCTATGTGTGTGTGTTGG + Intergenic
934752416 2:96801754-96801776 CTCTGTCTGTGTGTGTGTCTGGG - Intronic
934896952 2:98127570-98127592 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
935169019 2:100595931-100595953 GTGTGTGTGTGGGTGTGTCTGGG - Intergenic
935276096 2:101476436-101476458 GTGTGTGTGTGCATATGTTTTGG - Intergenic
935334438 2:102002503-102002525 CTGTGTCTGTGTCTATGTGTAGG + Intronic
935334450 2:102002838-102002860 CTGTGTCTATGTCTGTGTCTAGG + Intronic
935334453 2:102002874-102002896 CTGTGTCTGTGTCTCTGCCTGGG + Intronic
935334465 2:102003254-102003276 CGGTGTCTGTGTCAGTGTCTAGG + Intronic
935334475 2:102003362-102003384 CGGTGTCTGTGTCAGTGTCTAGG + Intronic
935334486 2:102003458-102003480 CTGTGTCTGTGTCGGTGTCTAGG + Intronic
935334498 2:102003566-102003588 CGGTGTCTGTGTCGGTGTCTAGG + Intronic
935334510 2:102003674-102003696 CGGTGTCTGTGTCGGTGTCTAGG + Intronic
935334518 2:102003742-102003764 CGGTGTCTGTGTCTGTGTCTAGG + Intronic
935334523 2:102003907-102003929 CTGTGTCTATGTGTATGTCTAGG + Intronic
935334526 2:102003943-102003965 CTGTGTCTGTGTCTGTGTCTAGG + Intronic
935334527 2:102003949-102003971 CTGTGTCTGTGTCTAGGTCTAGG + Intronic
935952426 2:108343246-108343268 CTGTGTCTTTGCATGTGAGATGG + Intergenic
936169577 2:110156752-110156774 TTGTGTGTGTGTATGTGTTTTGG + Intronic
936339334 2:111617486-111617508 GTGTGTATGTGCGTGTGTATGGG - Intergenic
936628993 2:114179933-114179955 TTGTGTGTGTGCATGTGTTGCGG - Intergenic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937043658 2:118839241-118839263 CTGTGTGTGGGCATTTGTATAGG - Intergenic
937187416 2:120057429-120057451 ATGTGTATGTGCATTTTTCTAGG - Intronic
937496140 2:122421937-122421959 CTGTGTCTATGCCTGTGATTGGG - Intergenic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937582870 2:123510213-123510235 GTGTGTCTGTGTGTGTGTGTAGG + Intergenic
937808569 2:126173684-126173706 CTGTGTATTTGTGTGTGTCTCGG + Intergenic
937817392 2:126266859-126266881 TTGTGTATGTGCGTGTGTGTTGG - Intergenic
938090214 2:128426342-128426364 CTGAGGGTGTGCATGTGTATGGG + Intergenic
938197488 2:129342078-129342100 CTCTCTCTGTGGATGTGTGTGGG + Intergenic
938254503 2:129845291-129845313 CTGTGTGTGTGTGTGTGTTTGGG + Intergenic
938558276 2:132446586-132446608 TTGTGCCTCTGCCTGTGTCTTGG + Intronic
938937848 2:136143296-136143318 GTGTGTGTGTGCAAGTGTGTGGG + Intergenic
939178151 2:138774640-138774662 CTGTGAGTGTGTATGTGTCTTGG - Intronic
939734136 2:145822615-145822637 CTGTGTGTGTGTGTGTGTGTAGG - Intergenic
939949215 2:148448380-148448402 CTGTGTCTGAATATGTATCTAGG - Intronic
940001354 2:148969451-148969473 GTGTGTGTGTGTATGTGTGTGGG + Intronic
940205455 2:151197071-151197093 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
940558879 2:155268158-155268180 CTGTGTGTGTGTGTGTGTGTTGG + Intergenic
940797853 2:158099496-158099518 GTGTGTGTGTGCATGTGTAAGGG + Intronic
941097759 2:161259907-161259929 GTGTGTGTGTGTATGTGTATGGG + Intergenic
941576067 2:167231875-167231897 CATTGTCAGTGAATGTGTCTGGG + Intronic
941881943 2:170489651-170489673 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
942228001 2:173833575-173833597 TTTTGCCTGTGCATGAGTCTCGG - Intergenic
942561672 2:177226535-177226557 GTGTGTGTGTGCATGTGTGGAGG - Intergenic
942641759 2:178067813-178067835 CTCTTTCTGTGCATGTTTGTTGG + Intronic
942713586 2:178865655-178865677 TTGTGTGTTTGCATGTGTGTGGG + Intronic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
943368679 2:186988684-186988706 CTGGGAGGGTGCATGTGTCTAGG + Intergenic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
944418014 2:199498108-199498130 TTGTGTGTGTGCATGTGACAGGG + Intergenic
944859675 2:203803379-203803401 GTGTGTCTGTGTGTGTGTATGGG + Intergenic
944956108 2:204811255-204811277 CTGTGTCTCTCAATGTTTCTTGG + Intronic
945171694 2:207003015-207003037 GTGTGTCTGTGCATGTGAGATGG - Intergenic
945213533 2:207409303-207409325 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
945219355 2:207468349-207468371 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
945329506 2:208523448-208523470 GTGTGTCTTTGCATGTGTGATGG + Intronic
945338401 2:208619833-208619855 GTGTGTGTGTGCATGTGTGCTGG + Intronic
945368681 2:208989285-208989307 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
945436907 2:209829490-209829512 ATGTGTCCATGCATGTGTGTGGG + Intronic
945850284 2:214998072-214998094 TTGTGTTTGAGTATGTGTCTGGG + Intronic
945943791 2:215974797-215974819 GTGTGTCTGTGTCTGTGTTTAGG - Intronic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
946172639 2:217904599-217904621 ATGTGTCTGTGCCTGTGTGTCGG - Intronic
946302321 2:218831468-218831490 GTGTGTCTGAGCGTGTGTATTGG - Intronic
946319544 2:218943859-218943881 CTGTGTCTGTTTCTGTGTCCAGG - Intergenic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
946817704 2:223595882-223595904 GCGTGTGTGTGCGTGTGTCTGGG - Intergenic
946838807 2:223799204-223799226 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
947025950 2:225738212-225738234 GTGTGTCTGTGTGTGTGTCCAGG + Intergenic
947478231 2:230471617-230471639 ATGTGTGTGTGCATATGTTTTGG - Intronic
947483786 2:230527677-230527699 GTGTGTCTTTGCATGTGAGTTGG - Intronic
947591706 2:231389612-231389634 GTGTGTGTGTTCATGCGTCTGGG + Intergenic
947726944 2:232406985-232407007 CTGTGTGTGTGTGTGTGTGTAGG - Intronic
947882480 2:233530201-233530223 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
948045114 2:234937554-234937576 ATGTGTCTGTGCGTGTGTGTTGG - Intergenic
948156092 2:235783034-235783056 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
948161704 2:235830000-235830022 CTGTGTATGTCCAGGTGTCCTGG - Intronic
948256954 2:236575412-236575434 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948256969 2:236575549-236575571 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948256975 2:236575605-236575627 CTCTGTGTGTGTGTGTGTCTGGG + Intronic
948354221 2:237364861-237364883 GTATGTGTGTGCATGTGTATGGG + Intronic
948429530 2:237910209-237910231 CTGTGTGTGTCCCTGTGTGTGGG - Intronic
948429534 2:237910245-237910267 CTGTGTGTGTCCCTGTGTGTGGG - Intronic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948741125 2:240046611-240046633 CTGTGGATGTGCCTGAGTCTGGG - Intergenic
948950900 2:241250701-241250723 CTCTGCGTGTGCATGTGTTTGGG - Intronic
948969782 2:241416017-241416039 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
948991527 2:241558050-241558072 GTGTGTGTGTGTGTGTGTCTCGG - Intergenic
1168732602 20:98996-99018 GTGTGTCTTTGCATGTGTGATGG - Intergenic
1169205625 20:3738848-3738870 GTGTGTGTGTGCATGTGTGCAGG + Intronic
1169421102 20:5461290-5461312 GTGTGTCTTTGCATGTGAGTTGG + Intergenic
1169580516 20:7018044-7018066 GTGTGTGTATGCATGTGTTTTGG + Intergenic
1169772276 20:9214556-9214578 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1169895083 20:10496171-10496193 CAGTGCTTATGCATGTGTCTGGG + Intronic
1169914183 20:10671475-10671497 CTGTGTCTGTGTATGAAGCTTGG - Intronic
1170568438 20:17619728-17619750 GCGTGTCTGTGCATCTGTCCAGG - Exonic
1171010497 20:21506686-21506708 GTGTGTGTGTGTGTGTGTCTCGG + Intergenic
1171030387 20:21671218-21671240 CTGTATATGTGCATGTGTGTGGG - Intergenic
1171073737 20:22101696-22101718 GTGTGTCTGTGTTTGTGTGTGGG + Intergenic
1171533227 20:25865754-25865776 CTGTGCCAGTGCTTGTGTGTCGG - Intronic
1171537994 20:25914705-25914727 GTGTGTCTGTGTGTGTGTGTTGG - Intergenic
1171726593 20:28627274-28627296 CTGTATCAGGGCATGTGGCTTGG + Intergenic
1171751663 20:29057339-29057361 TTGTATCGGTGCATGTGGCTTGG - Intergenic
1171779372 20:29405376-29405398 CTGTGGCTGAGCTTGTGTCCAGG - Intergenic
1171790671 20:29520531-29520553 CTGTATCGGGGCATGTGGCTTGG + Intergenic
1171803200 20:29647120-29647142 GTGTGTCTGTGTGTGTGTGTTGG + Intergenic
1171840926 20:30210022-30210044 GTGTGTCTGTGTGTGTGTGTTGG - Intergenic
1171857041 20:30356305-30356327 TTGTATCGGTGCATGTGGCTTGG - Intergenic
1172780649 20:37435091-37435113 CTGTGTGCATGCATGTGCCTGGG + Intergenic
1172843177 20:37914335-37914357 GTGTATGTGTGCATGTGTGTGGG + Intronic
1173093181 20:39995809-39995831 GTGTGTCTGTGTCTGTGTGTAGG - Intergenic
1173290803 20:41713323-41713345 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1173316864 20:41952440-41952462 GTGTGTCTGTGTATGCGTGTGGG + Intergenic
1173418964 20:42883751-42883773 GGGTGTGTGTGCATGTGTATGGG - Intronic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1173941715 20:46916489-46916511 ATGTGTGTGTGCATGTGTGATGG + Intronic
1174308778 20:49634295-49634317 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1174957746 20:55118744-55118766 GTGTATATGTGCATGTGTGTGGG - Intergenic
1175139458 20:56849247-56849269 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1175230335 20:57469820-57469842 CTCTGTGTGTGCGTGTGTGTAGG - Intergenic
1175297965 20:57922227-57922249 ATGTGTGTATGTATGTGTCTGGG - Intergenic
1175758567 20:61545771-61545793 GGGTGTGTGTGCATGTGTTTGGG + Intronic
1175758600 20:61545986-61546008 GGGTGTCTGTGCATGTGTGGAGG + Intronic
1175758620 20:61546100-61546122 GGGTGTGTGTGCATGTGTGTGGG + Intronic
1176106038 20:63387642-63387664 ATGTGTGTATGCATGTGTGTGGG - Intergenic
1176176772 20:63730974-63730996 GTGTGTGTGTGTGTGTGTCTCGG + Intronic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176198116 20:63846961-63846983 TTGTGTGTGTGTGTGTGTCTCGG - Intergenic
1176647727 21:9366338-9366360 TTGTCTCTGGGCCTGTGTCTTGG + Intergenic
1177313446 21:19426413-19426435 GTGTGTCTTTGCATGTGAGTTGG - Intergenic
1177339120 21:19776430-19776452 GTGTGTGTGTGTATGTGTTTTGG + Intergenic
1177707205 21:24721895-24721917 CTGTGTTTGTGTGTGTGTTTGGG + Intergenic
1177887751 21:26766321-26766343 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1178118763 21:29446230-29446252 ATGTGAGTGTGCATGTGTGTGGG - Intronic
1178489643 21:33041139-33041161 CTCTGTCTCTGCATGTATCTGGG - Intergenic
1178660244 21:34501739-34501761 TTGTGTCTGGGCTTGTTTCTGGG - Intergenic
1178843233 21:36155447-36155469 TTGTGTATATGCATGTTTCTAGG - Intergenic
1178939041 21:36889724-36889746 CTGTGTCTGTGTCTGTGTCTGGG - Intronic
1179107708 21:38418285-38418307 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1179270783 21:39849465-39849487 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1179382394 21:40911456-40911478 CTGAGACTGTGCGTGTGGCTTGG - Intergenic
1179453884 21:41485100-41485122 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1179462868 21:41549506-41549528 CCGTGTCTGTGTCTGTGTCTGGG + Intergenic
1179545604 21:42110854-42110876 CTCTGACAGTGGATGTGTCTTGG + Intronic
1179554082 21:42161462-42161484 GTGTGTCTGTGTATATGTTTGGG - Intergenic
1179606659 21:42520635-42520657 GTGTGTGTGTGCGTGTGTGTGGG + Intronic
1179707936 21:43193218-43193240 CTGTGTGTGTGTGTGTCTCTGGG - Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179966686 21:44810937-44810959 GTGGGTGTGTGCATGTGTGTGGG - Intronic
1180093861 21:45545616-45545638 CTGTATCTGTGCATATGTCTTGG - Intergenic
1180158010 21:45987348-45987370 GTGTGTCTGCCCATGTGCCTGGG + Intronic
1180172842 21:46069016-46069038 GTGTGTCTGTGCATGTCCCTGGG + Intergenic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181433376 22:22896130-22896152 CTCTGTCTGGTCATGTGTCTGGG + Intergenic
1181626614 22:24126432-24126454 CTGTCTCTAGGCATGTGTTTTGG - Intronic
1181713558 22:24707163-24707185 GTGTGACTGTGAATGTGTGTGGG - Intergenic
1181959255 22:26611090-26611112 CTGTCTCTGTGGGTGTCTCTGGG - Intronic
1182095601 22:27623258-27623280 CCATCTCTGTGCATGTGGCTGGG - Intergenic
1182142734 22:27975806-27975828 TCGTGTGTGTGCATGTGTGTGGG - Intergenic
1182203768 22:28601773-28601795 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
1182382579 22:29904824-29904846 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1182430353 22:30295391-30295413 CTTTGTCCCTGCATCTGTCTTGG + Intronic
1182489937 22:30664838-30664860 CTGTCTCTGTGCTTGTCCCTGGG - Intronic
1182492925 22:30685576-30685598 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1182667255 22:31968806-31968828 GTGTGTGTGTGCGTGTGTGTTGG - Intergenic
1182743106 22:32583164-32583186 GTGTGTCTGTCCATGTGTTGGGG - Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183012534 22:34958695-34958717 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1183103947 22:35602652-35602674 CTGTGTGTGTGCGTGTCTCTGGG - Intergenic
1183370122 22:37427436-37427458 GTGTGTCTGTGTGTGTGTCTGGG + Exonic
1183984350 22:41561411-41561433 CTGTGTCTGTGTCTGTGTCTGGG + Intronic
1184390563 22:44200998-44201020 CTGTGGCTGTGGCTGTGGCTGGG - Intronic
1184521456 22:44996653-44996675 GTGTGTCTGTGTGTGTGTGTAGG - Intronic
1184821000 22:46909285-46909307 GTGTGTGTGTGTATGTGTATAGG - Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
1185165432 22:49259299-49259321 CTGAGTCTCTCCTTGTGTCTGGG - Intergenic
1185216848 22:49605672-49605694 CTGTTGCTGTGCATTTGACTTGG - Intronic
1185285656 22:49998837-49998859 GTATGTGTGTGCATGTGTATGGG + Intronic
1185285660 22:49998885-49998907 ATGTGTGTGTGCATGTGTATGGG + Intronic
1185285664 22:49998921-49998943 GGGTGTCTGTGCATGTGTATGGG + Intronic
949340049 3:3019692-3019714 GTGTGTCTGTGTGTGTGTGTAGG + Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949706246 3:6820730-6820752 CTGTGCTTGTGTGTGTGTCTTGG - Intronic
949791516 3:7797301-7797323 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
949905665 3:8856350-8856372 ATGTGTGTGTGCGTGTGTGTGGG + Intronic
950463958 3:13142338-13142360 CTGTGTCTGAGCATGCATCTGGG - Intergenic
950587026 3:13900271-13900293 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
950633061 3:14296952-14296974 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
950802126 3:15561297-15561319 CTATATCTGTGCCTGTGTCCAGG - Intronic
952013669 3:28931846-28931868 ATGTGTCTGTGCTTCTGTCTAGG + Intergenic
952067394 3:29587558-29587580 GTGTCTGTGTGTATGTGTCTTGG + Intronic
952089056 3:29862609-29862631 GTGTGTGTGTGCATGTGTGGTGG + Intronic
952190264 3:31015469-31015491 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
952618945 3:35312508-35312530 GTGTATGTGTGCATGTGTGTGGG + Intergenic
952814656 3:37436673-37436695 CTGTCCCTGTGCATCTGCCTGGG + Intergenic
952825094 3:37518104-37518126 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
952921535 3:38288140-38288162 CTGTGTCTATGAATTTGACTAGG + Intronic
952971055 3:38650243-38650265 CTGTGTCTGTGTGGGTGTGTGGG - Intergenic
953412876 3:42700006-42700028 CTGTGTGTGTGTGTGTGTGTTGG + Intronic
953412884 3:42700080-42700102 CTGTGTGTGTGTGTGTGTGTCGG + Intronic
953412908 3:42700328-42700350 GTGTGTTTGTGTGTGTGTCTGGG + Intronic
953412910 3:42700360-42700382 CTGTGTGTGTGTGTGTGTGTCGG + Intronic
953758482 3:45667595-45667617 CTGTGTGTGTGTATGTGTTTAGG + Intronic
953904953 3:46863996-46864018 CTGTGTCTGTGTTTGTGTGGAGG + Intronic
954400129 3:50315118-50315140 GTGTGTGTGCGCATATGTCTGGG + Intergenic
954413972 3:50383900-50383922 CTGTGTGCGTGCATTTGTGTGGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954688032 3:52381105-52381127 GTGTGTGTGTGTATGTGACTGGG + Intronic
955089420 3:55734574-55734596 GTGTTTATGTGCATGTGGCTGGG - Intronic
955566218 3:60249685-60249707 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
956110333 3:65864186-65864208 GTGTGTCTGTGTATGTATTTAGG - Intronic
956277451 3:67518039-67518061 ATGTGTCTTTGAATGTGTTTTGG - Intronic
956457310 3:69435109-69435131 ATGTGACTGTGCATGTGGATAGG - Intronic
956715158 3:72072814-72072836 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
956780669 3:72600652-72600674 AAGTCTCTGTGCAAGTGTCTGGG - Intergenic
958187225 3:90137302-90137324 CTGTGTCTGTGAGAGTGTTTTGG - Intergenic
958973077 3:100634996-100635018 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
959139761 3:102471551-102471573 TTGTGTGTGTGTATGTGTGTAGG - Intronic
959432335 3:106270469-106270491 GTGAGTCTGTGCAGGTGTTTTGG - Intergenic
959487637 3:106945768-106945790 GTGTGTGTGTGTATGTGTATAGG - Intergenic
959626533 3:108458319-108458341 CTGGGTTTCTGGATGTGTCTAGG - Intronic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
959723749 3:109521335-109521357 CTGTGTCTCTGCATGTGAGATGG + Intergenic
959751488 3:109841842-109841864 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
959929719 3:111966505-111966527 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
960038407 3:113124652-113124674 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
960165916 3:114401079-114401101 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
960348396 3:116563554-116563576 CTGTGTGTGTGTGTGTGTGTAGG + Intronic
960363663 3:116745092-116745114 CTGTGTCTCTGCATGTGAGATGG - Intronic
960465930 3:117996818-117996840 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
960535924 3:118814089-118814111 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406558 3:126683839-126683861 GTGTGTGTGTGCGTGTGTGTAGG + Intergenic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
961809809 3:129515248-129515270 CGCTGCCTGTGCAGGTGTCTTGG + Intronic
961867729 3:129966088-129966110 ATGTGTATATGCATGTGTATGGG - Intergenic
961970149 3:130954941-130954963 ATGTGTGTGTGTATGTGTTTTGG + Intronic
962221653 3:133569432-133569454 GTGTGTGTGTGTCTGTGTCTAGG + Intergenic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962416100 3:135183475-135183497 TTGTTTCTGTGCATGTGACTGGG + Intronic
962817377 3:139014169-139014191 ATGTGTATGTGTGTGTGTCTGGG - Intronic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963075860 3:141345710-141345732 GTGTGTGTGTGGGTGTGTCTTGG + Intronic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963318044 3:143782106-143782128 CTGTGTCTGTGCACATATCTGGG - Intronic
963322875 3:143828562-143828584 CTGTGTGTGTGTGTGTGTGTTGG - Intronic
963431283 3:145207618-145207640 GTGTGTGTGTGCATGTGTGCGGG + Intergenic
963837547 3:150072222-150072244 CAGGGTCTGTGGAGGTGTCTGGG - Intergenic
963852443 3:150222157-150222179 GTGTGTGTGTGCATCTGTGTTGG + Intergenic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
964195684 3:154061915-154061937 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
964385941 3:156147936-156147958 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
964656301 3:159069877-159069899 GTGTGTGTGTGCGTGTGTATGGG + Intronic
964681570 3:159345792-159345814 CTGGGCCTGAGGATGTGTCTTGG + Intronic
964829049 3:160862651-160862673 GTGTGTGTGTGCGTGTGCCTAGG - Intronic
965176746 3:165344785-165344807 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
965264508 3:166523585-166523607 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
965382729 3:168010680-168010702 TTGTGGGTGTGCATGTGTATAGG - Intronic
966305396 3:178527767-178527789 GTGTGTGTGTGCATGATTCTAGG - Intronic
966483638 3:180443018-180443040 CTGTCTCTCTGCTTCTGTCTCGG - Intergenic
966656948 3:182369795-182369817 TTGTGTGTGTGCATGTGTATAGG + Intergenic
967090993 3:186134682-186134704 CTGTGTCAGTGTATGTGTATGGG + Intronic
967241255 3:187441689-187441711 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
967987995 3:195109867-195109889 GTGTATGTGTGCATGTGTGTGGG + Intronic
967988277 3:195112465-195112487 ATGCGTGTGTGCATGTGTGTGGG - Intronic
968126641 3:196164985-196165007 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1202739156 3_GL000221v1_random:38649-38671 TTGTCTCTGGGCCTGTGTCTTGG - Intergenic
968483534 4:848016-848038 CTGCGTGTGCGCAGGTGTCTGGG + Intergenic
968609728 4:1551488-1551510 CTGTGTCCCTGCATGTGGGTTGG + Intergenic
968620005 4:1599785-1599807 GAGTGCCTGTGCAGGTGTCTGGG - Intergenic
968913490 4:3487186-3487208 CTGTGCCTCTGCAGGTGTGTGGG + Intronic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969149815 4:5160076-5160098 ATGTGTCTGTGCGGGTGTTTTGG - Intronic
969193746 4:5544417-5544439 TTGTGTGCGTGCATGTGTGTGGG - Intronic
969291679 4:6244147-6244169 CTCAGTCTGTGTCTGTGTCTGGG + Intergenic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
969514610 4:7639440-7639462 GTGTGTGAGTGCATGTGTGTGGG + Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
970073084 4:12184699-12184721 TTGTTTGTGTGCATGTGTGTAGG + Intergenic
970214973 4:13749391-13749413 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
970425325 4:15940577-15940599 GTATGTGTGTGAATGTGTCTAGG - Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
971097235 4:23421280-23421302 GTGTGTGTGTGGATGTGTGTGGG + Intergenic
971108357 4:23552802-23552824 GTGTGTGTGTGAATGTGTTTAGG - Intergenic
971470672 4:27022677-27022699 CTGTAACTGTGGATGTGTCTTGG + Exonic
971562798 4:28102698-28102720 CTATGTCTCTGCATGTGTGATGG - Intergenic
972019790 4:34297633-34297655 TTGTGTATGTGTATGTGTGTGGG + Intergenic
972099977 4:35403043-35403065 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
972291797 4:37696591-37696613 GTGTGTGTATGCATGTGCCTCGG - Intergenic
972343076 4:38169599-38169621 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
972671279 4:41215492-41215514 CTGTGTGTGTGTGTGTGTATGGG - Intronic
972799126 4:42454662-42454684 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973273231 4:48282169-48282191 GTGTGTCTGTGCATGTGAGATGG - Intergenic
974164484 4:58184126-58184148 CTGTGTCTTTGTATGTGTGTGGG + Intergenic
974702188 4:65466104-65466126 TTGTATGTGTGCATGTGTGTGGG + Intronic
974913698 4:68153601-68153623 GTGTGTGTGTCCATGTGTATGGG + Intergenic
974946391 4:68534330-68534352 GTGTGTCTTTGCATGTGACATGG + Intergenic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
975665618 4:76732248-76732270 GTATGTGTGTGCATGTGTGTTGG + Intronic
975870232 4:78772050-78772072 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
975986351 4:80203745-80203767 GTGTGTCTGTGTGTGTGTGTGGG - Exonic
976073657 4:81272227-81272249 GTGTGTGTGTGCCTGTGTGTAGG - Intergenic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
977164562 4:93679031-93679053 GTGTGTCTCTGCATGTGTGATGG - Intronic
977286541 4:95114641-95114663 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
977478184 4:97539296-97539318 CTGTGTCTCTGCATGTGAGATGG - Intronic
977561106 4:98534919-98534941 GTGTGTCTTTGCATGTGAGTTGG + Intronic
978012958 4:103709760-103709782 GTGTGTCTCTGCATGTGACATGG - Intronic
978828107 4:113048913-113048935 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
979070759 4:116203691-116203713 GTGTGTGTGTGTATGTGTTTAGG - Intergenic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979279258 4:118846911-118846933 CTGTGTGTGTCCGTGTGTGTGGG - Intergenic
980151432 4:129053642-129053664 GTGTGTCTTTGCATGTGAGTGGG + Intronic
980737784 4:136913416-136913438 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
980964612 4:139509060-139509082 CTGGCTCTGTGCATGTCTTTGGG - Exonic
981222092 4:142248664-142248686 GTGTGTATGTGTATGTGTTTAGG + Intronic
981362455 4:143863169-143863191 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
981373182 4:143983931-143983953 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
981382281 4:144087207-144087229 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
981877164 4:149560561-149560583 CTGTTTGTTTGCATGTGTTTTGG - Intergenic
981881677 4:149620481-149620503 CAGTGTCTGTAAATATGTCTGGG - Intergenic
981999869 4:151012569-151012591 TTGTGTGTGCGCATGTGTGTGGG - Intronic
982840079 4:160173456-160173478 GTGTGTTTGTGTATGTGTGTTGG + Intergenic
983166501 4:164483666-164483688 GTGTGTGTGTGTCTGTGTCTGGG - Intergenic
983224304 4:165071883-165071905 TTGTGTGTGTGCATGGGGCTGGG + Intergenic
983336334 4:166398165-166398187 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
983447373 4:167870691-167870713 GAGTGTCTGTGCACCTGTCTGGG - Intergenic
983739983 4:171118120-171118142 CTCTGTCTCTGCCTCTGTCTAGG + Intergenic
983925083 4:173391901-173391923 CTGTGTGTGTGTGTGTGTCAAGG - Intronic
984008837 4:174346491-174346513 GTGTGTCTTTGCATGTGGCATGG + Intergenic
984468829 4:180138754-180138776 CTGTGACTGTGTGTGTGTGTGGG + Intergenic
984548839 4:181137036-181137058 ATATGTCTGTGCATGTGACCTGG - Intergenic
984758373 4:183343854-183343876 CTGTGTCTGTGCCTCTCTCCAGG + Intergenic
985066675 4:186128884-186128906 GTGTGTATGTGTGTGTGTCTGGG + Intronic
985190038 4:187363011-187363033 CTGTGTGTGTGTGTGTGCCTGGG - Intergenic
985434055 4:189911663-189911685 CTGTATCGGGGCATGTGGCTTGG - Intergenic
985624705 5:979159-979181 GTGTGTGTGTGCATGGGTGTGGG - Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985833784 5:2256074-2256096 CTCTGTATGTGCATGTGTGTGGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
986034405 5:3924337-3924359 CTGAGTGTGTTCATGTGTGTGGG + Intergenic
986153648 5:5151714-5151736 GTGTGTGTGTGTATGTGTGTGGG + Intronic
986178898 5:5375613-5375635 GTGTGTCTGTGTGTGTGTATTGG + Intergenic
986359361 5:6961093-6961115 GTGTGTTTGTGCATGCGTTTGGG - Intergenic
986388199 5:7259645-7259667 TTGTGTCTTTTCATGGGTCTTGG - Intergenic
986394251 5:7313251-7313273 CAGTGTCTGTGCATGTAGCCTGG + Intergenic
986649762 5:9951437-9951459 TTGTGACTGGGCATGTGTTTTGG - Intergenic
986799073 5:11241035-11241057 TGGTGTGTGTGCATGTGTGTTGG - Intronic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
986834251 5:11617073-11617095 CTGTGGCTATGCATGTGCCAAGG + Intronic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
987468635 5:18303298-18303320 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
987475083 5:18381660-18381682 TTGTGTTTGTGTGTGTGTCTTGG + Intergenic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988712200 5:33789746-33789768 CTGTGTTTGTTCATTTGTCAGGG - Intronic
988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG + Intronic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989078415 5:37589239-37589261 GTGTGTGTGTGTATGTGTGTAGG - Intronic
989268192 5:39501995-39502017 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
989289772 5:39749573-39749595 GTGTGTCAGTGCTTGTCTCTTGG - Intergenic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
989493158 5:42080399-42080421 GTGTGTCTGTGCACGTGAGTTGG - Intergenic
989682247 5:44043170-44043192 GTGTGTCTGTGCATGTGAGATGG - Intergenic
989693051 5:44168906-44168928 TTGTGTCAGTGCATGTGACATGG + Intergenic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
990332779 5:54744094-54744116 CAGTGTTTGTGCATCTCTCTGGG + Intergenic
990336713 5:54780391-54780413 GTGTGTCTGTGAGGGTGTCTTGG + Intergenic
990615030 5:57499015-57499037 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
990687437 5:58321786-58321808 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
990819534 5:59822063-59822085 ATTTGTGTGTGCATGTGTTTTGG + Intronic
990957325 5:61356094-61356116 GTGTGTCTGTGTGTGTGTTTCGG + Intronic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991503404 5:67300247-67300269 CTGTTTCTTTGCATTTGTTTTGG + Intergenic
991513691 5:67410280-67410302 ACGTGTGTGTGCATGTGTATTGG + Intergenic
991536946 5:67679682-67679704 ATGCGTGTGTGCATGTGTGTGGG - Intergenic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
992303833 5:75413664-75413686 CTGTGTGTGTGTGTGTGTATAGG - Intronic
992413126 5:76526938-76526960 GTGTGTCTGTGCATGATGCTGGG + Intronic
993305605 5:86271687-86271709 GTGTGTCTGTGTGTGTGTCCAGG + Intergenic
993443814 5:87988210-87988232 GTGTGTCTGTGAAGGTGTTTGGG + Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
994228473 5:97283672-97283694 CTTTGCCTGTTCCTGTGTCTAGG + Intergenic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
994291981 5:98037965-98037987 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
994744078 5:103657290-103657312 ATGTGGCTGTTCATGTGTGTTGG - Intergenic
995204664 5:109465948-109465970 GTGTGTCTGTGTGTGTGTCTTGG + Intergenic
995232257 5:109780538-109780560 GTGTGTGTGTGTATGTGTGTAGG + Intronic
995448638 5:112275564-112275586 CTGTGTGTGTGTATGTGTCGAGG - Intronic
995641797 5:114265698-114265720 TTGTGTCTGTGCGGGTGACTTGG - Intergenic
995737852 5:115321770-115321792 CTGTGACTGGGTATGTGTGTTGG + Intergenic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
996004952 5:118408302-118408324 CTGTGTGTGTGTGTGTGTATGGG + Intergenic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996904450 5:128582267-128582289 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
996916108 5:128713963-128713985 GTGTGTGTGTGCATGAGTGTTGG - Intronic
997004387 5:129801609-129801631 CTGTGTCTTTGCATGTGAGATGG + Intergenic
997074774 5:130660377-130660399 ATGTGTTTATGCATTTGTCTAGG + Intergenic
997085836 5:130797454-130797476 GTGTGTATGTGTATGTGTATTGG - Intergenic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997328330 5:133040761-133040783 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
997628841 5:135350952-135350974 ATGTGCCTGTGCGTGGGTCTCGG - Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998085326 5:139317079-139317101 CTGCCTTTCTGCATGTGTCTAGG - Exonic
998133239 5:139661547-139661569 CTGTGTATGTGCATTCGCCTAGG - Intronic
998181797 5:139951271-139951293 CAGTGTTTGTGTGTGTGTCTTGG + Intronic
998365537 5:141628378-141628400 ATGTGTATGTGCATTTTTCTGGG - Intronic
998682022 5:144478915-144478937 ATGTGTATGTGTATGTGTATGGG + Exonic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999268265 5:150280960-150280982 CTGTGTCTGTGCATTGTTCTGGG + Intronic
999379847 5:151112923-151112945 CTATGTCTGTGAATTTGACTGGG - Intronic
1000021322 5:157321726-157321748 CTGTGTCTGTGCTGGGGGCTGGG + Intronic
1000039849 5:157477494-157477516 CTGTGCGTTTGTATGTGTCTGGG - Exonic
1000716188 5:164647355-164647377 ATATGTGTGTGCATGTGTGTAGG + Intergenic
1000799232 5:165703862-165703884 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1001219516 5:169888187-169888209 ATGTGTCTGTGCAAGGGTCATGG - Intronic
1001238122 5:170046753-170046775 GTGTGTATGTGTGTGTGTCTTGG - Intronic
1001293896 5:170485484-170485506 ATGTGTCTGTGTGTGAGTCTAGG - Intronic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001709429 5:173766370-173766392 CTGTGCCTGTGAGTGTGTGTTGG + Intergenic
1001745860 5:174091669-174091691 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1001953319 5:175831100-175831122 CTGTGTGTGTGTGTGTGTCTCGG + Intronic
1002090177 5:176800232-176800254 CTGTGTGTGTGTGTGTGCCTGGG + Intergenic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1002100986 5:176857489-176857511 GTGTGTGTGTGCGTGTGTGTAGG - Intronic
1002132486 5:177090138-177090160 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1002175375 5:177398443-177398465 CGGTGTGTGTGCATGTGTGGGGG + Exonic
1002376668 5:178794074-178794096 GTGTGTGTGTGCATATGTATGGG - Intergenic
1002466065 5:179409361-179409383 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1002971408 6:2025483-2025505 GTGCGTGTGTGCATGTGTATTGG - Intronic
1003141508 6:3475293-3475315 CTGATTATGTGCATTTGTCTGGG + Intergenic
1003332547 6:5142005-5142027 CTGTTTCTGTGCATGTGTCGGGG + Intronic
1003335428 6:5167355-5167377 CTGTTTCTGTGTATTTGTGTAGG - Intronic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004097847 6:12577108-12577130 ATGTGTTTGTGTATGTGTATGGG + Intergenic
1004118757 6:12798035-12798057 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
1004127043 6:12883903-12883925 GTGTGTGTGTGCATGTGAGTGGG - Intronic
1004314554 6:14574567-14574589 CTGGGTCTGTGCTTGTGACGAGG - Intergenic
1004395920 6:15246252-15246274 GTGTGTGTGTGTATGTGTTTCGG + Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1004883061 6:20027734-20027756 GTGTGTGTGTGTATGTGTATAGG - Intergenic
1004884118 6:20035671-20035693 CTGAGTCTGTGGATGTGGCAAGG - Intergenic
1005706753 6:28462583-28462605 CTGTGTGTGTGTGTGTGTGTGGG - Intergenic
1006174003 6:32110836-32110858 CCGTGTGTGTCCGTGTGTCTGGG + Intronic
1006263019 6:32893105-32893127 TTGCGTGTGTGCATGTGTATCGG - Intergenic
1007208146 6:40169549-40169571 TTGTCTCTGGGCATGTGCCTAGG + Intergenic
1007242470 6:40437000-40437022 GTGTGTGTGTGTATGTGTATGGG + Intronic
1007421743 6:41723836-41723858 CTGTGTCTCTCCATCTGCCTAGG - Intronic
1007696704 6:43738614-43738636 GTGTGCCTGTGCGTGTGTGTGGG + Intergenic
1007811588 6:44490132-44490154 CTGTGTGTGTCTATGTGTATAGG - Intergenic
1008039103 6:46777052-46777074 GTGTTTCTGTGCAGGTGTTTTGG - Intergenic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008754295 6:54775879-54775901 GTGTATGTGTGCATGTGTGTTGG - Intergenic
1009663871 6:66651101-66651123 CTGTGTCATTTTATGTGTCTGGG + Intergenic
1010007658 6:71012892-71012914 TCTGGTCTGTGCATGTGTCTTGG - Intergenic
1010145791 6:72668463-72668485 CTGTGTGTGTGTGTGTGTTTTGG + Intronic
1010430825 6:75776672-75776694 GTGTGTGTGTGTATGTGTTTTGG + Intronic
1010899922 6:81414408-81414430 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1011156780 6:84341834-84341856 GTGTGTGTGTGTATGTGTCCTGG + Intergenic
1011186412 6:84681495-84681517 CTTTCTGTGTGCCTGTGTCTCGG + Intergenic
1011499096 6:87968147-87968169 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
1011592722 6:88985987-88986009 CTGTGTGTGTGTGTGTGTTTGGG + Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012058450 6:94446080-94446102 CTGTGTCAGTTGATGTTTCTGGG - Intergenic
1012269576 6:97192123-97192145 GTGTGTCTGTGCATATGTGGAGG + Intronic
1012340312 6:98113478-98113500 GTGTGTGTGTGCGTGTGTGTGGG - Intergenic
1012423987 6:99094457-99094479 CTTTGTCTGGGCATCTGTCAGGG - Intergenic
1012488526 6:99750436-99750458 CTGTTTGTGTGTATGTGTGTTGG + Intergenic
1012571508 6:100735662-100735684 TTGTGTCTGTGCCTTTTTCTAGG - Intronic
1013294915 6:108750442-108750464 ATGTGTGTGTGCACGTGTGTTGG + Intergenic
1013350584 6:109302198-109302220 CTGGCTATGTGCATGTTTCTAGG + Intergenic
1013789819 6:113824172-113824194 TTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014032710 6:116724489-116724511 GTGTGTCTGTATCTGTGTCTTGG + Intronic
1014107725 6:117585758-117585780 CTGTCTTTGTGCATGTGTATGGG - Intronic
1014219403 6:118785199-118785221 GTGTGTGTGTGCGTGTGTGTTGG + Intergenic
1014322253 6:119944598-119944620 GTGTGTGTGTGTATGTGTATAGG - Intergenic
1014357891 6:120434812-120434834 GTGTGTCTCTGCATGTGACATGG - Intergenic
1014568629 6:122981678-122981700 CTGTGTGTGTGCACGTGTGCAGG - Intergenic
1014643552 6:123944952-123944974 GTCTGTGTGTGCATGTGTGTTGG - Intronic
1014689259 6:124542483-124542505 CTGTTTCTGCCTATGTGTCTTGG - Intronic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1015823747 6:137290605-137290627 GTGTGTCTGTGTATGTGTAAGGG + Intergenic
1016642144 6:146361342-146361364 CTTTGGCTGTACTTGTGTCTTGG - Intronic
1016772314 6:147865240-147865262 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1016928080 6:149373624-149373646 CTGTGTCTGTGCAGGAGTTTGGG + Intronic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017277433 6:152585910-152585932 GTGTATGTGTGCATGTGTTTGGG + Intronic
1017665960 6:156720308-156720330 GTGTCTGTGTGCATGTGTGTGGG - Intergenic
1017738841 6:157386832-157386854 CTGTATGTGTGCATATGTCAGGG - Intronic
1017744856 6:157437033-157437055 CTGTGACTGTGCATGTGACATGG + Intronic
1017961312 6:159223579-159223601 CTCAGTCTGTGCTTGTGTCCTGG + Exonic
1018424208 6:163665291-163665313 GTGTGTCTGTGTGTGTCTCTGGG - Intergenic
1018614943 6:165678237-165678259 GTGTATCTGTGAATGTGTATCGG + Intronic
1018788180 6:167125085-167125107 GTGTGTGTATGTATGTGTCTAGG - Intronic
1018941552 6:168311499-168311521 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019137369 6:169918756-169918778 ATGTGTGTGTGCGTGTGTGTAGG + Intergenic
1019168884 6:170117503-170117525 CTGTGTCTGTGGCTGTTTCTAGG - Intergenic
1019284500 7:216792-216814 CTGCCTCTGTTCATGTGTCTTGG - Intronic
1020017129 7:4837660-4837682 GTGTGTGGGTGCATGTGTGTTGG - Intronic
1020082664 7:5295203-5295225 ATGTCTCTGAGCATGTGGCTGGG + Intronic
1020159037 7:5754154-5754176 GTGTGTGTGCGCATTTGTCTGGG + Intronic
1020547847 7:9556069-9556091 CTTGGTTTGTGCATGTGACTGGG + Intergenic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021577149 7:22115180-22115202 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1021896405 7:25240085-25240107 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1022045171 7:26617019-26617041 GTGTGTGTGTGCGTGTGTGTAGG + Intergenic
1022096798 7:27146257-27146279 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1022350038 7:29559704-29559726 TTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1022555300 7:31288457-31288479 GTGTGTCTGTGTGTGTGTGTAGG + Intergenic
1022629833 7:32074856-32074878 GTGTGTCTGTGAATGTGACACGG + Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023217173 7:37875397-37875419 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1023244714 7:38189123-38189145 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1023454968 7:40328765-40328787 GTGTGTATGTGTATGTGTTTTGG + Intronic
1023648586 7:42344762-42344784 CTGGGTCAGTGCATGAGGCTGGG + Intergenic
1023743699 7:43302928-43302950 ATGTGTGTGTGCACGTGTGTGGG - Intronic
1023810700 7:43909193-43909215 GTGTGTTTGTGTATGTGTGTAGG - Intronic
1024131291 7:46355126-46355148 GTGTATGTGTGCATGTGTGTAGG - Intergenic
1024193662 7:47037701-47037723 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1024866702 7:53911548-53911570 GTGTGTGTGTGCATGTGGATGGG - Intergenic
1024866711 7:53911588-53911610 TTGTGTGTGTGCGTGTGTCGGGG - Intergenic
1024970781 7:55068112-55068134 GTGTGTGTGTGCATGTGTGGTGG + Intronic
1025026491 7:55520646-55520668 GTGTGTCTGTGCGTATGTGTAGG - Intronic
1026122901 7:67552932-67552954 CTGGGTCTGACCATGTGACTAGG + Intergenic
1026260459 7:68750695-68750717 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026975648 7:74496288-74496310 ATGTGGGTGTGCATGTGTGTGGG + Intronic
1026975683 7:74496568-74496590 GTGTGGGTGTGCATGTGTGTGGG + Intronic
1027385146 7:77652608-77652630 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1027537241 7:79418820-79418842 GTGTGTGTGTGTATGTGTATTGG - Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1027790069 7:82628358-82628380 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1028224179 7:88230921-88230943 CTGTGTGCGTGCATGTGTGTGGG - Intergenic
1028237297 7:88377991-88378013 GTGTGTCTGTGTATGTGTTTGGG - Intergenic
1028318161 7:89430143-89430165 CTGTGTGTGTGCGTATGTTTTGG - Intergenic
1028530919 7:91837749-91837771 GTGTGTCTGTCCACGTGTTTTGG - Intronic
1028933848 7:96443697-96443719 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
1028969705 7:96844886-96844908 GTGTGTCTGTGTGTGTGTATGGG - Intergenic
1029147355 7:98455983-98456005 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1029550927 7:101236738-101236760 CGGTGTGTGTGCAGGTGTGTGGG - Intronic
1029842500 7:103380998-103381020 GTGTGTGTATGCATGTGTGTGGG - Intronic
1030167173 7:106566930-106566952 CTGTGTGTGTACATCTGTATGGG - Intergenic
1030279167 7:107752460-107752482 GTGTGTCTGTGTCTGTGTATAGG + Intronic
1030371648 7:108706804-108706826 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1030399950 7:109036677-109036699 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1030401189 7:109052477-109052499 CTGTGTGTGTGCATGTGGTATGG + Intergenic
1031814741 7:126419905-126419927 CTGTGTGTGTCTATGTGTGTGGG - Intergenic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1032086684 7:128887378-128887400 CTGTGGCTGTGTATGTGTGGAGG - Intronic
1032202724 7:129834111-129834133 ATGTGACTCTGCATGTGTTTTGG + Exonic
1032479413 7:132234618-132234640 GTGTGTGTGTGTATGTGTATTGG + Intronic
1032883830 7:136116678-136116700 CTGTGCCTCTCCATTTGTCTAGG + Intergenic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033820088 7:145124866-145124888 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
1033824152 7:145169138-145169160 CTGTGAGTGTGCATGAGTATCGG - Intergenic
1034032538 7:147784097-147784119 CTCTCTTTGTGCATGTCTCTGGG + Intronic
1034480072 7:151313016-151313038 GAGTGTCAGTGCATGTGTGTGGG + Intergenic
1034480142 7:151313594-151313616 TAGTGTGTGTGCATGTGTATGGG + Intergenic
1034480152 7:151313671-151313693 GTGTGTGAGTGCATGTGTATGGG + Intergenic
1034520897 7:151618808-151618830 TTGTTTCTGTTCATGTTTCTAGG - Intronic
1034556589 7:151854284-151854306 TCGTGTGTGTGCATGTGTGTGGG - Intronic
1034612461 7:152384046-152384068 GTGTGTGTGTGCGTGTGTGTAGG + Intronic
1034858246 7:154574188-154574210 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1034889421 7:154827195-154827217 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1034897068 7:154883026-154883048 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897087 7:154883409-154883431 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897114 7:154884067-154884089 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897116 7:154884097-154884119 ATGTGTGTGAGCATGTGTATGGG - Intronic
1034897118 7:154884125-154884147 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034906427 7:154951387-154951409 CGGTGTGTGTGCATGGGTATGGG + Intronic
1035048701 7:155985631-155985653 CTGTGTGTGTGTGTGTGTGTGGG + Intergenic
1035106460 7:156445472-156445494 CTGTGTCTCTGTCTGTGTCATGG + Intergenic
1035112911 7:156498208-156498230 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1035112919 7:156498468-156498490 CTATCTGTGTGCGTGTGTCTGGG - Intergenic
1035272712 7:157729895-157729917 GTGTGTCTGTGAGTGTGACTCGG + Intronic
1035288307 7:157820448-157820470 GTGTTTGTGTGCATGTGTGTGGG - Intronic
1035288320 7:157820629-157820651 ATGTGTGTGTGCACGTGTGTAGG - Intronic
1035319792 7:158021469-158021491 CTGTGTGTGTGCGTGTGCGTGGG - Intronic
1035360707 7:158311820-158311842 AGGTGTGTGTGCATGTGTGTGGG - Intronic
1035360719 7:158311986-158312008 AGGTGTGTGTGCATGTGTGTGGG - Intronic
1035360727 7:158312227-158312249 AGGTGTGTGTGCATGTGTGTGGG - Intronic
1035360740 7:158312507-158312529 AGGTGTCTGTGCGTGTGTGTGGG - Intronic
1035368822 7:158365646-158365668 CTGTGTGTGTGCGTGTGCATTGG - Intronic
1035651545 8:1269488-1269510 CTTTGTCTGTTTATGTGACTGGG + Intergenic
1035776613 8:2192077-2192099 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1035877378 8:3206226-3206248 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1035907070 8:3524739-3524761 ATGTGTGTGTGCACATGTCTCGG - Intronic
1036157512 8:6356492-6356514 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1036609056 8:10334198-10334220 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1036664042 8:10727329-10727351 GTGTGTGCATGCATGTGTCTGGG - Intronic
1036686423 8:10914603-10914625 CTGTCTCCTTGCATGTTTCTGGG + Intronic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037422005 8:18712536-18712558 GTGTATGTGTGTATGTGTCTAGG - Intronic
1037700103 8:21265924-21265946 CTGTGTCTATGTGTGTGCCTGGG - Intergenic
1037716669 8:21406853-21406875 GTGTGTATATGCATGTGTGTGGG + Intergenic
1038023091 8:23566483-23566505 GTGTGTGCGTGCGTGTGTCTGGG - Intronic
1038126358 8:24677550-24677572 CTGTGTATGTGTTTGTGTGTTGG - Intergenic
1038316114 8:26485692-26485714 CTGGGTGTGTGGATGTTTCTAGG + Intronic
1038764439 8:30414301-30414323 CTGTATCTGTGGATGTTTATAGG + Intronic
1039145407 8:34440776-34440798 GTGTGTCTTTGCATGTTTGTTGG - Intergenic
1039427016 8:37494558-37494580 CTGTGTGTGTGCGTGTGTTAGGG + Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039442396 8:37604278-37604300 ATGTGCGTGTGCATGTGTGTGGG - Intergenic
1039736116 8:40334890-40334912 GTGTGTGTGTGCATATGTATGGG + Intergenic
1040465134 8:47688035-47688057 GTGTGTGTGTGCATGCGTATAGG + Intronic
1040582712 8:48710296-48710318 GTGTGTCTGTGTGTGTGTGTGGG + Intergenic
1041106584 8:54450086-54450108 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1041195472 8:55397625-55397647 ATGTGTGTGTGCATGTGTGGTGG - Intronic
1041430839 8:57778874-57778896 TTGTGCATGTGCATGTGTTTTGG - Intergenic
1041551837 8:59111587-59111609 ATGGGTATGTGCATGTGTATGGG - Intronic
1042099036 8:65254013-65254035 GTGTATGTGTGCATGTGTGTTGG + Intergenic
1042504815 8:69548921-69548943 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1042882777 8:73512641-73512663 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1043004248 8:74798304-74798326 GTGTGTCTGTGTGTGTGTGTGGG + Intronic
1043161660 8:76854252-76854274 CTGTGGCTGTGGCTGTGGCTGGG - Exonic
1043486771 8:80705553-80705575 GTGTGTCTGTGTGTGTGTTTCGG + Intronic
1043696683 8:83228226-83228248 TTGTGTGTGTCCATGTGTGTGGG + Intergenic
1044069068 8:87733541-87733563 GTGTGTGTGTGCATGTGTGCAGG - Intergenic
1044893447 8:96862304-96862326 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1044922790 8:97183444-97183466 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1045281119 8:100750516-100750538 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1045581332 8:103483507-103483529 CTGTTTCTTTGCAGGTATCTTGG - Intergenic
1045658599 8:104412422-104412444 ATGTCTATGTGCGTGTGTCTTGG + Intronic
1045839651 8:106564400-106564422 GTGTGTGTGTGTATGTGTCCAGG - Intronic
1046157808 8:110316429-110316451 TTGTGTGTGTGCATGTGGATGGG + Intergenic
1046167851 8:110462017-110462039 CTGTGTGTATGTATGTGTTTGGG + Intergenic
1046200607 8:110922965-110922987 CTGTGTGTGTGTTTGTGTGTAGG - Intergenic
1046372517 8:113328062-113328084 GTGTGTCTGTGTGTGTGTTTGGG - Intronic
1046505164 8:115127549-115127571 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
1046710729 8:117508655-117508677 CTATGTCCTTGCATTTGTCTTGG + Intergenic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1046792181 8:118333975-118333997 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
1047257775 8:123228640-123228662 CTGTGTGTGTGTGTGTGTTTTGG - Intronic
1047544957 8:125806848-125806870 CTCTGTGTGTGCATGTTTGTGGG + Intergenic
1047667007 8:127102827-127102849 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1047705639 8:127496854-127496876 TTGTGTGTGTGCCTGTGTATGGG + Intergenic
1047930828 8:129726989-129727011 GTGTGTGTGTGTATGTGTATTGG - Intergenic
1048216017 8:132495700-132495722 CTGCGTGTGTGCGTGTGTGTTGG + Intergenic
1048307924 8:133296684-133296706 GTGTGTGTGTGTCTGTGTCTGGG - Intronic
1048378166 8:133840785-133840807 CTGTCTCTGTGCAGGTTTCCTGG + Intergenic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1048522454 8:135169435-135169457 ATGTGTGTGTGTGTGTGTCTTGG + Intergenic
1048696931 8:137038854-137038876 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1048971622 8:139648209-139648231 CTGTCTCTGTGGATTTGCCTAGG - Intronic
1049031001 8:140037689-140037711 GTGTGTCTGTGTACGTGTGTGGG - Intronic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049245774 8:141561562-141561584 CTGCATCTGTGCATGTATCTGGG - Intergenic
1049245785 8:141561696-141561718 CTGCATCTGTGCATGTATCTGGG - Intergenic
1049298056 8:141854395-141854417 CTCTGTGTGTGCATATGTGTGGG - Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1049335469 8:142082256-142082278 GTGTGTCTGGGTGTGTGTCTGGG - Intergenic
1049420998 8:142516614-142516636 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1050481269 9:6089535-6089557 CTGTGTATGTGCATAGGCCTGGG + Intergenic
1050504571 9:6334360-6334382 CTCTGTCAGTGCATTTTTCTTGG - Intergenic
1050755822 9:9001973-9001995 CTGTGTGTGTGTGTGTGTTTGGG + Intronic
1051702144 9:19835329-19835351 GTGTGTCTCTGCATGTGTGATGG - Intergenic
1052235744 9:26211953-26211975 ATGTGTCTGTGTATGTGTGTTGG + Intergenic
1052555180 9:30003968-30003990 TTGTGTGTGTGCGTGTGTGTGGG + Intergenic
1052602621 9:30655354-30655376 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1052998591 9:34564996-34565018 CTATGCCTGTGCAAGTGTGTGGG + Intronic
1053373332 9:37581298-37581320 TTGTGACTGTGCAGGTGTCGGGG - Intronic
1053397754 9:37789778-37789800 GTGTGTGTGTGCCTGTGTCATGG + Intronic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1053671993 9:40375670-40375692 CTGTGTGTGTGTGTGTGTGTGGG + Intergenic
1053714810 9:40876020-40876042 GTGTGTCTCTGCATGTGAGTTGG - Intergenic
1053723136 9:40969825-40969847 CTGTATCAGGGCATGTGGCTTGG - Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054342830 9:63882167-63882189 CTGTATCAGGGCATGTGGCTTGG + Intergenic
1054456279 9:65432057-65432079 GTGTCTGTGTGCATGTGTGTGGG - Intergenic
1054512630 9:66000640-66000662 CTGTGTGTGTGTGTGTGTGTGGG - Intergenic
1055253090 9:74332184-74332206 GTGTGTGTGTGCATATGTATAGG + Intergenic
1055289900 9:74771408-74771430 GTGTGTGTGCGCATGTGTGTAGG - Intronic
1055488099 9:76776883-76776905 GTGTGTGTGTGTATGTGTTTTGG - Intronic
1055555230 9:77467021-77467043 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1055580287 9:77701480-77701502 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1055773713 9:79745042-79745064 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
1055828686 9:80356732-80356754 CTGTGTGTTTGTATGTGTGTTGG - Intergenic
1055916572 9:81408196-81408218 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1056070256 9:82978973-82978995 GTGTGTCTGTGTGTGTGTGTTGG + Intergenic
1056456438 9:86765565-86765587 CTGAGTGTGTGGATGTGTCTGGG + Intergenic
1056535964 9:87528052-87528074 CAGTGTCAGTGCAAGTGGCTTGG - Intronic
1056687324 9:88777392-88777414 GTGTGTGTGTGCATGTGTACGGG + Intergenic
1056731822 9:89172506-89172528 CTGTGTCTGTGTGTGTGTGATGG - Intronic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778980 9:89535249-89535271 CTGTGTGTGTGTATGTGTATAGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1057140223 9:92722283-92722305 CTGTGTCTCTGCCTGTGACAGGG - Intronic
1057210149 9:93196688-93196710 CTGTAACTGTGCTTGTATCTGGG + Intronic
1057579128 9:96270237-96270259 GTGTGTGTGTGTATGTGTTTGGG - Intronic
1057586122 9:96330304-96330326 CTGTGTGTGTGTATATGTGTGGG - Intronic
1057682972 9:97207393-97207415 GTGTGTCTCTGCATGTGACATGG - Intergenic
1058609819 9:106763342-106763364 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
1058838337 9:108879880-108879902 CTGTGTCTGTGTTTGTGTGTTGG - Intronic
1059509782 9:114834321-114834343 ATGTGTCTTTGCATGTGAGTTGG + Intergenic
1059553759 9:115257233-115257255 GTGTGTCTGTGCATGTTTGTGGG - Intronic
1059626033 9:116067160-116067182 GTGTGTCTGTGCATGTTGATGGG - Intergenic
1059911443 9:119048737-119048759 GTGTGTCTGTGTGTGTGTCGGGG - Intergenic
1060038017 9:120275052-120275074 GTGTGTCTTTGCATGTGAGTTGG + Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060227849 9:121806740-121806762 ATGTGTGTGTGCTTGTGTGTGGG + Intergenic
1060227869 9:121807006-121807028 TTGTGTGTGTGCTTGTGTGTGGG + Intergenic
1060319006 9:122538023-122538045 CTCTTACTGTGCATGTGTCGGGG + Intergenic
1060346506 9:122821409-122821431 CTGTGTGTGTGTGTGTGTTTGGG - Intronic
1060470147 9:123941911-123941933 CTGTGTGTGTGTGTGTGTGTGGG - Intergenic
1060492964 9:124098414-124098436 GTGTGTTTGAGCACGTGTCTGGG + Intergenic
1060613284 9:124988060-124988082 GTATGTGTGTGCATGTGTGTAGG - Intronic
1060892042 9:127195183-127195205 CTGTGGCTCTTCCTGTGTCTGGG - Exonic
1061005187 9:127924901-127924923 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061295259 9:129673613-129673635 CTGTGTGTGTCTTTGTGTCTGGG - Intronic
1061453093 9:130679168-130679190 CTGTGCCTGTGTGTGTGTCAGGG + Intronic
1061821577 9:133230269-133230291 ATGTATGTGTGCATGTGTATGGG - Intergenic
1062025755 9:134339455-134339477 CTGTGTGTGAGCCTGTGTGTGGG + Intronic
1062237674 9:135519791-135519813 ATGTGGGTGTGCATGTGTATGGG + Intergenic
1062298462 9:135848500-135848522 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1062637486 9:137499213-137499235 CTGTGTGTCTGTGTGTGTCTCGG - Intronic
1203451998 Un_GL000219v1:126153-126175 CTGTATCAGGGCATGTGGCTTGG + Intergenic
1203707885 Un_KI270742v1:69093-69115 TTGTCTCTGGGCCTGTGTCTTGG - Intergenic
1203611112 Un_KI270749v1:5420-5442 GTGTGTGTGTGCATTGGTCTAGG + Intergenic
1185527361 X:790255-790277 GTGTGTCTGTGTGTGTGTGTGGG + Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1185754145 X:2639905-2639927 ATGTGTTTGTGTATGTGTGTAGG - Intergenic
1185764376 X:2713372-2713394 TTGTGTATGTGCATATGTGTAGG - Intronic
1185863857 X:3605008-3605030 GTGTGTGTGTGTGTGTGTCTTGG - Exonic
1185921545 X:4098562-4098584 CTGTGTGTGTGTGTGTGTTTTGG + Intergenic
1186037560 X:5441277-5441299 CGGAGGCTGTGCATGTGTGTGGG + Intergenic
1186082888 X:5952486-5952508 CTGTGGCTGTGAATAGGTCTCGG + Intronic
1186084483 X:5972191-5972213 GTTTGTGTGTGCATGTGTGTGGG + Intronic
1186285021 X:8033885-8033907 CTGTGTCTGTGTGTGGGTGTGGG - Intergenic
1186285023 X:8033891-8033913 GTGTGTCTGTGTCTGTGTGTGGG - Intergenic
1188681140 X:33007034-33007056 CTGGGTGTGTGCGTGTGGCTAGG - Intronic
1189296897 X:39924979-39925001 GTGTGTGTGTGTATGTGTATGGG - Intergenic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1189589404 X:42495724-42495746 ATGTGTCTGTATGTGTGTCTGGG + Intergenic
1189631256 X:42956099-42956121 ATGTGTGTGTGTATGTGTCTTGG + Intergenic
1190254942 X:48755275-48755297 CTGTGTGTGTACATGTGGTTGGG - Intergenic
1190440704 X:50471697-50471719 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1190817058 X:53938312-53938334 CTGTGGCTGTGGCTGTGGCTGGG - Exonic
1191124622 X:56941786-56941808 GTGTGTCTGTGCATGTGAGATGG + Intergenic
1191180217 X:57554229-57554251 TTGTGTGTGTGTATGTGTGTGGG - Intergenic
1191782211 X:64880932-64880954 GTGTGTCTGTGCATGTGAGAAGG - Intergenic
1191828068 X:65387528-65387550 GTGTGTCTGTGCATGTGAGATGG + Intronic
1191957949 X:66666791-66666813 GTGTGTGTGTGCATGTGTAGGGG + Intergenic
1192298750 X:69878711-69878733 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1192664705 X:73077718-73077740 GTGTGTGTGTGTGTGTGTCTTGG - Exonic
1192763275 X:74118650-74118672 CTGTGGCTCTGCATTTTTCTGGG + Intergenic
1192826527 X:74702941-74702963 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1193443207 X:81567888-81567910 CTGTGTTTGAGCATGTTGCTTGG + Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1193734784 X:85144561-85144583 CAGTTTCTGTGCATGTTTATAGG + Intergenic
1193893219 X:87077908-87077930 CAGTTTCTATGCATGTTTCTTGG - Intergenic
1194880793 X:99249549-99249571 CTTTGTGTGTGCATGTGTTGTGG + Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195391211 X:104364528-104364550 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1195774591 X:108389616-108389638 GTGTGTCTTTGCATGTGTGATGG + Intronic
1195854752 X:109318799-109318821 GTGTGTCTGTGCATGTGAGGTGG + Intergenic
1195966386 X:110433606-110433628 ATGTGTTTGTGTATGTGTTTGGG - Intronic
1196172447 X:112604625-112604647 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1197629520 X:128842157-128842179 ATGTATGTGTGCATGTGTATGGG + Intergenic
1198080831 X:133237672-133237694 CTGTGTGTGTGTGTGTGTGTTGG - Intergenic
1198083731 X:133263658-133263680 GTGTGTGTGTGTATGTGTGTAGG - Intergenic
1198110869 X:133501699-133501721 CTGTGTCTGTGCTTGGAACTGGG + Intergenic
1198165119 X:134048054-134048076 GTGTGTCTCTGCATGTGAGTTGG + Intergenic
1198279373 X:135126722-135126744 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1198291584 X:135245792-135245814 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1198302590 X:135345856-135345878 CTGTATCTGCCCATGTGCCTTGG - Intronic
1198342001 X:135723773-135723795 CTGTGTGTGTGTGTGTGTGTTGG + Intergenic
1198345994 X:135759598-135759620 CTGTGTGTGTGTGTGTGTGTTGG - Intergenic
1198445163 X:136706138-136706160 ATGTGTCAGTGAATGTGTCAGGG + Intronic
1198799697 X:140436188-140436210 GTGTGTCTGTGTGTGTGTGTGGG - Intergenic
1199114040 X:143968985-143969007 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
1199548501 X:149032843-149032865 CTGTGTGTGTGTATATGTCTAGG + Intergenic
1199732575 X:150650944-150650966 CTGTTTCTGGGCCTTTGTCTAGG + Intronic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200490606 Y:3818344-3818366 CTGTGTCAGTGCATGTGAGATGG - Intergenic
1200785960 Y:7260609-7260631 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1201394539 Y:13534720-13534742 ATGTGTCTTTGCATGTGAGTTGG + Intergenic
1201450700 Y:14110417-14110439 GGGTGACTGTGCATGTGTCAGGG - Intergenic
1202361167 Y:24111799-24111821 CAGTGGCTGTGCATTTGTCATGG + Intergenic
1202509611 Y:25558319-25558341 CAGTGGCTGTGCATTTGTCATGG - Intergenic