ID: 1098556655

View in Genome Browser
Species Human (GRCh38)
Location 12:71825970-71825992
Sequence TTTGAGACGGAGTCTTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3536
Summary {0: 42, 1: 318, 2: 697, 3: 1095, 4: 1384}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098556655_1098556659 12 Left 1098556655 12:71825970-71825992 CCAGAGCAAGACTCCGTCTCAAA 0: 42
1: 318
2: 697
3: 1095
4: 1384
Right 1098556659 12:71826005-71826027 AAAGAGCAATCTGGAGAGGAAGG No data
1098556655_1098556660 21 Left 1098556655 12:71825970-71825992 CCAGAGCAAGACTCCGTCTCAAA 0: 42
1: 318
2: 697
3: 1095
4: 1384
Right 1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG No data
1098556655_1098556658 8 Left 1098556655 12:71825970-71825992 CCAGAGCAAGACTCCGTCTCAAA 0: 42
1: 318
2: 697
3: 1095
4: 1384
Right 1098556658 12:71826001-71826023 AATAAAAGAGCAATCTGGAGAGG No data
1098556655_1098556657 3 Left 1098556655 12:71825970-71825992 CCAGAGCAAGACTCCGTCTCAAA 0: 42
1: 318
2: 697
3: 1095
4: 1384
Right 1098556657 12:71825996-71826018 AAAAAAATAAAAGAGCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098556655 Original CRISPR TTTGAGACGGAGTCTTGCTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr