ID: 1098556654

View in Genome Browser
Species Human (GRCh38)
Location 12:71825962-71825984
Sequence GGAGTCTTGCTCTGGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307904
Summary {0: 10, 1: 9789, 2: 57444, 3: 102493, 4: 138168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098556654_1098556658 16 Left 1098556654 12:71825962-71825984 CCTGGGCGCCAGAGCAAGACTCC 0: 10
1: 9789
2: 57444
3: 102493
4: 138168
Right 1098556658 12:71826001-71826023 AATAAAAGAGCAATCTGGAGAGG No data
1098556654_1098556659 20 Left 1098556654 12:71825962-71825984 CCTGGGCGCCAGAGCAAGACTCC 0: 10
1: 9789
2: 57444
3: 102493
4: 138168
Right 1098556659 12:71826005-71826027 AAAGAGCAATCTGGAGAGGAAGG No data
1098556654_1098556657 11 Left 1098556654 12:71825962-71825984 CCTGGGCGCCAGAGCAAGACTCC 0: 10
1: 9789
2: 57444
3: 102493
4: 138168
Right 1098556657 12:71825996-71826018 AAAAAAATAAAAGAGCAATCTGG No data
1098556654_1098556660 29 Left 1098556654 12:71825962-71825984 CCTGGGCGCCAGAGCAAGACTCC 0: 10
1: 9789
2: 57444
3: 102493
4: 138168
Right 1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098556654 Original CRISPR GGAGTCTTGCTCTGGCGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr