ID: 1098534672

View in Genome Browser
Species Human (GRCh38)
Location 12:71581250-71581272
Sequence CCCACCCCGGGGTATCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098534664_1098534672 9 Left 1098534664 12:71581218-71581240 CCAACTAATTCTAAATCATTCTC 0: 1
1: 0
2: 3
3: 32
4: 596
Right 1098534672 12:71581250-71581272 CCCACCCCGGGGTATCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1098534663_1098534672 21 Left 1098534663 12:71581206-71581228 CCTGCTTTTTGTCCAACTAATTC 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1098534672 12:71581250-71581272 CCCACCCCGGGGTATCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098534672 Original CRISPR CCCACCCCGGGGTATCTGTC TGG Intronic