ID: 1098536086

View in Genome Browser
Species Human (GRCh38)
Location 12:71595067-71595089
Sequence CATCCAATGCTGCCTGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098536086_1098536089 -3 Left 1098536086 12:71595067-71595089 CCAGTCACAGGCAGCATTGGATG No data
Right 1098536089 12:71595087-71595109 ATGGCCACAGCCTCCCCACAGGG No data
1098536086_1098536096 21 Left 1098536086 12:71595067-71595089 CCAGTCACAGGCAGCATTGGATG No data
Right 1098536096 12:71595111-71595133 GGCAAGACGCCCTATAATCCTGG No data
1098536086_1098536088 -4 Left 1098536086 12:71595067-71595089 CCAGTCACAGGCAGCATTGGATG No data
Right 1098536088 12:71595086-71595108 GATGGCCACAGCCTCCCCACAGG No data
1098536086_1098536090 0 Left 1098536086 12:71595067-71595089 CCAGTCACAGGCAGCATTGGATG No data
Right 1098536090 12:71595090-71595112 GCCACAGCCTCCCCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098536086 Original CRISPR CATCCAATGCTGCCTGTGAC TGG (reversed) Intergenic
No off target data available for this crispr