ID: 1098556656

View in Genome Browser
Species Human (GRCh38)
Location 12:71825983-71826005
Sequence TTATTTTTTTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371976
Summary {0: 392, 1: 91386, 2: 74079, 3: 85580, 4: 120539}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098556656_1098556657 -10 Left 1098556656 12:71825983-71826005 CCGTCTCAAAAAAAAAAAAATAA 0: 392
1: 91386
2: 74079
3: 85580
4: 120539
Right 1098556657 12:71825996-71826018 AAAAAAATAAAAGAGCAATCTGG No data
1098556656_1098556660 8 Left 1098556656 12:71825983-71826005 CCGTCTCAAAAAAAAAAAAATAA 0: 392
1: 91386
2: 74079
3: 85580
4: 120539
Right 1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG No data
1098556656_1098556658 -5 Left 1098556656 12:71825983-71826005 CCGTCTCAAAAAAAAAAAAATAA 0: 392
1: 91386
2: 74079
3: 85580
4: 120539
Right 1098556658 12:71826001-71826023 AATAAAAGAGCAATCTGGAGAGG No data
1098556656_1098556659 -1 Left 1098556656 12:71825983-71826005 CCGTCTCAAAAAAAAAAAAATAA 0: 392
1: 91386
2: 74079
3: 85580
4: 120539
Right 1098556659 12:71826005-71826027 AAAGAGCAATCTGGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098556656 Original CRISPR TTATTTTTTTTTTTTTGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr