ID: 1098546370

View in Genome Browser
Species Human (GRCh38)
Location 12:71716334-71716356
Sequence CAGAGGAGTCAGAGAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098546368_1098546370 9 Left 1098546368 12:71716302-71716324 CCTAACTATGGTCAAAGAAAGTG No data
Right 1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098546370 Original CRISPR CAGAGGAGTCAGAGAGATGC TGG Intergenic
No off target data available for this crispr