ID: 1098566358

View in Genome Browser
Species Human (GRCh38)
Location 12:71941680-71941702
Sequence TTCTCCTTGAAGAATGAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098566357_1098566358 3 Left 1098566357 12:71941654-71941676 CCGAAAGTGGCAAGACAGCAGTT 0: 1
1: 0
2: 2
3: 16
4: 186
Right 1098566358 12:71941680-71941702 TTCTCCTTGAAGAATGAAGTTGG 0: 1
1: 0
2: 2
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098566358 Original CRISPR TTCTCCTTGAAGAATGAAGT TGG Exonic
901545035 1:9949755-9949777 TGCTTCTTTAAGAATGTAGTGGG - Intronic
902384287 1:16067565-16067587 CTCTCCTTGAAGAATCAAGATGG - Intronic
902444170 1:16451602-16451624 ATTTCCCTGATGAATGAAGTGGG + Intronic
906738547 1:48156895-48156917 ATCCACATGAAGAATGAAGTTGG + Intergenic
907674915 1:56509390-56509412 TTCTCCTTGCAGAGTGCAGAGGG + Intronic
907957105 1:59240290-59240312 AGCTCCTGGAAGAATGAAGCTGG - Intergenic
908318946 1:62962697-62962719 TGCTCCTGGAAGAATGGTGTGGG + Intergenic
908614832 1:65908198-65908220 TTCTCCTGGAAGAATAAAGAGGG + Intronic
909179750 1:72407669-72407691 TTCTCCTTGTACATTGAATTTGG - Intergenic
909189688 1:72537094-72537116 TTATCCATGAGGAATGAACTCGG - Intergenic
911385832 1:97174376-97174398 TGCTCCTTGAGGAGTGGAGTAGG - Intronic
917142143 1:171846394-171846416 AACTTCTTTAAGAATGAAGTTGG + Intronic
917157151 1:172015873-172015895 TTCACCATTAAGAATGATGTTGG + Intronic
918357950 1:183723904-183723926 TTCTGCTTGAAGAAAGGAGAGGG + Intronic
918949765 1:191122432-191122454 TTTTCCATCAAGAATGAAATTGG + Intergenic
918980163 1:191547150-191547172 TTCTCCTTGATGAAAGAACCAGG - Intergenic
919399173 1:197087737-197087759 TTCTGATTGAAGAATGAATTTGG - Intronic
919581313 1:199377591-199377613 TTCTATTTGAAAAATGAAGCTGG - Intergenic
920804070 1:209216635-209216657 TTCTCCTGGGAGACTGAAGTTGG + Intergenic
920953648 1:210597872-210597894 TTCTGCTTGAAAAAAGAAGAGGG - Intronic
921369889 1:214410975-214410997 ATTTCCATGAAGAATGATGTTGG + Intronic
921485409 1:215709750-215709772 GGCTCTTTGAAGAATGTAGTTGG + Intronic
921908063 1:220516214-220516236 TTCTCCAAGAAGAATGTAATGGG - Intergenic
922315798 1:224440715-224440737 TTCTCTTTGATGGATGGAGTGGG + Intronic
1062841436 10:675898-675920 CTGGCCTTGAAGAATGAACTTGG - Intronic
1062956493 10:1543649-1543671 TATCCGTTGAAGAATGAAGTTGG - Intronic
1063888668 10:10606269-10606291 GTCTCCTGGAAGACTGAAATTGG - Intergenic
1065425499 10:25598744-25598766 TTCTCCTTTAAGGAAAAAGTGGG - Exonic
1068279376 10:54849174-54849196 TTTTCATTGAAGAAAGAAGAAGG - Intronic
1068907978 10:62348225-62348247 TGCTCAATGAAGAATGAATTTGG + Intergenic
1070940851 10:80345762-80345784 TTCAGCTTTAAGAAAGAAGTAGG - Intronic
1071458159 10:85867268-85867290 GTCTCCTTGAAGAACAAAGATGG - Intronic
1071876025 10:89844261-89844283 TTCTCCTTTCAGTATGATGTTGG + Intergenic
1072488248 10:95877025-95877047 TTCTCCCTGCAGGATGAAGGGGG - Exonic
1074074863 10:110113720-110113742 TTCTGTGTGAAGAATGAACTGGG + Intronic
1075298108 10:121295909-121295931 TCCTTCTTAAAGAAGGAAGTTGG - Intergenic
1075420660 10:122298201-122298223 TTCTCCTCTGAGAATGAGGTTGG - Intronic
1076594909 10:131619381-131619403 TGCTCCTGGAAGAATAAAGGAGG + Intergenic
1076961601 10:133766584-133766606 TTCATCTTAAAGAATGAAGAAGG + Intergenic
1077821769 11:5751958-5751980 TTCTGCTTGAAGAATGTATAGGG + Intronic
1078609115 11:12804125-12804147 TTCTCTTTGAAGTATTAACTTGG + Intronic
1078620345 11:12901458-12901480 TCCTGCTGGAAGAAGGAAGTGGG + Intronic
1078632023 11:13011143-13011165 TTTTTCTTGCAGAATGCAGTGGG + Intergenic
1078813222 11:14792865-14792887 TTCTCCTTGGAGAAGGGAGAAGG - Intronic
1079165700 11:18040677-18040699 TTTTCCTTAAAGAATGAAGTTGG - Exonic
1079694504 11:23463270-23463292 ATATCCTTTAAGAATGAAGATGG + Intergenic
1080547786 11:33337970-33337992 TTCTTCTTAAAGAAGGAAGGGGG - Intronic
1080813103 11:35725717-35725739 TACTCCCTGAAGAATGAAAAAGG + Intronic
1085178443 11:74511220-74511242 TTCTCCTTGATAAAAGAAGAGGG + Intronic
1086426991 11:86694839-86694861 TTCTCCTAGAAATATGAAGTTGG + Intergenic
1087135621 11:94715591-94715613 CTATCCTTCAAGAATGAAGGGGG - Intronic
1087359260 11:97137071-97137093 TTCTGCTTGAAGAAAGGAGAGGG - Intergenic
1087480952 11:98699672-98699694 TTCTCCTTGAAGAGGTCAGTAGG - Intergenic
1087853069 11:103055960-103055982 TTTGGCTTGAAGAATGAAGTGGG - Intergenic
1088634109 11:111802926-111802948 TTCTCAGTGAAGTAGGAAGTGGG - Intronic
1089147799 11:116342975-116342997 TTCTCAATGAAGTAGGAAGTAGG + Intergenic
1089849775 11:121486231-121486253 TGCTCCTGGAAGAATGAGGAAGG - Intronic
1090952372 11:131484968-131484990 TTATACTTGAAAAATGGAGTGGG + Intronic
1092930794 12:13313856-13313878 TTCTCATTGTAGAATCAAGGTGG - Intergenic
1093445011 12:19246873-19246895 CTCTCCATTAAGAATGAAATAGG + Intronic
1093480530 12:19599835-19599857 TTCTCCCTTCAGAATGAAGCAGG - Intronic
1093615724 12:21221198-21221220 TTTTCCTTTCAGTATGAAGTTGG - Intronic
1095827771 12:46548120-46548142 TTCTCCTTCAAGAATGATTGAGG + Intergenic
1095973543 12:47923124-47923146 TATTCCTTGAAGCATCAAGTGGG + Intronic
1098443892 12:70546625-70546647 TTCTTCTTGAAGGAAGAATTAGG + Intronic
1098566358 12:71941680-71941702 TTCTCCTTGAAGAATGAAGTTGG + Exonic
1099363665 12:81741193-81741215 ATCCCCTTCAAGAATGAAGTGGG - Intronic
1099452644 12:82826077-82826099 TTCTTTTTTAAAAATGAAGTTGG - Intronic
1101021108 12:100554762-100554784 TTCTCCAGGAAGAAGGAAGCAGG + Intronic
1103194575 12:119031522-119031544 TTCTACTTCTAGAATGTAGTAGG - Intronic
1104134150 12:125921551-125921573 TCTCCCTTGAAGAGTGAAGTGGG + Intergenic
1105773039 13:23630681-23630703 TTCTCCTTGAAGCTCTAAGTGGG - Intronic
1106065811 13:26348128-26348150 TTATCCATAAAGAATGAAATAGG + Intronic
1106324905 13:28679732-28679754 TTCTCCTTAATTAAGGAAGTTGG + Intergenic
1106349669 13:28917267-28917289 CTGTCCTTGTAGAATGAATTTGG + Intronic
1107061825 13:36167466-36167488 TTTTCCTTGTAAAATCAAGTTGG - Intergenic
1107201087 13:37718382-37718404 TTCTCCTTCTAGAAAGAAGCAGG + Intronic
1107445347 13:40465650-40465672 TTCTCCTCGAAGCATGGATTTGG - Intergenic
1107984403 13:45763045-45763067 GTCTCCTTGATGCATGAAGGAGG + Intergenic
1108898727 13:55369186-55369208 TTCTCTTTGAAGAATTGATTGGG + Intergenic
1108960286 13:56218287-56218309 TTCTTCTAGAAGTGTGAAGTGGG + Intergenic
1109961704 13:69639612-69639634 TTCTTCTTGAAGAGTGGAGAGGG - Intergenic
1110518266 13:76442776-76442798 TTCTCCATTAAGTATAAAGTTGG - Intergenic
1111426026 13:88083564-88083586 TTCTCCTTCAATATTGAAGTAGG + Intergenic
1111537650 13:89625021-89625043 TTCTCATTGAAGAATGAGGCCGG - Intergenic
1111617444 13:90678820-90678842 TGCTCTTTGAAGATTGAAGCAGG - Intergenic
1112221040 13:97490528-97490550 TTCTCCTTGAAGAGTAATTTAGG + Intergenic
1112865935 13:103898432-103898454 TTCTCCTTGAAGAAAGGAGAAGG + Intergenic
1113114923 13:106865123-106865145 TTTACCTTGAAAAATCAAGTAGG + Intergenic
1113255782 13:108503409-108503431 TTCTCCTTGATGAAGAAAATTGG - Intergenic
1113847041 13:113398161-113398183 TTCTCCTAGAAGAACAAAGGAGG - Intergenic
1114374008 14:22123514-22123536 TTGTCCTTGAAGTATGAGGCTGG + Intergenic
1115895596 14:38083443-38083465 TTCTCATTGAAAAAGAAAGTAGG + Intergenic
1115965710 14:38885174-38885196 TTCTGCTGAAAGAGTGAAGTTGG - Intergenic
1116106455 14:40514045-40514067 TTCTTCTTGAAAAATGCAGAGGG + Intergenic
1117086607 14:52208044-52208066 TTCTCCTTTAACAATGAAACAGG - Intergenic
1117843022 14:59880752-59880774 TTCTGCTTGAGGAAAGAAGAGGG - Intergenic
1119668843 14:76503642-76503664 TGCTCCATGAAGAATGAAGATGG - Intergenic
1120426176 14:84351043-84351065 TTCTACTTGAAGAAAGGAGAAGG + Intergenic
1120736033 14:88053851-88053873 TTCTCCATGCAGTATGATGTTGG + Intergenic
1120754229 14:88227067-88227089 TTCTCCTTCAAGATGGAAGATGG - Intronic
1121926722 14:97933675-97933697 ATATACTTGAAGTATGAAGTTGG - Intronic
1122500955 14:102199195-102199217 TTCTGCTTGCAGGATGATGTGGG + Intronic
1124869951 15:33530684-33530706 TTCTCCTTGAATGATGAAAGTGG - Intronic
1125722531 15:41852121-41852143 GTCTCCCTGAAGCATGCAGTGGG - Intronic
1126067937 15:44840313-44840335 TGTTCCTTGAAGAATGTAGGAGG - Intergenic
1126091889 15:45060262-45060284 TGTTCCTTGAAGAATGTAGGAGG + Intronic
1127753954 15:62072115-62072137 TTTTCCTTTAATAATGAAGTTGG + Intergenic
1128427516 15:67556916-67556938 ATCTGCTTGAAAAATAAAGTTGG - Intronic
1128576632 15:68780460-68780482 TTCTCCTAGGAGGATGAAGAAGG - Exonic
1128909296 15:71497610-71497632 GACTCCTTGAACAAAGAAGTAGG - Intronic
1129068382 15:72930146-72930168 TTGGCCTTGTAGAATGAATTAGG + Intergenic
1129374273 15:75117989-75118011 TTCACCATTAAGTATGAAGTTGG + Intergenic
1130766526 15:86876782-86876804 TTTGCCTTGCAGAATGTAGTTGG + Intronic
1131725668 15:95220956-95220978 TTGGCCTTGTAGAATGAATTTGG + Intergenic
1133944808 16:10339226-10339248 TTCTACTTGAAGAATGAATAGGG - Intronic
1134390747 16:13817639-13817661 TTCTACTTTAAGAATAAAATTGG + Intergenic
1136565024 16:31064643-31064665 TGCTCATTGAAGAAAGGAGTTGG + Exonic
1136580605 16:31148973-31148995 TTATCCTTGAGGACGGAAGTGGG + Intronic
1137806345 16:51309610-51309632 TTTTCTTTGAAAAATGTAGTTGG + Intergenic
1137940714 16:52681223-52681245 TTCCACTTGAAGAAAGAAGCTGG + Intergenic
1138329624 16:56203243-56203265 TGCTGCTTGAAGAGAGAAGTAGG + Intronic
1138639842 16:58376301-58376323 TTCTTCATGACTAATGAAGTTGG + Intronic
1139115168 16:63942404-63942426 ATATCCTTCAAGAATGAAGAGGG - Intergenic
1139305744 16:65984769-65984791 TTCCCCTCGAAGAATGAAACTGG + Intergenic
1139815989 16:69672608-69672630 TTCACCTTGAAGAAAAAAATGGG + Intronic
1140950713 16:79814720-79814742 TTCTGCTTGAAAACTGAAGTAGG - Intergenic
1140988868 16:80188662-80188684 TTGTCCTGGAAGAATGGAGATGG - Intergenic
1142984719 17:3688956-3688978 TTCTCCCTGAAGAACGAGGGAGG - Intronic
1143895227 17:10130687-10130709 TTCTCCTTGTAGCATGTATTAGG - Intronic
1143945043 17:10583803-10583825 TCTTCCTGAAAGAATGAAGTAGG + Intergenic
1143980346 17:10863753-10863775 TTCTCCATGAAGTTTGAATTGGG + Intergenic
1146098843 17:29959383-29959405 TTCTGCTTGAAGAAAAAAGAGGG - Intronic
1146908721 17:36634114-36634136 TTCTCCATGGAGGATGTAGTTGG - Intergenic
1147151007 17:38513809-38513831 CTCTCCTTCAAAAATAAAGTAGG + Intergenic
1147685422 17:42284078-42284100 CTCTCCTTGAAGAAGGGACTTGG + Intergenic
1147838241 17:43350537-43350559 CTCTCCTTAAAGAAAGAGGTAGG - Intergenic
1148495184 17:48049106-48049128 CTCCCCCTGTAGAATGAAGTTGG + Intronic
1148882972 17:50745702-50745724 TTTTCCTAGAAAAATCAAGTTGG - Exonic
1148933560 17:51146729-51146751 TTATCCTTGAGGAGAGAAGTGGG - Intergenic
1149004795 17:51794321-51794343 TTCTACTGGTAGAATGAAGAAGG - Intronic
1149053749 17:52337772-52337794 CCTTCCTTGAAGAATGAACTTGG - Intergenic
1150550414 17:66204518-66204540 TTCTCCTTGAGGGAAGAAGATGG + Intergenic
1151153122 17:72104938-72104960 TTCTACTGGAAGAGTGAAGCTGG - Intergenic
1151818284 17:76482462-76482484 TTATCTTTGAAAAATGAACTGGG - Intronic
1152733310 17:81984154-81984176 TTCCACATGAAGAATGACGTGGG - Intronic
1152964700 18:104270-104292 TTCATCTTAAAGAATGAAGAAGG - Intergenic
1153370531 18:4310430-4310452 CTTACCTTAAAGAATGAAGTGGG - Intronic
1156729722 18:40176907-40176929 TTCTGCTTTAATAATGAAGATGG - Intergenic
1156888423 18:42162559-42162581 TTTTCCTTGAAAATTGATGTGGG + Intergenic
1157024218 18:43823553-43823575 TTAGTCTTGGAGAATGAAGTAGG + Intergenic
1157063154 18:44316830-44316852 TTCACCATTAAGAATGATGTTGG - Intergenic
1157075015 18:44455989-44456011 TACTTCTTGAAGCATGGAGTAGG + Intergenic
1157368238 18:47086173-47086195 TACTCCTTGAGGAAAGGAGTGGG - Intronic
1157676830 18:49574896-49574918 TTCTCCTTCCAGAAGGATGTAGG + Intronic
1158637730 18:59176338-59176360 TTCTACTGGAGGAATGAAGCTGG - Intergenic
1159672452 18:71238731-71238753 ATCTCTTTAAAGAATAAAGTAGG - Intergenic
1159754367 18:72345906-72345928 TCCTCCTTCAAGAAAGAAGTTGG - Intergenic
1161821971 19:6535107-6535129 GTCTCCATGAAGGATGGAGTAGG - Exonic
1163080408 19:14936109-14936131 TTCTCCTTTAAGAATTAAAAAGG - Intergenic
1166156909 19:40920422-40920444 TTCACCTTTAAGTATGATGTTGG - Intergenic
926515422 2:13839216-13839238 TTCCCATTGAAGTATTAAGTTGG - Intergenic
926548554 2:14272398-14272420 TTCACCTTGAGGAATGCAGTGGG - Intergenic
926817233 2:16811228-16811250 TTTACCTTGAGGAATGAAGATGG - Intergenic
927050210 2:19320756-19320778 TTCCCCTGGAAAAATCAAGTTGG - Intergenic
929758839 2:44789747-44789769 TTCTCTTTGAAGAATCAAAGAGG + Intergenic
930787823 2:55287906-55287928 TTCTCCTTCAAAAATTAAGTTGG - Exonic
930895487 2:56441003-56441025 TTCTACTTGAGGAAAGAAGTGGG - Intergenic
933861744 2:86476403-86476425 CTCTCCTTGAAGATTTAAATGGG + Intronic
935928074 2:108092181-108092203 TTGGCCTTGTAGAATGAATTTGG + Intergenic
937033041 2:118756798-118756820 TTGTTCTTGAAGAATGCAGGTGG - Intergenic
939553175 2:143640973-143640995 TTCACTTTGCAGACTGAAGTAGG + Intronic
939623067 2:144444728-144444750 TTCTCATTTCAGAGTGAAGTTGG - Intronic
940865728 2:158816155-158816177 TTCTCCTTGAAGGCAGAGGTTGG + Intronic
941880065 2:170472145-170472167 GTCTCTTTGGAGAATGAAATAGG - Intronic
941973378 2:171376817-171376839 TTTTCTTTGAAGAATGATGATGG - Intronic
942056346 2:172187178-172187200 TTATCCTTCAAAAATGAAGGAGG - Intergenic
942111744 2:172689297-172689319 TTCTCCTTGAAGAGGGGACTTGG - Intergenic
942641502 2:178066039-178066061 TTATCCTTGAAGAGAGGAGTTGG - Intronic
942769828 2:179503307-179503329 TTATCTTTGAAGAAAGAATTTGG + Intronic
942866273 2:180678947-180678969 TTTTCCTTTAACAATGAAATGGG + Intergenic
942881909 2:180871423-180871445 TTCTGCTTGAAGAAAGGAGAGGG + Intergenic
943988164 2:194650019-194650041 TACTCCTGGAAGGATGAAGAAGG - Intergenic
945000821 2:205348225-205348247 TTTTCCTTCAAGAAAGAACTTGG - Intronic
945407283 2:209464539-209464561 TTTTCCTGAAAGAATGAAGCTGG + Intronic
945805540 2:214485600-214485622 TTCTTCCTGAAAAATGTAGTAGG + Intronic
946156501 2:217810050-217810072 TTCTCCCTGAAGAATGGATCTGG - Intronic
947039559 2:225900922-225900944 CTGTCCTTGTAGAATGAATTTGG - Intergenic
947867578 2:233410246-233410268 TTCTCTTTGAAGAAAGAGGGGGG + Intronic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
1168868805 20:1111376-1111398 TTTTCATTGAAGAATGAATCAGG + Intergenic
1169665084 20:8024312-8024334 TTACCCTTGAATAATGGAGTAGG + Intergenic
1170330665 20:15207299-15207321 TTATCCTTCAGGAATGAAGGGGG - Intronic
1170821724 20:19759875-19759897 TTCCCATTGAACAATGAAGCAGG - Intergenic
1171098515 20:22357753-22357775 TTTTCTTTGAAAAATGATGTTGG - Intergenic
1171270474 20:23813095-23813117 TTATGCCTGAAAAATGAAGTGGG - Intergenic
1172203590 20:33145903-33145925 TTCTGCTTGAAAAAAGAAGAGGG - Intergenic
1173669058 20:44785091-44785113 GGCTCCTTGAACAATGAAGAAGG - Intronic
1175006687 20:55690944-55690966 TGCTCCTTAAAGAATAAAGAGGG + Intergenic
1177036344 21:16047654-16047676 TTCTCTTTAAAGAATAAAATTGG + Intergenic
1177078514 21:16608814-16608836 TTCTTCTTGGAGAATGAATGAGG + Intergenic
1177104634 21:16939690-16939712 CTGTCCTTGTAGAATGAATTTGG + Intergenic
1177708429 21:24739146-24739168 TTCTCAGGGCAGAATGAAGTAGG - Intergenic
1180101219 21:45587696-45587718 TTATCATTTTAGAATGAAGTTGG - Intergenic
949605863 3:5652840-5652862 GTCTTGTTGAAGAATGAAGAAGG + Intergenic
950424935 3:12920134-12920156 TTGTCCTTGAAGGATGAAACTGG - Intronic
950856075 3:16106569-16106591 TTCTTCTTGGACTATGAAGTTGG - Intergenic
951580163 3:24154455-24154477 TTCTCATTGAAGAATGACCAAGG - Intronic
952572100 3:34730190-34730212 TTCTCCTTGAAAACTGTAATAGG + Intergenic
953022340 3:39122795-39122817 TGCCCCTTGAAGGAGGAAGTAGG - Intronic
953139208 3:40211787-40211809 TGCTCCTTGCAGAATGATGAAGG - Intronic
953183744 3:40619748-40619770 TTCTCTTTAAAGAATGAATTTGG - Intergenic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
956713141 3:72055952-72055974 TTTCCCATGAAGGATGAAGTTGG - Intergenic
956949795 3:74268924-74268946 TTCTCCCTGAAGGCTGATGTTGG - Intronic
957788262 3:84907935-84907957 TTCCCCTTTAAGAAAAAAGTCGG - Intergenic
959676945 3:109046324-109046346 TTCTTCTTGAAGAAAGAACCAGG - Intronic
960122850 3:113965355-113965377 TCCTCCTTTAAGAATAAAGAAGG + Exonic
960776169 3:121257247-121257269 GACTCCTTGAAGAAGGAAGCTGG - Exonic
963432090 3:145220492-145220514 TTTTCCTTGAAGAGAGAGGTAGG + Intergenic
963501393 3:146131611-146131633 TCCTCCTTCATGAAAGAAGTGGG - Intronic
963596792 3:147337705-147337727 TTTTCATTGAATATTGAAGTAGG + Intergenic
964098425 3:152961063-152961085 TTCTGCTTGAAAATTGAGGTTGG - Intergenic
964195924 3:154064175-154064197 TTCTCCTTGAAGTCTCAAGAAGG + Intergenic
964965104 3:162482313-162482335 TACTCCTTGAGGAAAGAAGGGGG - Intergenic
964999935 3:162940503-162940525 TTCTGCTTGATGAATGGAGAGGG + Intergenic
965157410 3:165081766-165081788 TTCTCCTAGAAGACAGAAGCAGG + Intergenic
965341591 3:167498140-167498162 TTCACCTTTAAGAATGAAATGGG - Intronic
967236467 3:187389343-187389365 TTCTATTTGAAGAATGATGATGG - Intergenic
967524779 3:190478561-190478583 AACTCCTTGAAGAATGAAACTGG + Intergenic
967770289 3:193326777-193326799 ATCTCCATGAAAAATGGAGTAGG - Intronic
967833122 3:193939173-193939195 CTCTCTTTGAAGAATGAAGCTGG - Intergenic
968015900 3:195332529-195332551 TACTTAATGAAGAATGAAGTTGG - Intronic
970866284 4:20762592-20762614 TTCTCTATCAAGAATGAATTTGG + Intronic
970873597 4:20844435-20844457 TTCTCTTTGAACCATGAAGGAGG - Intronic
972128154 4:35796135-35796157 TTGTCCTTGTAGAATGAGTTTGG - Intergenic
972860059 4:43157139-43157161 TTGTCCTTGTAGAATGAGTTAGG + Intergenic
972889227 4:43535216-43535238 TACTCACTGAAGAAAGAAGTAGG + Intergenic
973210923 4:47614507-47614529 TTCTCCTTGAATATAGAAATTGG - Intronic
973571020 4:52239784-52239806 TTCCCCTTAAAAAATGAAGGTGG + Intergenic
973919806 4:55673561-55673583 TTCTGCTTGAAAAAAGAAGAAGG - Intergenic
974224255 4:59018476-59018498 TTCTGCTTGAAGAAAGGAGAGGG - Intergenic
976053802 4:81039231-81039253 TTTTGTTTGAAGAAAGAAGTTGG + Intronic
976667205 4:87608552-87608574 TTCTCTTTGAAGACTGAAAGTGG - Exonic
977032952 4:91910065-91910087 CACTTCTTGAAGAAGGAAGTAGG - Intergenic
977199015 4:94093292-94093314 TTGGCCTTGAAGAATGAATTTGG + Intergenic
978160091 4:105536089-105536111 TTCTCCTTTAAGAAACAAGTAGG - Intergenic
978581193 4:110232814-110232836 TTCTCCTTCAGGAATGGAGGAGG + Intergenic
978913010 4:114087679-114087701 TTCTCCCTGAAGAATGTATGAGG + Intergenic
979215598 4:118160313-118160335 TTGTCCTTCAATAATGAAGGAGG + Intronic
979495456 4:121378255-121378277 TTCTCCATGAAGTAAGAAGCAGG + Intronic
981833186 4:149025627-149025649 TACACCTTGAAGGATGATGTAGG + Intergenic
982401975 4:154978321-154978343 TTCTCCCTGAAGAAGAATGTGGG - Intergenic
982710009 4:158748534-158748556 TTATCCGTGAAGAGTGAGGTTGG + Intergenic
983249811 4:165330915-165330937 CTCTCCTTTGAGAAAGAAGTTGG + Intronic
983873982 4:172854659-172854681 TTGGCCTTGAAGAATGGAGAGGG - Intronic
984332063 4:178336193-178336215 TTCTAATTGAAAAATGACGTTGG - Intergenic
984507172 4:180634647-180634669 TGCTCCTAGAAAAATGATGTTGG + Intergenic
985073912 4:186193844-186193866 TTCACCTTGAAGATTGCAGTTGG + Intronic
985464831 4:190184066-190184088 TTCATCTTAAAGAATGAAGAAGG + Intronic
985895241 5:2746123-2746145 TTTTCCTAGAAGAATGATTTGGG - Exonic
986703002 5:10429801-10429823 TTCCCCTAGAAGAATGGACTGGG - Intronic
987676095 5:21074222-21074244 TTCACCTTAAAAAATAAAGTTGG - Intergenic
988004258 5:25387498-25387520 TTCTCCTAGAAAAATGAACTAGG + Intergenic
988663077 5:33294780-33294802 ATATGCTTCAAGAATGAAGTGGG + Intergenic
989251935 5:39327242-39327264 TTCTCCTTGAAGCTTAAATTTGG - Intronic
989270438 5:39526759-39526781 TTTTCCTCTAAGCATGAAGTAGG + Intergenic
991263645 5:64691751-64691773 TTTTGCTTGAAGAATGAATGGGG + Intronic
992912271 5:81407646-81407668 TACTCCTTAACGAATAAAGTAGG + Intergenic
994233838 5:97339139-97339161 TTCTGCTTGAAGAGAGGAGTGGG + Intergenic
994529922 5:100956433-100956455 TTCTGCTTGAGGAAAGAAGAAGG + Intergenic
994892285 5:105651566-105651588 TTGACCTTGAAGAATGAGTTGGG - Intergenic
995648137 5:114336814-114336836 TTCTGCTACTAGAATGAAGTTGG + Intergenic
995797228 5:115954606-115954628 TTTTCCATGATTAATGAAGTGGG + Intergenic
996123348 5:119695914-119695936 ATTTCCTTTAAGAATGATGTTGG + Intergenic
996766016 5:127034521-127034543 TCCTCCTTAAAGAATAAAGATGG - Intergenic
997548492 5:134731677-134731699 TTCTCCTTTAATAACAAAGTTGG - Intergenic
998985208 5:147749315-147749337 TTCTGCTGTAAGAATCAAGTAGG - Intronic
999667377 5:153927162-153927184 TTCTGCTTGAAGAAAGGAGGGGG + Intergenic
1001089973 5:168731835-168731857 TTCTCCATTAAGGATGATGTTGG - Intronic
1001113487 5:168918853-168918875 TTGACTTTGAAGAAGGAAGTTGG - Intronic
1003373446 6:5551103-5551125 TTCTCCTGCAAGAATAAAGCAGG + Intronic
1003608226 6:7584943-7584965 ATCTCCTTGAAAAATGGTGTCGG + Exonic
1003656108 6:8010246-8010268 CTCTTCTTGAATAATGAAGAAGG - Intronic
1003926409 6:10881877-10881899 TTCTCTTTAAAGAAGAAAGTGGG + Exonic
1007179607 6:39920184-39920206 TTCATGTTTAAGAATGAAGTTGG - Intronic
1009542525 6:64980610-64980632 TTCATATTGAAGAATGATGTAGG + Intronic
1009755332 6:67931914-67931936 TTCTCCTTGAAGAAAGACTGAGG + Intergenic
1009902743 6:69828741-69828763 TTCTCCTGAAAGAATAAAATAGG - Intergenic
1010343167 6:74781180-74781202 TTCTGCTTGAGGAGAGAAGTGGG + Intergenic
1010528837 6:76941781-76941803 TTCTGCTTGAGGAAAGAAGAGGG + Intergenic
1010926952 6:81754763-81754785 TTCTTCTTGAAGATTAAATTAGG - Intergenic
1011018963 6:82789364-82789386 TTCTGCTTGAAGAAAGGAGAGGG + Intergenic
1012136374 6:95562101-95562123 TTCTCCTTCTTGAATGAAGAGGG + Intergenic
1012393726 6:98771872-98771894 TTTTCCTTTAATAAAGAAGTGGG - Intergenic
1013340459 6:109209928-109209950 TTGGCCTTGTAGAATGAATTTGG + Intergenic
1014862811 6:126491070-126491092 TTCACCTTGAAAAATGTATTTGG + Intergenic
1015726553 6:136305497-136305519 CTCTCCTGGAAGAAGGAAGAAGG - Intergenic
1015807641 6:137127447-137127469 TTTTCCTTGCAGAATGATGTGGG + Intergenic
1017555460 6:155561380-155561402 TTCTAATTGAAGAATGAATCAGG + Intergenic
1018833047 6:167460701-167460723 TCCTCTTTAAAGAAAGAAGTGGG - Intergenic
1020981432 7:15074261-15074283 TTCTCCTTGAAAAAATAGGTTGG - Intergenic
1021190568 7:17615058-17615080 TTGGCCTTGAAAAATGAATTTGG - Intergenic
1021438195 7:20646086-20646108 TTCTCCATTAAGAATCAAGGAGG - Exonic
1021860896 7:24905217-24905239 GTCTCCTTGAAGAAAAAAGATGG - Intronic
1021944017 7:25707693-25707715 TTCTCCTTTAAGGAGGAAGAAGG + Intergenic
1022080636 7:27017337-27017359 TTGGCCTTGTAGAATGAATTTGG - Intergenic
1023218518 7:37893309-37893331 TGCACCATGAAGAATGAATTAGG - Intronic
1023322860 7:39018293-39018315 CTCTCCATGAAGTAGGAAGTAGG + Intronic
1023479621 7:40620089-40620111 TTCTCCTTTTAGAATTAAGCTGG + Intronic
1024192339 7:47025342-47025364 TTCTACTAGCAGAAGGAAGTCGG + Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1028133991 7:87207650-87207672 TTCTCCCTCAAGAATGTAGTAGG - Intronic
1028928062 7:96382037-96382059 TTCTCTTTGGAGAATGAGTTTGG + Intergenic
1029249889 7:99228387-99228409 TTCTCTCTTAAGAATGAATTGGG + Intergenic
1029492472 7:100879401-100879423 TTCTGCTTGAAAAATGAGGCAGG - Intronic
1030599386 7:111576013-111576035 TTGGCCTTGTAGAATGAGGTTGG - Intergenic
1030956907 7:115864182-115864204 TTCTCCTTAAAGACTGAAGTAGG - Intergenic
1032386517 7:131529378-131529400 CCCTCCTTGAAGATTGAAGCAGG - Intronic
1036237978 8:7058238-7058260 TTCTCCTTAAAAAATTAAGTTGG - Intergenic
1036442786 8:8796368-8796390 CTGTCATTGCAGAATGAAGTTGG - Intronic
1037480314 8:19299052-19299074 TTTTCCTAGAAGAATTAGGTAGG + Intergenic
1038192097 8:25332053-25332075 TTCTCTTTGAAGAATGAAAGAGG + Intronic
1038675411 8:29618373-29618395 TTCTCCTGGAAGAAAGATGGTGG + Intergenic
1039593585 8:38770732-38770754 TTCTCCCTTAAGAAAGAAGCTGG - Intronic
1040500535 8:48001124-48001146 TTGTCCTTGAATGATTAAGTTGG - Intergenic
1041119091 8:54568496-54568518 TCCTCCTTGAAAAATGGAGTAGG + Intergenic
1041252888 8:55951789-55951811 TTCTACTTGACAAATGAAGCTGG - Intronic
1041779936 8:61567072-61567094 TTCTCTTAGAAGAATTACGTGGG - Intronic
1043142826 8:76611720-76611742 TTCTACCTGGAGAGTGAAGTAGG + Intergenic
1043284950 8:78516567-78516589 TTCTCATTGCAGAATGCAGCGGG - Intronic
1043523676 8:81073633-81073655 TTCTCCTTAAAGAAAGTATTTGG - Intronic
1043602376 8:81955989-81956011 TTCTCCTTTAAGAATGAAAATGG - Intergenic
1043692576 8:83173883-83173905 TCCCCCTTAAAGAATGAAATAGG - Intergenic
1044743384 8:95350025-95350047 TTCTGATTGGAGAATGCAGTGGG + Intergenic
1044903686 8:96976467-96976489 TACTTCTTGAAGAATGATGGTGG - Intronic
1046168234 8:110468735-110468757 TTCTCCATGAAGCATTATGTAGG + Intergenic
1046335775 8:112784898-112784920 TTGTCCTTGTAGAATGAGTTTGG - Intronic
1047550383 8:125865497-125865519 TTTTCTGTGAAGAATGATGTTGG + Intergenic
1047678616 8:127230476-127230498 TTCTTGTTGATGAAGGAAGTAGG + Intergenic
1047770079 8:128023826-128023848 TTCTCCTTGAAGAATGTAACAGG - Intergenic
1048908057 8:139107347-139107369 TTCACCTGGAAGGAAGAAGTGGG + Intergenic
1049091755 8:140519994-140520016 TGTTCCTTGAAGAATGTACTTGG - Intergenic
1049249499 8:141580665-141580687 TTCTCCATCAAGGATGAAGAAGG + Intergenic
1049511081 8:143026911-143026933 TTCTCCGTGAAGAACAAATTCGG - Intergenic
1049917401 9:331534-331556 TGATCCTTGAAGAAAGAATTTGG - Intronic
1049961682 9:743412-743434 CTCTTCTGGAAGAAAGAAGTCGG - Intronic
1050030485 9:1380549-1380571 TTCTCCTTGCATCATGAAGAAGG + Intergenic
1050107564 9:2181693-2181715 ATTTACTTGAAGAATAAAGTTGG - Intronic
1050686927 9:8181996-8182018 TTGTTGTTGAAGAAAGAAGTAGG - Intergenic
1052067161 9:24036204-24036226 TTCTCCTAGAATAATCATGTTGG - Intergenic
1052093972 9:24362349-24362371 TTCTGCTTGAGGAAAGAAGAGGG + Intergenic
1052680960 9:31692003-31692025 TTCTACTTGAAGAATGAAAAGGG + Intergenic
1053724311 9:40982481-40982503 ATATCTGTGAAGAATGAAGTTGG - Intergenic
1054341658 9:63869519-63869541 ATATCTGTGAAGAATGAAGTTGG + Intergenic
1054713532 9:68535362-68535384 TTGTCCATGAAGCATGAATTTGG - Intergenic
1054713871 9:68538211-68538233 TTCTCCATCATGAATGAATTTGG + Intronic
1054958397 9:70939846-70939868 TGCTCCTTGAAGTTTGAAGGTGG + Intronic
1054968760 9:71060473-71060495 TTCTACTTGTTGAATGATGTCGG - Intronic
1055168987 9:73231533-73231555 TTCTACTTGAAGAATGACTGAGG - Intergenic
1055400673 9:75920475-75920497 TTCTCCTTTAAGAATAAAATGGG + Intronic
1055648214 9:78380717-78380739 TTCTACCTGAAGAGTGATGTTGG + Intergenic
1056003824 9:82245953-82245975 CTCTCCTTGCAGAATGAGTTTGG + Intergenic
1056261620 9:84854570-84854592 TTCTGATTGAAGTGTGAAGTTGG + Intronic
1056316154 9:85392372-85392394 TTCTGCTTAAACAATGACGTGGG - Intergenic
1056793047 9:89638512-89638534 TTCTCCACGAGGAATGAAGAGGG - Intergenic
1057194463 9:93109025-93109047 ATCTCCTGGAACAATGAGGTTGG + Intronic
1057601443 9:96461686-96461708 TTCTCATTGAAAAATGGAGAGGG + Intronic
1058018346 9:100062497-100062519 TTATCATAGAACAATGAAGTTGG + Intronic
1058174227 9:101719586-101719608 TTCTCCTTGCAGAATGAGAGGGG - Intronic
1058428930 9:104900944-104900966 TTCTTTTTAAAGAAGGAAGTGGG - Intronic
1060047291 9:120350942-120350964 TTCCCCTTGCAGCATTAAGTGGG - Intergenic
1060420207 9:123462998-123463020 TTCTCCATGCACAATGGAGTGGG - Intronic
1060464881 9:123894890-123894912 TTCACATTGCAGAATGAACTGGG + Intronic
1203450486 Un_GL000219v1:109479-109501 ATATCCGTGAAGAATGAAATTGG + Intergenic
1186503555 X:10071817-10071839 TTACCCATGAAGAAAGAAGTGGG - Intronic
1187249063 X:17580698-17580720 TTCTCCTTGGAGACTGACTTGGG - Intronic
1188485140 X:30674307-30674329 TTCTCCATGAAGCAGGAGGTAGG - Intronic
1188608694 X:32068725-32068747 TTCTCATTATAGAATTAAGTAGG - Intronic
1188899609 X:35713575-35713597 TACTGCTTGGAGCATGAAGTTGG + Intergenic
1190477128 X:50839627-50839649 TTCTACTTGAAGAATAGAATTGG - Intergenic
1190911604 X:54776541-54776563 TTCTGCTTGAAGACTGGAGAGGG + Intronic
1192286918 X:69748035-69748057 TACTCCTGGAGGAAAGAAGTAGG + Intronic
1193880143 X:86911376-86911398 TTCTGCTTGAAGAAAGCAGAGGG - Intergenic
1194360580 X:92944797-92944819 TTTTTCTTGAAGAATGTATTTGG + Intergenic
1194754381 X:97720417-97720439 TTCTCCTTGAAACATGGACTAGG - Intergenic
1195486291 X:105410674-105410696 TTATCCTTCAGAAATGAAGTAGG + Intronic
1196576664 X:117326059-117326081 TTCTGCTTGAAAAAAGAAGGAGG - Intergenic
1196648933 X:118149047-118149069 TTCACCTGGTAGAATTAAGTAGG - Intergenic
1196972526 X:121125096-121125118 TTTTACTTAAAGAATGAGGTAGG + Intergenic
1197329080 X:125131580-125131602 ATTGCCTTGAAGAATGGAGTAGG + Intergenic
1197597888 X:128488995-128489017 GTCTACTTGTAGTATGAAGTGGG + Intergenic
1197637633 X:128932940-128932962 TGATCCTTGAAGAATGAATGGGG - Intergenic
1197771429 X:130092051-130092073 CTCTCCTTGCAAAATGAAGATGG + Intronic
1198220479 X:134596437-134596459 ATATCCTTCAGGAATGAAGTGGG - Intronic
1198325471 X:135567196-135567218 CTCTCTTTGAAGAAAGAAATGGG + Intronic
1198950535 X:142066250-142066272 TTCTCCAGGAAGAATTAACTTGG - Intergenic
1199153709 X:144521059-144521081 TTCTCCATTGAGTATGAAGTGGG + Intergenic
1199839791 X:151633218-151633240 GTCTCCTTGCAGGGTGAAGTGGG + Intronic
1200668781 Y:6060611-6060633 TTTTTCTTGAAGAATGTATTTGG + Intergenic
1201980207 Y:19899094-19899116 TTCTCCTTGAAGAAAGCAGAAGG + Intergenic