ID: 1098556302

View in Genome Browser
Species Human (GRCh38)
Location 12:71822706-71822728
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098556295_1098556302 2 Left 1098556295 12:71822681-71822703 CCAGGTGCAGTGGCTCCTGCCAG No data
Right 1098556302 12:71822706-71822728 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1098556290_1098556302 30 Left 1098556290 12:71822653-71822675 CCTTGTGAGATTTTTAAGTGTTC No data
Right 1098556302 12:71822706-71822728 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098556302 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr