ID: 1098541554

View in Genome Browser
Species Human (GRCh38)
Location 12:71663438-71663460
Sequence GGAGGCCTTCGCCGCGGATA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098541539_1098541554 10 Left 1098541539 12:71663405-71663427 CCTCCGCCAGATCCACCGCCCCG 0: 1
1: 0
2: 0
3: 33
4: 473
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541550_1098541554 -10 Left 1098541550 12:71663425-71663447 CCGGGCCGAGTGAGGAGGCCTTC 0: 1
1: 0
2: 1
3: 10
4: 184
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541537_1098541554 16 Left 1098541537 12:71663399-71663421 CCACCGCCTCCGCCAGATCCACC 0: 1
1: 0
2: 1
3: 36
4: 594
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541546_1098541554 -5 Left 1098541546 12:71663420-71663442 CCGCCCCGGGCCGAGTGAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541549_1098541554 -9 Left 1098541549 12:71663424-71663446 CCCGGGCCGAGTGAGGAGGCCTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541543_1098541554 4 Left 1098541543 12:71663411-71663433 CCAGATCCACCGCCCCGGGCCGA 0: 1
1: 0
2: 1
3: 44
4: 525
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541544_1098541554 -2 Left 1098541544 12:71663417-71663439 CCACCGCCCCGGGCCGAGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 362
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541548_1098541554 -8 Left 1098541548 12:71663423-71663445 CCCCGGGCCGAGTGAGGAGGCCT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541542_1098541554 7 Left 1098541542 12:71663408-71663430 CCGCCAGATCCACCGCCCCGGGC 0: 1
1: 0
2: 1
3: 12
4: 331
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1098541538_1098541554 13 Left 1098541538 12:71663402-71663424 CCGCCTCCGCCAGATCCACCGCC 0: 1
1: 0
2: 1
3: 31
4: 498
Right 1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098541554 Original CRISPR GGAGGCCTTCGCCGCGGATA GGG Exonic
903550583 1:24155231-24155253 GGAGGCCTTCACCGCTGCTGGGG - Exonic
907943499 1:59111160-59111182 GGAGGTCTTCACCGGGGATGGGG + Intergenic
918612465 1:186508624-186508646 GGAGGCCTTCTCCGCATCTATGG + Intergenic
1072429349 10:95356978-95357000 GCAGGCCTTCGCAGCTGACAGGG + Intronic
1080450482 11:32374917-32374939 GGAGGCCTTCCCCGAGGCTGGGG - Intergenic
1085421238 11:76362901-76362923 GGAGGCCTTGGCCGGGTAGACGG + Intronic
1090333415 11:125947873-125947895 GGAGGCCATCGCCTCGGCTCTGG + Intergenic
1098541554 12:71663438-71663460 GGAGGCCTTCGCCGCGGATAGGG + Exonic
1113800182 13:113082423-113082445 GCAGGGCTACGCCGCGGAGATGG + Exonic
1134635709 16:15790367-15790389 GGAGACCATAGCCACGGATAGGG - Intronic
1148119258 17:45197987-45198009 GGAGCCCTTCCCCGCAGAGAGGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
1169044430 20:2524664-2524686 GGGGGCCTTCGCAGAGGATCTGG + Intronic
1176145889 20:63565308-63565330 GATGGCCTTCGCCGGGGATGAGG - Exonic
1178367883 21:32002651-32002673 GGAGGCCTTGGTCATGGATAGGG + Exonic
1179924326 21:44525686-44525708 GGAGGCCTTCGAGGTGGATGGGG - Exonic
1184686933 22:46100480-46100502 GGAGGCCTTGGCCCAGGATGGGG + Intronic
951593283 3:24289912-24289934 GGAGGCCTTTGCTGGGGATGGGG - Intronic
1060545123 9:124454877-124454899 GGAGGCCTCCGCTGGGGACAGGG - Exonic
1201593247 Y:15638001-15638023 GGAGGGCTTCCCAGCTGATATGG + Intergenic