ID: 1098540900

View in Genome Browser
Species Human (GRCh38)
Location 12:71656106-71656128
Sequence CCAGGTGAACTAAGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098540900 Original CRISPR CCAGGTGAACTAAGGGCTGA GGG Intronic
900001186 1:15718-15740 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
900020901 1:186239-186261 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
900392458 1:2439689-2439711 CCAGGTGAACAGATGGCTCAGGG - Intronic
903226388 1:21896292-21896314 ACAGGTGACCCATGGGCTGAGGG - Exonic
903967689 1:27100540-27100562 CCTGGTGAATGAAGAGCTGAAGG - Exonic
905284649 1:36871378-36871400 CCAGGTGATTTAAGGGGTGCAGG - Intronic
906037108 1:42757730-42757752 CCAGCTGAACTCAGACCTGAGGG - Intronic
906328994 1:44868757-44868779 CCAGGTGATCAAATGGATGAAGG + Intronic
907952727 1:59199151-59199173 TCAGGTATACAAAGGGCTGAAGG - Intergenic
910117515 1:83748686-83748708 ACAGGAGAACCAAGGACTGATGG + Intergenic
910897148 1:92080812-92080834 CGAGGAGAACCAAGTGCTGAGGG - Intronic
911401838 1:97385149-97385171 CCAAGTGATCTAAGAGCTCAGGG + Intronic
916413192 1:164567910-164567932 CCTTGTGAACTAAGAGCTGTGGG + Intronic
918527120 1:185477305-185477327 CCAGGTGACCAAGGGACTGATGG - Intergenic
921318976 1:213918939-213918961 CAACATGAACTAAGAGCTGAAGG + Intergenic
922051029 1:221990764-221990786 CCAGGTGATATAAAGGCTGCTGG + Intergenic
922813112 1:228429139-228429161 CCAGGTGTCCTTAGGGCTAACGG + Intergenic
924126571 1:240859599-240859621 CCAGGTTAACTAAGGAATAAAGG - Intronic
924608406 1:245554394-245554416 CCAGATGGACTAAGAGGTGATGG - Intronic
1063018277 10:2100321-2100343 AAAGGTGAAATAAGGGCTGATGG - Intergenic
1067285098 10:44902179-44902201 CCAGATGAACTGAGTGGTGACGG - Intergenic
1073486015 10:103819682-103819704 CGGGGAGATCTAAGGGCTGAAGG + Intronic
1075112755 10:119600995-119601017 CCTGGTGGTCTAATGGCTGAGGG - Intergenic
1075403015 10:122174198-122174220 ACAGGTGGCCTAGGGGCTGAGGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078608953 11:12802797-12802819 CCAGGAGAACAAAGGGCTCGGGG - Intronic
1078723458 11:13905367-13905389 TCAGTTGAACTAATGGATGAGGG + Intergenic
1081703633 11:45167507-45167529 CCAGAAGAACTCAGGGCTGAGGG + Intronic
1085252806 11:75154700-75154722 CCTGGTGAACACAGGCCTGAGGG + Intronic
1087053372 11:93908178-93908200 CCAGGTGAAGTGATTGCTGATGG + Intergenic
1087109920 11:94453860-94453882 CCAGGTAAACTAACGACTGTGGG + Intronic
1088553592 11:111038883-111038905 CCAGATGAACTACTGGTTGAGGG + Intergenic
1089318172 11:117606152-117606174 TCAGGTGAGCTATGGGTTGAGGG + Intronic
1090437263 11:126697161-126697183 CCAGGTGAACACAGGTCTGGGGG - Intronic
1090499226 11:127245351-127245373 CAAGGAGAATTCAGGGCTGAGGG + Intergenic
1091374275 12:15835-15857 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
1093032028 12:14297225-14297247 CCAGTTAAAGTAAGGGCTTATGG - Intergenic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1098805280 12:75014810-75014832 CCAGTTGAAGTAGGGGCTTATGG + Intergenic
1098832073 12:75375301-75375323 CCAGTTGAAGTAGGGGCTTATGG - Intronic
1099379838 12:81940085-81940107 CCAGCTAAACTAGGGGCTTATGG - Intergenic
1099508365 12:83505664-83505686 CCAGTTAAACTAGGGGCTTATGG + Intergenic
1100229687 12:92594330-92594352 CCAGGTGAACTAGGGGTTGGGGG - Intergenic
1101263961 12:103064839-103064861 CCAGTTAAACTAGGGGCTTATGG + Intergenic
1102049858 12:109854911-109854933 CCATGAGAACGAGGGGCTGACGG - Intronic
1102248678 12:111370986-111371008 CCAGGTGACCTAGGGGCTTAAGG + Intergenic
1102792845 12:115661945-115661967 GCAGTTGCCCTAAGGGCTGAAGG - Intergenic
1103988454 12:124782570-124782592 CCAGGTGAAGTTGAGGCTGAAGG + Intronic
1105012724 12:132766461-132766483 CCATCTGAAGTGAGGGCTGAAGG - Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108914466 13:55590166-55590188 CCAGTTGAAGTAGGGGCTTATGG - Intergenic
1109712842 13:66182169-66182191 CCAGTTAAAGTAAGGGCTTATGG - Intergenic
1111694916 13:91611506-91611528 TCTGATGAACTAATGGCTGAAGG - Intronic
1112484753 13:99810356-99810378 CCATTTGAACTAGGAGCTGAAGG + Intronic
1112792435 13:103017413-103017435 CCAGCTGAACCAATGGCTGCGGG + Intergenic
1114162381 14:20182748-20182770 CCAGGAGTATTAAGGGATGAGGG + Intergenic
1114382514 14:22222543-22222565 CCAAGAGGACTAAGAGCTGAAGG - Intergenic
1115057883 14:29152878-29152900 CCAGGTGAAGCAGGGGCTGGTGG + Intergenic
1115959553 14:38820079-38820101 ACATGAGAACTAGGGGCTGAAGG + Intergenic
1119665397 14:76481733-76481755 TAAGGAGAACCAAGGGCTGAGGG + Intronic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1125739559 15:41952578-41952600 CCAGTGGAACTGAGGGCTGCTGG - Intronic
1126110048 15:45169627-45169649 CCAGGTGGACTAAGGGAGAAGGG - Intronic
1126312620 15:47334813-47334835 CCAGTGGAATTAAGGGATGATGG + Intronic
1127869095 15:63055395-63055417 CTAGGTGAGCAAAGAGCTGAAGG + Intronic
1129054480 15:72809185-72809207 CCACCTGAACTGAGGGCTGTGGG - Intergenic
1129550803 15:76447065-76447087 TCTGGTGTATTAAGGGCTGAAGG + Intronic
1131458187 15:92599470-92599492 CAAGGTGAAATAAGAGCTCAAGG + Intergenic
1132452323 15:101975221-101975243 CCCGGTGGACTCAGGGCTGGAGG - Intergenic
1132454573 16:15402-15424 CCCGGTGGACTCAGGGCTGGAGG + Intronic
1133130928 16:3675768-3675790 CCAGGTGCACTAAAGGCCAAGGG + Intronic
1134397435 16:13878037-13878059 CCAGGTGAACTAGGGCAAGAAGG - Intergenic
1135671409 16:24378637-24378659 CCAGGTGTCCCAAGGGCTAAAGG + Intergenic
1137249767 16:46732923-46732945 CCAGGAGAACTGAGGCCTGTAGG + Intronic
1141889979 16:86919931-86919953 ACAGGTGAGCTGTGGGCTGATGG + Intergenic
1145230671 17:21171245-21171267 TCAGGGGAAATAAGGGCAGATGG + Intronic
1145932776 17:28697949-28697971 ACAGATGAAATAAGGGATGAAGG - Exonic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1151833202 17:76567977-76567999 CGATGTGAACTCAGGCCTGAGGG - Intronic
1154382928 18:13868967-13868989 TCAGGTGAAGGAAGAGCTGATGG - Intergenic
1157914352 18:51650183-51650205 CCAAGTGGCCTAAGGGCTGCTGG - Intergenic
1159148939 18:64494993-64495015 CCAGGTGGACAGAGAGCTGAGGG + Intergenic
1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG + Intronic
1162386370 19:10362530-10362552 CCAGGTGAGCCCAGGGCTGGGGG - Exonic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167141085 19:47651214-47651236 CCAGGTGAGCCCAGGGCTGAGGG - Intronic
925260118 2:2521631-2521653 ACAGGTGAACGAATGGATGAAGG - Intergenic
925781081 2:7382437-7382459 CAAGGAGAACTCAGGGGTGAGGG - Intergenic
925918791 2:8625485-8625507 GAAGGTGAACTAGGGGGTGAGGG + Intergenic
927948372 2:27150785-27150807 CCAGGAGAACAACGGTCTGAGGG + Intronic
929755827 2:44763695-44763717 ACAGGTAAACTGAGAGCTGAAGG + Intronic
935353488 2:102176868-102176890 CCAGGTGACCTCAGGGATAAAGG - Exonic
936568539 2:113597694-113597716 CCCGGTGGACTCAGGGCTGGAGG - Intergenic
936646443 2:114377624-114377646 CCAGGTAAATTAGGGGCTTATGG - Intergenic
941155424 2:161972028-161972050 CCAGGTAACCTAAGCACTGACGG + Intronic
941805825 2:169711646-169711668 CCAGCCCAACTGAGGGCTGAGGG + Intronic
945162174 2:206903703-206903725 CCAGGTAAACAAAAAGCTGAGGG - Intergenic
945985357 2:216349448-216349470 CCAGGTGAACGATGAGCTCAAGG - Intronic
947601893 2:231456617-231456639 CCAGGTGAACTTACGGCTTCTGG + Exonic
948218501 2:236250541-236250563 CCAGGTAAAAAAAGGGGTGAAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174438101 20:50526416-50526438 CCAGGTAAACTAAGGGGAGTAGG - Intronic
1175997693 20:62818829-62818851 CCAGGTGACCTCAGGCCTGGGGG - Intronic
1176729175 21:10473597-10473619 GCAGAGGAACTAAGAGCTGAAGG - Intergenic
1178586539 21:33875434-33875456 CCAGGTGAACGAAGGGGTGCGGG + Exonic
1178927572 21:36788373-36788395 CCATCGGAACTTAGGGCTGACGG + Intronic
1180005333 21:45018303-45018325 CCAAGTGCACGAACGGCTGAGGG - Intergenic
1180070787 21:45435035-45435057 CCTGGAGCACCAAGGGCTGAAGG + Intronic
1181359975 22:22327055-22327077 CCAGGAGAACTAAGGTCATATGG - Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182658487 22:31908272-31908294 ACAGTTGAGCTAAGAGCTGATGG - Intergenic
1183817161 22:40312216-40312238 CCAGGAGACTTCAGGGCTGAAGG - Intronic
1184058058 22:42065881-42065903 CCAGGTGAACTACAGTCTGCTGG - Exonic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184197383 22:42939095-42939117 ATAGGTGAGCTAAGAGCTGATGG - Intronic
1184827782 22:46964778-46964800 GCAGGGGCACTGAGGGCTGAGGG + Intronic
950192961 3:10991132-10991154 CCATTTGAACTGAGGTCTGAAGG - Intergenic
950428986 3:12940226-12940248 CCAGGTGAGGAAGGGGCTGATGG + Intronic
953469539 3:43155161-43155183 GCAGGGGAAAGAAGGGCTGAGGG + Intergenic
954053954 3:48006394-48006416 CCAGTTAAACTAGGGGCTCATGG + Intronic
954268302 3:49487558-49487580 CCAGAAGAACTCAGGGCTCAGGG - Intronic
954468419 3:50672374-50672396 CCAGCTGAACTGAGGGCAGTTGG + Intergenic
955508955 3:59660047-59660069 ACAGGGGAGCTAAGAGCTGAAGG - Intergenic
956632852 3:71332958-71332980 GCAGCTGAACTTAGGGCTGTGGG + Intronic
957954110 3:87161480-87161502 TCAGGAGAACTGAGGGATGAGGG - Intergenic
961371169 3:126432952-126432974 CCAGCTGTCCTGAGGGCTGAAGG - Intronic
962407021 3:135109146-135109168 CCAGGTAAACTGAGGGCTTCTGG - Intronic
964443148 3:156732735-156732757 CCAGCTGAATCAAGGGCAGAGGG + Intergenic
966509060 3:180740922-180740944 ACAGGTGAAATATGGGCAGAGGG + Intronic
968826146 4:2898937-2898959 GAACGTGAACTAACGGCTGACGG - Intronic
971054260 4:22895151-22895173 CCATTTGAACCAAGGTCTGAAGG + Intergenic
972085069 4:35205832-35205854 CCAGTTGAAGTAGGGGCTTATGG + Intergenic
972549599 4:40117837-40117859 CCAGGGGAAAAAAGGGTTGAAGG - Intronic
972713339 4:41620687-41620709 CCAGGTCAGCTCTGGGCTGAGGG + Intronic
973103610 4:46302950-46302972 CAAGGTAAAATAGGGGCTGAAGG - Intronic
976005232 4:80422052-80422074 TCAGCAGACCTAAGGGCTGATGG + Intronic
976100587 4:81558570-81558592 CCAGGTGAAGAACGGGGTGAGGG + Intronic
976302179 4:83525631-83525653 CCAGTTGAACTAAGAGTTGAGGG + Intergenic
977920874 4:102641226-102641248 CCAGGTCAGCTAAGAACTGAAGG + Intronic
978460527 4:108946772-108946794 CCAGGTGAATGAGGGGCTGGAGG + Intronic
983837608 4:172411673-172411695 CCAGTTGTCCTAAGGGCTGAAGG + Intronic
985833512 5:2253020-2253042 CCAGGTGAGCGGAGTGCTGAAGG - Intergenic
986233273 5:5885844-5885866 ACAGTTGCACAAAGGGCTGAGGG - Intergenic
989635327 5:43525595-43525617 CAAGGAAAACTAAGGGCTGAGGG - Intergenic
989719306 5:44505145-44505167 CCAGAAGAACTGAGGGGTGAAGG + Intergenic
991931166 5:71754095-71754117 CTTGGTGAACTAAGGCCTGTAGG - Intergenic
992070706 5:73145968-73145990 GCTGGTGAACTATGGGCTGCGGG + Intergenic
994277360 5:97855124-97855146 CCAGGCCAACTAGGGGCAGAAGG + Intergenic
1000288257 5:159846473-159846495 CCAGATGAACCATGGGCTGCAGG + Intergenic
1003165093 6:3670592-3670614 CTGGGTGGACTCAGGGCTGAGGG + Intergenic
1004194857 6:13494188-13494210 CCAGGAGAATGAAGGGCTGAGGG - Intergenic
1006214658 6:32430082-32430104 CCTGGTGAACTTAGAACTGAAGG + Intergenic
1006727304 6:36208946-36208968 CCAGATGCTCCAAGGGCTGATGG + Intronic
1007249679 6:40487323-40487345 TCAGGTGAAGCCAGGGCTGAGGG - Intronic
1007398771 6:41591878-41591900 CCAGGAAAACTTATGGCTGAAGG - Intronic
1007915886 6:45561369-45561391 CCATATGAACCAAGGGCAGAGGG + Intronic
1008820244 6:55623970-55623992 CCAGGTAAAGTAGGGGCTAATGG - Intergenic
1009562750 6:65270264-65270286 CCAGGTGATCTTAAGGCTCAAGG + Intronic
1010108169 6:72192194-72192216 CCAGTTTAAGTAAGGGCTTATGG - Intronic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1012820636 6:104081643-104081665 CCAGTTAAAGTAAGGGCTTATGG + Intergenic
1013458025 6:110349670-110349692 CCAAGTGAACTATGGGCTGAAGG - Intronic
1016010615 6:139134996-139135018 CCAGGTGACCTCACGGCTGACGG - Intergenic
1017977284 6:159369339-159369361 CCAGTTAAAGTAAGGGCTTATGG - Intergenic
1019840003 7:3431666-3431688 CCTGGTGGACTAAGGGAGGATGG + Intronic
1020605073 7:10326952-10326974 GCAGGTGAACTCAGAGCTGATGG + Intergenic
1020916944 7:14206356-14206378 CCAGGTGAACAAGGAGGTGATGG + Intronic
1024147050 7:46528148-46528170 CCAAGTTAACTTGGGGCTGATGG - Intergenic
1026377866 7:69770392-69770414 TCATGTGAACTCAGGGCTGAGGG - Intronic
1026651940 7:72223282-72223304 CCAGGAGAATTAAAGTCTGAAGG + Intronic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1031041506 7:116843140-116843162 CCAGTTGAGCTGAGGCCTGATGG - Intronic
1033007858 7:137586940-137586962 CCAGATCAAATAAGGGCTCAAGG + Intronic
1033360499 7:140635834-140635856 CTAGGCAAACTGAGGGCTGACGG + Intronic
1033824586 7:145173889-145173911 ACATGTAAACTAAGGTCTGAAGG - Intergenic
1034600412 7:152248011-152248033 GCAGAGGAACTAAGAGCTGAAGG + Exonic
1034616799 7:152424769-152424791 GCAAGTCAACTAAGGGCTGAAGG + Intronic
1036079594 8:5540527-5540549 CCAGGGAACCTAAGGACTGAAGG + Intergenic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1036236504 8:7043570-7043592 GCGGGTGGACAAAGGGCTGAGGG - Intergenic
1037671211 8:21016757-21016779 ACAGTTGAAGGAAGGGCTGACGG - Intergenic
1037796305 8:21998087-21998109 CCATGCCAACTAATGGCTGAAGG + Intronic
1039345600 8:36701863-36701885 CCAGGTGAACTACGTGGTCATGG - Intergenic
1040387675 8:46924452-46924474 CCAGGTGAAGTGATGGGTGATGG - Intergenic
1044797259 8:95916416-95916438 CCAGGTGAAATAAAGAATGAGGG - Intergenic
1046512739 8:115219865-115219887 CCAGGTGAACAAAGGCAAGAAGG + Intergenic
1046585940 8:116148914-116148936 CCAGTTAAACTAGGGGCTTATGG - Intergenic
1049415820 8:142494658-142494680 CCAGGTGCTCTTAGGGCTCAGGG - Intronic
1049883991 9:15831-15853 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
1050301455 9:4262875-4262897 CCATGTGAACTACGGGCTTAAGG - Intronic
1053796248 9:41729362-41729384 CCAGGAGAACTCAGGTCCGAGGG + Intergenic
1054184653 9:61941432-61941454 CCAGGAGAACTCAGGTCCGAGGG + Intergenic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1054653854 9:67647065-67647087 CCAGGAGAACTCAGGTCCGAGGG - Intergenic
1056361567 9:85862739-85862761 CCAGCTGCCCTGAGGGCTGAGGG - Intergenic
1056829205 9:89900789-89900811 CCAGGTGAGCAAAGGGGTAAGGG + Intergenic
1056886654 9:90449602-90449624 CCAGATGAAGTCAGGGCTGATGG - Intergenic
1057521240 9:95762259-95762281 CCAGGTGAACTGAGGCCAGCTGG + Intergenic
1059563580 9:115359649-115359671 TCAGCTGAACTGAGGTCTGAAGG + Intronic
1061317737 9:129807435-129807457 CCTGGTAAACAAAGTGCTGATGG - Intronic
1061474888 9:130858472-130858494 CCAGGTGCCCAAACGGCTGATGG - Intronic
1062478200 9:136739917-136739939 CCAGGAGGGCAAAGGGCTGAGGG + Intronic
1203585084 Un_KI270746v1:60478-60500 GCAGAGGAACTAAGAGCTGAAGG + Intergenic
1186469940 X:9813359-9813381 CCAGTTGAAGTAGGGGCTTATGG - Intronic
1191811761 X:65196770-65196792 CCTGGTGATATTAGGGCTGAGGG - Intergenic
1194179753 X:90697224-90697246 CCAGTTAAAGTAGGGGCTGATGG - Intergenic
1195327987 X:103773596-103773618 CCAAGAGAACCGAGGGCTGAGGG - Intergenic
1195437759 X:104864908-104864930 CCAGTTAAAGTAAGGGCTTATGG + Intronic
1195809826 X:108817100-108817122 CCAGTTAAAGTAGGGGCTGATGG - Intergenic
1196372509 X:114995393-114995415 CCAGGTAAAGTACGGGCTTATGG - Intergenic
1196485153 X:116197717-116197739 CCAGTGAAACTAAGGGCTTATGG + Intergenic
1197822770 X:130558306-130558328 CCAGGGGAGCTGATGGCTGAGGG + Intergenic
1200526413 Y:4279393-4279415 CCAGTTAAAGTAGGGGCTGATGG - Intergenic