ID: 1098556660

View in Genome Browser
Species Human (GRCh38)
Location 12:71826014-71826036
Sequence TCTGGAGAGGAAGGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098556655_1098556660 21 Left 1098556655 12:71825970-71825992 CCAGAGCAAGACTCCGTCTCAAA 0: 42
1: 318
2: 697
3: 1095
4: 1384
Right 1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG No data
1098556656_1098556660 8 Left 1098556656 12:71825983-71826005 CCGTCTCAAAAAAAAAAAAATAA 0: 392
1: 91386
2: 74079
3: 85580
4: 120539
Right 1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG No data
1098556654_1098556660 29 Left 1098556654 12:71825962-71825984 CCTGGGCGCCAGAGCAAGACTCC 0: 10
1: 9789
2: 57444
3: 102493
4: 138168
Right 1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098556660 Original CRISPR TCTGGAGAGGAAGGCTCCTG TGG Intergenic
No off target data available for this crispr