ID: 1098529645

View in Genome Browser
Species Human (GRCh38)
Location 12:71527174-71527196
Sequence GAGTGAACACAATTTCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098529645_1098529648 21 Left 1098529645 12:71527174-71527196 CCTGCCAGAAATTGTGTTCACTC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1098529648 12:71527218-71527240 AAAGACTAATATTCAATGAATGG 0: 1
1: 0
2: 3
3: 42
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098529645 Original CRISPR GAGTGAACACAATTTCTGGC AGG (reversed) Intronic
900961125 1:5921142-5921164 GAATGAACACAAGTTCTGAAAGG - Intronic
905514551 1:38552606-38552628 GAGTCAACACCATTTGTTGCAGG + Intergenic
907022178 1:51078595-51078617 AAGTGAAAAAGATTTCTGGCCGG - Intergenic
916961914 1:169897033-169897055 GGGTGGTCACAAGTTCTGGCCGG + Intergenic
917222832 1:172749608-172749630 AAGGCAACACAATTTCTGCCTGG - Intergenic
917590428 1:176470536-176470558 GAGTCAGCCTAATTTCTGGCTGG - Intronic
919613435 1:199775605-199775627 GAGTGAACACAGTATCTGTCTGG - Intergenic
919796703 1:201325347-201325369 GAGGCAACACACTTCCTGGCTGG + Intronic
921669311 1:217908621-217908643 GAGTGGGCACATTTTCAGGCTGG - Intergenic
1063960035 10:11299416-11299438 GAGAGAACATCATTTCTGGGAGG - Intronic
1064502525 10:15989897-15989919 GAGTGAACACAAATTATGGTGGG + Intergenic
1068751015 10:60592461-60592483 GAGTTAATACAAATTTTGGCTGG + Intronic
1069051992 10:63804637-63804659 GAGTGAACAAAATATCTGACAGG - Intergenic
1073446284 10:103582429-103582451 GAATAATCACATTTTCTGGCCGG + Intronic
1074525014 10:114255453-114255475 GAGGGAAGAGAGTTTCTGGCCGG + Intronic
1077255212 11:1578575-1578597 CAGTGTACACATTTTCTGGAAGG + Intergenic
1078638727 11:13076180-13076202 GAGAGAAGAGAATTTCTGGATGG + Intergenic
1078868640 11:15323482-15323504 GAGTGAACCCAATCTCTGACAGG + Intergenic
1079338734 11:19594635-19594657 GAGTGACCACAGTAGCTGGCTGG + Intronic
1080041396 11:27763057-27763079 CAGTGAAGAAAATTTTTGGCCGG - Intergenic
1080338807 11:31232537-31232559 GAGTGAACAAGATTTCAAGCAGG - Intronic
1080674912 11:34416702-34416724 GAGAAAACAGACTTTCTGGCTGG - Intergenic
1087275997 11:96161028-96161050 CAGTGACCTCAATTTCTGCCAGG + Intronic
1088954782 11:114607477-114607499 GGGTGAACACCATTACCGGCTGG + Intergenic
1091681476 12:2530598-2530620 AACAGAACACAATCTCTGGCAGG + Intronic
1098529645 12:71527174-71527196 GAGTGAACACAATTTCTGGCAGG - Intronic
1100153686 12:91772227-91772249 GAGAGAACTCAAAGTCTGGCAGG - Intergenic
1105902655 13:24769521-24769543 GAGTGATAACAATTTCAGGAAGG - Intronic
1106489286 13:30202855-30202877 GAGTGGACACAGTGTCTCGCAGG - Exonic
1106869285 13:34001453-34001475 GAGTGGACACCATTACTGACAGG + Intergenic
1108966597 13:56313483-56313505 GAGTGAACACAAATTGAGGATGG + Intergenic
1109807618 13:67465085-67465107 GAGGGAACAAAATTTCAGACAGG - Intergenic
1111809531 13:93081684-93081706 GAGGAAACAAAATTTATGGCAGG - Intergenic
1112945137 13:104918959-104918981 GAGTGGACACCATGTCTGGGTGG - Intergenic
1113159103 13:107359100-107359122 GAATGAACAGAATTTCAGGGAGG - Intronic
1113196004 13:107806944-107806966 AAGTTAAAACAATTTTTGGCTGG + Intronic
1116475310 14:45332468-45332490 GAGTAAAAACAATTTCAGGCAGG + Intergenic
1117858145 14:60057494-60057516 GTGTGAATAGAATTTCTGGGAGG - Intronic
1119757494 14:77129280-77129302 GAGTGTACCCACTTTCTGGATGG + Intronic
1125409316 15:39388861-39388883 GGGTGAACGCAATCTCTGGAGGG + Intergenic
1125410033 15:39396406-39396428 GAGTGAATTCTATTTGTGGCAGG + Intergenic
1126829509 15:52586537-52586559 GAGTTAACTCAATTTCAAGCTGG + Intronic
1127188782 15:56507437-56507459 CAGTGCACACAATATCTAGCAGG + Intergenic
1127718404 15:61674366-61674388 GAGTGAATACACTGTCTGGTGGG - Intergenic
1129993642 15:79986165-79986187 AAGAGTACAGAATTTCTGGCCGG - Intergenic
1132665937 16:1081332-1081354 GAGTGGGCACAAATCCTGGCAGG + Intergenic
1133400653 16:5484196-5484218 GAGTTAACTGAAGTTCTGGCTGG - Intergenic
1133754424 16:8751819-8751841 GAGTGAACACTCTATATGGCTGG - Intronic
1134485332 16:14653621-14653643 CAGAAAACACAAATTCTGGCTGG - Intronic
1139570978 16:67812127-67812149 GAGTGAACACAAGATCTATCTGG + Intronic
1139721870 16:68862686-68862708 GAGTAAACTCACTTACTGGCTGG - Intronic
1140131787 16:72168385-72168407 CAGTGAACCTAATTTCTTGCTGG + Intronic
1141236252 16:82219990-82220012 GATGGAAAACAAATTCTGGCTGG + Intergenic
1143133608 17:4697012-4697034 GTGTGAAGAGAACTTCTGGCTGG + Intronic
1146155175 17:30517897-30517919 GAGTGAACACATTTTTGGCCAGG - Intronic
1147046705 17:37757669-37757691 GAGTTACAACACTTTCTGGCCGG - Intergenic
1147059160 17:37860402-37860424 GAAAGAACACAAATTCTGGGGGG + Intergenic
1148621855 17:49040539-49040561 GAGTGCACAGAATTTCTAGGAGG - Intronic
1153839377 18:8992222-8992244 AAGAAAATACAATTTCTGGCTGG - Intergenic
1157101652 18:44735766-44735788 GACTTAACACAAGTTCTGCCAGG + Intronic
1157993476 18:52526187-52526209 CAGGGAACAAAATTTCTGGCAGG + Intronic
1159900985 18:74045408-74045430 GGGTGAAGACAATTTCTTGTGGG + Intergenic
1160328757 18:77973656-77973678 GACTGAAAGCAATTTGTGGCAGG + Intergenic
1160896238 19:1403325-1403347 GAGAGAAAACAGCTTCTGGCCGG - Intergenic
1162028171 19:7905800-7905822 GAGTGATCACAATAACTGGATGG - Intronic
1168570653 19:57466282-57466304 GGTTGGACACAAGTTCTGGCTGG - Intronic
929881646 2:45842079-45842101 GAGAGAACACAGTTTCTGTAAGG + Intronic
934940133 2:98494959-98494981 GAGTGAACACACATTCTCTCTGG - Intronic
934996583 2:98967267-98967289 ATGTGCACACAATTGCTGGCGGG - Intergenic
944639411 2:201707779-201707801 TAGAGAACACACTTTCTCGCTGG + Intronic
946606847 2:221414552-221414574 GAGTAAACAGAATTTCAGGGAGG + Intergenic
947234696 2:227928149-227928171 GAGGAATCACAATTTATGGCAGG - Intergenic
948951651 2:241256243-241256265 CAGTGAAGACAATCTCTGTCCGG + Exonic
1172414548 20:34753772-34753794 AAGTTCACACTATTTCTGGCAGG - Intronic
949461121 3:4295662-4295684 GAGTGAAATTAATTTCTTGCTGG + Intronic
949646427 3:6100431-6100453 GAGTGAAAAGCATTTCAGGCAGG - Intergenic
953057082 3:39396626-39396648 AAGGCAACACAATTTCTGCCTGG - Exonic
953540273 3:43811929-43811951 GAGTCAACACAATTTCTGTAAGG - Intergenic
954164006 3:48741561-48741583 TAAAGATCACAATTTCTGGCTGG + Intergenic
957723295 3:84032094-84032116 CAGTGCACACAATCTCTAGCAGG + Intergenic
959223020 3:103545699-103545721 GAGTGAAGGCATTGTCTGGCGGG + Intergenic
959355053 3:105316024-105316046 GATTGAACACTACTGCTGGCAGG + Intergenic
965785089 3:172327156-172327178 GAGTGAACTCACTATGTGGCTGG - Intronic
969492629 4:7508896-7508918 GAGTGAGCAGAAGTTCTGGAGGG + Intronic
969573730 4:8024679-8024701 GGGTGAACACAATTTGTGAACGG + Intronic
970393127 4:15635784-15635806 GAGTTAAAACAATTTCTGCTAGG - Intronic
970888045 4:21009290-21009312 GAGTGAATAAAATTTCAGGATGG + Intronic
981937582 4:150251914-150251936 GGGAGAGCACACTTTCTGGCAGG - Intronic
983713202 4:170745502-170745524 GAGTGAAAACAATGTCTTCCAGG + Intergenic
983911060 4:173240244-173240266 GAGTGAATATACTTTCTGGTGGG - Intronic
986769939 5:10963438-10963460 GAGTGAACAGAAAATCTGGTTGG + Intergenic
986800148 5:11251130-11251152 GACTGAACACAATTATTGGCCGG + Intronic
987385686 5:17327086-17327108 CAGTGAACAGAGCTTCTGGCTGG - Intergenic
991731702 5:69596143-69596165 AAGTGAACACACTTGCTGGAAGG - Intergenic
991808134 5:70451281-70451303 AAGTGAACACACTTGCTGGAAGG - Intergenic
991863250 5:71031724-71031746 AAGTGAACACACTTGCTGGAAGG + Intergenic
992182755 5:74214040-74214062 GGGTGAAGGCAATTTGTGGCAGG + Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
995111151 5:108429673-108429695 AAGTGAATATAATTTTTGGCTGG + Intergenic
1001248513 5:170124932-170124954 TACAGAACACAGTTTCTGGCAGG + Intergenic
1003894821 6:10597449-10597471 GAATTAAGACAATTCCTGGCCGG - Intronic
1007470011 6:42083714-42083736 GAGGGAACACAATCTCTTTCTGG + Intronic
1008531655 6:52466824-52466846 GAGGCAATACAATTTCTGGAAGG + Intronic
1008637610 6:53426761-53426783 GAGTGATGAGAAATTCTGGCGGG - Intergenic
1009928690 6:70150187-70150209 GAGTGAAAAAAAATTCAGGCTGG + Intronic
1013160628 6:107540764-107540786 GAGACAACACAACTTCTGGGAGG - Intronic
1015717506 6:136207648-136207670 GACTTAACACAATTTATGGAAGG + Intergenic
1017577039 6:155816618-155816640 GAGTGATCAGACTATCTGGCAGG - Intergenic
1017713912 6:157194546-157194568 GACTGAACACAATTTCCTTCAGG + Intronic
1020590679 7:10132951-10132973 GAGTGAACAAAATTTATTTCTGG + Intergenic
1021565545 7:22013070-22013092 GTTTGAAGACAATGTCTGGCAGG - Intergenic
1021606637 7:22415028-22415050 GAGTGAACCCAACCTCTAGCAGG - Intergenic
1024173372 7:46812486-46812508 AAGTGAAGTCAGTTTCTGGCAGG - Intergenic
1030062197 7:105631436-105631458 GAGTTATCACCATTTCTGCCAGG + Intronic
1033682562 7:143609389-143609411 AAGTGAAGACATTTTCTGTCAGG + Intergenic
1033702329 7:143852524-143852546 AAGTGAAGACATTTTCTGTCAGG - Exonic
1034462477 7:151205443-151205465 GAGTGGACACAATGTCTGAGGGG - Exonic
1036470503 8:9048529-9048551 GAGTGACCACAGTTTATAGCTGG - Intronic
1036710784 8:11077319-11077341 GAGTGTCCACACTTTCTGGATGG - Intronic
1042174285 8:66023655-66023677 GAGTAAACACTTTATCTGGCAGG + Intronic
1042236042 8:66613655-66613677 GAGCGAACCGAGTTTCTGGCGGG + Intronic
1043358452 8:79441336-79441358 GAGTGAACAGTAGTTCTGGAGGG - Intergenic
1047715585 8:127592010-127592032 GATTCAACACATTTTCTGGTAGG + Intergenic
1048136626 8:131752709-131752731 GAGTGAACACAGTGCCTGGAAGG - Intergenic
1048241979 8:132751604-132751626 GAGTGAACAAAATTAATGGATGG + Intronic
1050833579 9:10047612-10047634 GAGTCAACACAAATTTTGGCAGG - Intronic
1050994290 9:12193967-12193989 GAGGGAAAGCATTTTCTGGCTGG + Intergenic
1051516736 9:17938144-17938166 GAGTGCACACAACTACTTGCTGG - Intergenic
1051742341 9:20263903-20263925 AAGTGAACATCATGTCTGGCTGG + Intergenic
1055100950 9:72465062-72465084 GAGAGACCAGACTTTCTGGCCGG - Intergenic
1056376877 9:86023336-86023358 GAATGAAAACTGTTTCTGGCTGG + Intergenic
1056626168 9:88255181-88255203 GAGGGAACCCAAGTCCTGGCTGG + Intergenic
1060079971 9:120634622-120634644 AAGTGAAGACAATTTCTTGTAGG + Intronic
1060468277 9:123927147-123927169 GGTTGAACACAATCTCTGTCAGG - Intronic
1188845241 X:35064432-35064454 GATTGAAAACAATGTCTGGGAGG - Intergenic
1190338551 X:49278408-49278430 GTTTCAACACAATTTCTGCCAGG - Intronic
1190507911 X:51145783-51145805 GAAGGAACTCAAATTCTGGCTGG - Intergenic
1195938652 X:110148380-110148402 GAATGAACACCATTTCTTCCAGG - Intronic
1202162349 Y:21948467-21948489 GAATGAACTCACTTTCTGGGTGG - Intergenic
1202229007 Y:22637906-22637928 GAATGAACTCACTTTCTGGGTGG + Intergenic
1202314147 Y:23558259-23558281 GAATGAACTCACTTTCTGGGTGG - Intergenic
1202556655 Y:26112336-26112358 GAATGAACTCACTTTCTGGGTGG + Intergenic