ID: 1098568227

View in Genome Browser
Species Human (GRCh38)
Location 12:71959078-71959100
Sequence CAGTATAAGCAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098568227_1098568233 14 Left 1098568227 12:71959078-71959100 CCCTCCTCTTCCTGCTTATACTG 0: 1
1: 0
2: 4
3: 34
4: 504
Right 1098568233 12:71959115-71959137 ATGTCAAAACAAAACCCTCTGGG 0: 1
1: 0
2: 2
3: 20
4: 228
1098568227_1098568232 13 Left 1098568227 12:71959078-71959100 CCCTCCTCTTCCTGCTTATACTG 0: 1
1: 0
2: 4
3: 34
4: 504
Right 1098568232 12:71959114-71959136 GATGTCAAAACAAAACCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098568227 Original CRISPR CAGTATAAGCAGGAAGAGGA GGG (reversed) Intronic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901487619 1:9575947-9575969 CAGCATGACCAGGAAGGGGAAGG - Intronic
902097852 1:13961132-13961154 CATTATAAGTTGGAAGAAGAGGG - Intergenic
902513459 1:16978241-16978263 CAGGAATAGCAGGAAGAGGTAGG + Exonic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904538095 1:31214714-31214736 CAGGATAAGGAGGAAAGGGAGGG + Intronic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
906256082 1:44351496-44351518 CAGTATGAAAAGGAAGAGCATGG - Intronic
906914388 1:49993056-49993078 CACTATAAGTAGGGAAAGGATGG - Intronic
906970337 1:50506913-50506935 CAGTAATGGCAGGAAGAAGAAGG - Intronic
907096797 1:51789396-51789418 AAGTATGAACTGGAAGAGGATGG - Exonic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
907804118 1:57801612-57801634 CATGCTAAGGAGGAAGAGGAAGG - Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
909334487 1:74455762-74455784 CAGAATGAGGAGGCAGAGGAAGG - Intronic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909595870 1:77405670-77405692 CAGTGTAACCAAGAAGTGGAGGG + Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
914242517 1:145861285-145861307 CAGTAGTTGCAGGATGAGGAAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915999330 1:160599722-160599744 CATTATAATCAGGAGGAGGTGGG + Intergenic
918784748 1:188750933-188750955 CAGTAGAAAAAGGGAGAGGAGGG - Intergenic
920894950 1:210038742-210038764 CTGTATAAGCAAGAAGAGAGTGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921976884 1:221212527-221212549 AAGTATAAGGAAGAAGAAGAAGG + Intergenic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922546238 1:226459351-226459373 TAGAAAAAGCAGGAAGAAGAAGG + Intergenic
923006285 1:230052670-230052692 GAGAATAAGAAGGAAGAGGTCGG - Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923664004 1:235982794-235982816 GAGTATAAGCAGGAAGGAGAAGG + Intronic
923753440 1:236768637-236768659 CAATATAATCAGGAAGAGTTGGG - Intergenic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064265164 10:13820114-13820136 CACTAGAAGCTGGAAGAGGTGGG + Intronic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1065114896 10:22476011-22476033 AAGCATGAGCAGGAAGAGGCTGG + Intergenic
1065506363 10:26433853-26433875 GAGTAGGAGGAGGAAGAGGAGGG - Intergenic
1066114549 10:32227944-32227966 GAATAAAAGCAGGAAGAAGATGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067480424 10:46593239-46593261 CAGTAAAAGCAGCTAGAGGCAGG - Intronic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1068834200 10:61534304-61534326 GGATAAAAGCAGGAAGAGGAAGG - Intergenic
1069025432 10:63535040-63535062 CAATAAAAGTAGGAAGAGAATGG + Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070145557 10:73771309-73771331 CAGGATTAGCAGGAAAAAGAGGG - Exonic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070972570 10:80579600-80579622 GAGTAAAACCAGGAAGAGGTGGG - Intronic
1072028101 10:91485202-91485224 CAGTATAAGGAATAAGGGGAGGG - Exonic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1073327496 10:102651101-102651123 GAGTGAGAGCAGGAAGAGGAAGG - Intronic
1074031961 10:109697670-109697692 CAGTATTAGCAGGACCAGGTGGG - Intergenic
1074348181 10:112709079-112709101 CGGTCTAATCAGGAACAGGATGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076425302 10:130363266-130363288 ACCTATAAGCAGGAAGAAGACGG - Intergenic
1077783175 11:5354424-5354446 CAGTATAAGGAAGAACAGAAAGG - Intronic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078391952 11:10942699-10942721 CATTAAGAGCAGGAAGAGGTAGG - Intergenic
1079152683 11:17914935-17914957 CAGTAAAAGCAGGAAAGGAATGG + Intronic
1079444183 11:20545063-20545085 TAGTGTGGGCAGGAAGAGGAGGG - Intergenic
1080342007 11:31275400-31275422 CAGTATAGTAAGGATGAGGATGG - Intronic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080612843 11:33919812-33919834 CAGTAGAAAGAGGAAGGGGAGGG - Intergenic
1081976762 11:47240197-47240219 CACTATGAGGAGGAAGAGGATGG + Exonic
1083923422 11:65792342-65792364 CAGTACTAACAGGCAGAGGAGGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1086101027 11:83100150-83100172 CAGTATAAGAAGGAAGAACTCGG + Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087231559 11:95671781-95671803 CTGTATCAGAAGGAAGAAGAAGG + Intergenic
1088542118 11:110923947-110923969 CAGCCTAAGCCAGAAGAGGAGGG + Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089146257 11:116331526-116331548 CAAAATAGGCAGGAAGAGGGAGG + Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089874634 11:121708163-121708185 CAGTAGAAGCAGGCAGAGAGAGG - Intergenic
1089891484 11:121885927-121885949 CAGTAAAGGCAGGTAGAGGCAGG + Intergenic
1090721082 11:129473823-129473845 CAGAATAATCAGGGAGAGGGAGG + Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1092247272 12:6870696-6870718 CGGTGTAAGAAGGGAGAGGATGG - Exonic
1092915687 12:13186978-13187000 CAGCATAGGGAGGAAGTGGAGGG + Intergenic
1093219255 12:16399367-16399389 AAGTATGAGCCAGAAGAGGAAGG - Intronic
1093896672 12:24582605-24582627 CAGTAAATGCAGGAAAAGAAGGG + Intergenic
1094337065 12:29371645-29371667 GACTATATGAAGGAAGAGGAAGG - Exonic
1094777639 12:33749625-33749647 TAGTATAAGCAGTAACAGGTAGG - Intergenic
1095728372 12:45476809-45476831 CAGTCAAAGGAGGAAGAAGAGGG - Intergenic
1095978362 12:47955240-47955262 AATTCCAAGCAGGAAGAGGAAGG + Intergenic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1099019252 12:77382616-77382638 CAGTACAAGAGGGAAAAGGAGGG - Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099647964 12:85383763-85383785 CAGTATAGGCTGGAATAGGTAGG - Intergenic
1099734229 12:86547311-86547333 AAGGAAGAGCAGGAAGAGGAAGG - Intronic
1101390486 12:104295401-104295423 CAATATGAGCTGGAAGAGAAGGG - Intronic
1101475847 12:105047434-105047456 CAGTCTAAACAGGAAGAAGGAGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103826029 12:123739281-123739303 GACTATAAGCAGTAAGAGGTGGG - Intronic
1104092699 12:125529081-125529103 CAAAAGAAGAAGGAAGAGGAAGG - Intronic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1104499060 12:129267090-129267112 GAGTATAATGAGGAAGAGAAGGG - Intronic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106323423 13:28663818-28663840 CAGTCCAATCAGGAAGAAGAAGG - Intronic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1107242507 13:38253586-38253608 CAGAACAAGCATGAAGAGTAGGG - Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109516657 13:63451566-63451588 CAGTAAAAGCAAGACTAGGAGGG + Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111585873 13:90284230-90284252 CAGTATAATCATGAAAAGGCAGG + Intergenic
1111950205 13:94703755-94703777 CAGTCTATGCAGGCAGAGTAAGG + Intergenic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112763237 13:102713793-102713815 CAGTAAAAGAGGCAAGAGGAGGG + Intergenic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113292687 13:108923608-108923630 CAGTGAAAGCAGGAAGGCGAGGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1114158897 14:20140407-20140429 CAGAATTAGCAGGAAGAGAATGG + Intergenic
1114298559 14:21352753-21352775 AAGTATGAGCCGGAAGAGGAAGG - Exonic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114730491 14:24987718-24987740 CAGCCTAAGCAGGAAGATAATGG + Intronic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1117100022 14:52335919-52335941 CAGCTTGAGCAGGAAGAGGGAGG + Intergenic
1117538279 14:56721967-56721989 CAGTACAACCAGGAAAATGAGGG + Intronic
1117670769 14:58103261-58103283 CACTAGAAGCTGGAAGAGGCAGG + Intronic
1118015116 14:61652715-61652737 CAGTCTAAGCAGCAAGAAGTGGG - Intronic
1118348957 14:64960051-64960073 GAGTCACAGCAGGAAGAGGATGG - Intronic
1118832258 14:69445294-69445316 GAGGATGAGGAGGAAGAGGAGGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1121284493 14:92724763-92724785 CAGTACAAGCAGACAGAGTAGGG - Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1121748419 14:96322631-96322653 CACTACCAGGAGGAAGAGGAAGG - Exonic
1124363098 15:29053327-29053349 CAGTTTGAGGGGGAAGAGGAGGG + Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1125141229 15:36410202-36410224 GAGTATAAGGAAGAAGAGGAAGG - Intergenic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125672193 15:41481686-41481708 CAGAATCACCAGGAAGAGGCTGG - Exonic
1126212279 15:46113363-46113385 GAGTATAAGCAGGAAGAGGCTGG - Intergenic
1126473117 15:49037014-49037036 CAGTATAAGCAGGGTTAGAATGG + Intronic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1127568528 15:60216883-60216905 CATTAGAGGCAGGAAGAGGCAGG - Intergenic
1127693153 15:61417554-61417576 AAGTATAACTAGGAACAGGAAGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129178182 15:73855043-73855065 CAGTTTCAGCAGGAAAAGAAGGG + Intergenic
1130286670 15:82561095-82561117 CAATATAAACACGAAGAGGTGGG + Intronic
1130801900 15:87273268-87273290 CACTACAAGCTGGAAGAGGCAGG + Intergenic
1131024877 15:89131893-89131915 CAGCATAAGCAGGATAAGCATGG + Intronic
1131135735 15:89933690-89933712 CAGTTTGAGCAGGCAGAGCAAGG - Intergenic
1132303312 15:100789658-100789680 AAGTCTACGCAGGAAGGGGATGG + Intergenic
1132852761 16:2032350-2032372 CAGCATGGGCAGGAAGAGGTGGG + Intronic
1134060005 16:11193696-11193718 CAGGATGAGGAGGAAGAGGGAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1136133007 16:28236164-28236186 CATTATAAGTAGGAAGCAGAGGG + Intergenic
1136265272 16:29113377-29113399 CACTAGAAGCTGGAAGAGGCAGG - Intergenic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138127591 16:54451818-54451840 CACTATATGCAGAAAGATGAAGG + Intergenic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142054076 16:87981309-87981331 CACTAGAAGCTGGAAGAGGCAGG - Intronic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143695341 17:8611106-8611128 CAGTCTACTCAGGAAGAGGTTGG + Intronic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145248138 17:21283352-21283374 CAGGAGACGCAGGAAGAGAATGG + Intergenic
1145281897 17:21474152-21474174 CTGTATAAGGAAGAAGAGGGTGG - Intergenic
1145395552 17:22491468-22491490 CTGTATAAGGAAGAAGAGGGTGG + Intergenic
1146482018 17:33212402-33212424 CCCTAGAAGCCGGAAGAGGAAGG + Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1150125995 17:62635388-62635410 AAGTGTAAGGATGAAGAGGAAGG - Intronic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152940375 17:83169087-83169109 CTGTATAAGCAAGAAGAGAGTGG - Intergenic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155927542 18:31673106-31673128 CACTAAAAGAAGCAAGAGGAAGG + Intronic
1156003023 18:32406841-32406863 AAGTATAAGACTGAAGAGGAAGG + Intronic
1156263207 18:35463539-35463561 CAGCTTGAGCAGGAAAAGGAGGG - Intronic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157524630 18:48371569-48371591 CAGGATAACCAGGAAGAGAGTGG + Intronic
1157810251 18:50690037-50690059 CAGTATAGGCAGGAAGAGTTTGG + Intronic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1159072351 18:63640121-63640143 AAATAAAAGTAGGAAGAGGAGGG - Intronic
1159228229 18:65569091-65569113 CAGTACAAGAAGGAAAAGGGTGG - Intergenic
1159658370 18:71060368-71060390 AAATGTTAGCAGGAAGAGGAGGG + Intergenic
1159787829 18:72736172-72736194 GAGTATTAGCAGGAAGAATAAGG - Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1161751051 19:6097017-6097039 CAGTATAATCAGAAACAGAAAGG + Intronic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164591996 19:29512379-29512401 GAGTATAAGGAGGAAGGAGAGGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1166607281 19:44155505-44155527 AATTATAAGGAGGAAGAGGAGGG + Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167821574 19:51933078-51933100 CAGTGCAAGCAGGAAGTGAACGG - Intronic
1168231769 19:55037115-55037137 AAGGCTAAGCAGGAAGAAGATGG - Intronic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925732430 2:6928883-6928905 CAGAAGTGGCAGGAAGAGGATGG - Intronic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
927848717 2:26485682-26485704 CGGTAGAAGGTGGAAGAGGAGGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
929475566 2:42244021-42244043 CAGTATAAGCAGGAAAATTCAGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930533110 2:52614693-52614715 TAGAATAACCAGGAAGAGAATGG + Intergenic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
932869152 2:75379672-75379694 CATTCTAATCAGGCAGAGGAGGG + Intergenic
934277231 2:91584522-91584544 CAGTAGAAACTGGAAGAGGCTGG + Intergenic
936427867 2:112435267-112435289 CATTATTAGCAAGGAGAGGAGGG - Intergenic
936560866 2:113538823-113538845 AAGTATAAGCATGAATAGAAAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
939121993 2:138128358-138128380 CACTATAAGCATTAAGATGAGGG - Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940205347 2:151195946-151195968 CAGTGTAGGCAGGAAGCAGAGGG - Intergenic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941101802 2:161304825-161304847 CAGTAACAGAAGGGAGAGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942400871 2:175601799-175601821 CTGTATGAGCAGGAAGATTATGG - Intergenic
942495944 2:176540185-176540207 CAGTAAAAGGCAGAAGAGGAGGG + Intergenic
942661796 2:178273176-178273198 AAGTATATCCTGGAAGAGGAAGG + Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
944146679 2:196514169-196514191 CACTAGAAGCAGGGAGAGGCCGG - Intronic
944175204 2:196821160-196821182 CAACAGAAGCTGGAAGAGGAAGG + Intergenic
944684886 2:202109552-202109574 CAGAATCAGCAGGAAGGAGAAGG - Intronic
945978697 2:216291081-216291103 GAGTATAGGTAGGAAAAGGAAGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947587030 2:231362625-231362647 CAGTGTGAGGAAGAAGAGGATGG + Intronic
947653411 2:231806622-231806644 AAGAAACAGCAGGAAGAGGATGG - Intronic
947969792 2:234313409-234313431 CAGTGTAACAAGGAAAAGGAAGG - Intergenic
948845870 2:240682595-240682617 CAGGAAGAGCAGGAAGAGCAGGG + Exonic
948847989 2:240692135-240692157 CAGGAAGAGCAGGAAGAGCAGGG - Exonic
1168747925 20:259988-260010 GAGTATAAGGAGGGAGAGAAAGG + Exonic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1170135260 20:13066735-13066757 AAGTGTAAGAAGGAAGAGAAGGG - Intronic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170786086 20:19468901-19468923 CAGTAAAAGTAGGAAGGGAACGG + Intronic
1174004631 20:47400918-47400940 CAGTTTCAGCAGGAAGTGGTAGG - Intergenic
1174059531 20:47822769-47822791 GAGTAGGAGGAGGAAGAGGAGGG - Intergenic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174956120 20:55100443-55100465 TAGAAAAAGCAGGCAGAGGAAGG - Intergenic
1176191631 20:63813571-63813593 CAGTAGAACCAGGTAGAGGCGGG - Intronic
1176374382 21:6079944-6079966 CATTATTAGCAAGGAGAGGAGGG + Intergenic
1177676135 21:24302195-24302217 CAATATAAGTTGGAACAGGAAGG - Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1177969762 21:27775656-27775678 AAGGAAGAGCAGGAAGAGGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179749094 21:43458301-43458323 CATTATTAGCAAGGAGAGGAGGG - Intergenic
1180031095 21:45208517-45208539 CATTATGGGCAGGAAGAGCAAGG + Intronic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181733887 22:24867079-24867101 CAGTAGACGCTGGAAGCGGACGG - Exonic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182980848 22:34669409-34669431 CAGCATAAGCTGGAAATGGATGG - Intergenic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1184375827 22:44112027-44112049 GAGTGGAAGCAGGCAGAGGAGGG + Intronic
949819741 3:8103337-8103359 CACTATCAGCAGGGAAAGGAAGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951317086 3:21201388-21201410 CCTTACAAGCAGGAAGAGAATGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952509545 3:34039334-34039356 CATTATTAGCAGGGAAAGGATGG - Intergenic
952614168 3:35249457-35249479 CAGTCTAAGCAAGAGAAGGAGGG - Intergenic
953555044 3:43938768-43938790 CCCTATAAGCCAGAAGAGGATGG - Intergenic
953737445 3:45508497-45508519 CAGAACAAGGAAGAAGAGGAAGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
956304227 3:67806089-67806111 CAGAAAAAGAAGGAAGAGAAAGG - Intergenic
957629096 3:82695335-82695357 GAGTTTAATCAAGAAGAGGAAGG + Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
958615769 3:96492217-96492239 CAGTATAAGCCAGAAGAGATTGG - Intergenic
959191405 3:103116314-103116336 CAGTAAAAGCAGTAATAAGAAGG + Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960435550 3:117622218-117622240 CCCTATCAGCAGGAAGAAGAGGG + Intergenic
960647142 3:119898663-119898685 CCGTATATACAGGAAGAGTAGGG - Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961259603 3:125590617-125590639 CAAAATAATCAGGAAAAGGAAGG - Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961615359 3:128175156-128175178 CAGTACTAGTAAGAAGAGGAGGG - Intronic
962389992 3:134963105-134963127 AGGTATAAGAAGGGAGAGGAGGG - Intronic
964908018 3:161742486-161742508 GATTGTAAGTAGGAAGAGGAGGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
966040815 3:175485669-175485691 TAGAAAAAGCAGGAAGATGAAGG - Intronic
966473868 3:180322456-180322478 GAATATAAGCAGGCAGAGGCTGG - Intergenic
967014620 3:185470505-185470527 GAGTAGAAGCAGGAAGAGACGGG - Intronic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
969246648 4:5938906-5938928 AAGCATGAGCAGGCAGAGGAAGG - Intronic
969996980 4:11323415-11323437 CAGAAGAAGTAGGAAGATGAAGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG + Intergenic
970950312 4:21747985-21748007 CACCAGAAGCTGGAAGAGGAAGG + Intronic
971040373 4:22745062-22745084 CAGTATAAGGAGGAATAGAATGG - Intergenic
971580073 4:28326070-28326092 CACTATAAGCAGGAAAAAGTAGG - Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
972331833 4:38071160-38071182 CAGTAAGAGCAGGGACAGGAGGG - Intronic
973268891 4:48240323-48240345 GGGTAAAAGCAGGAAGAGAAAGG + Intronic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974723754 4:65773694-65773716 CAGTATAGGGAGGAAGTGGGTGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
976828611 4:89287575-89287597 AAGTATATGCAGGAAGAGCTGGG + Intronic
977112130 4:92971260-92971282 TATTTTAAGCAGGAAGAGCAGGG + Intronic
977269362 4:94897224-94897246 CTATATAAGCAGGAAGAGCTGGG - Intronic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
980021934 4:127721300-127721322 CCTTATAAGCTGGAAGAGGTTGG - Exonic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
980771139 4:137374554-137374576 CACTATAATCAGAAAGAGCATGG + Intergenic
981125470 4:141101397-141101419 CAATATATGGAGGTAGAGGACGG - Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG + Intergenic
984931417 4:184850852-184850874 AAGTATAAGAAGGCAGAGGCTGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986220626 5:5765758-5765780 CTGCATTATCAGGAAGAGGAGGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989303750 5:39927132-39927154 GAGTCTAAGCAGGGTGAGGAGGG + Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990981452 5:61605863-61605885 CAGTGTAAGAATTAAGAGGATGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992149535 5:73889316-73889338 CAGTTAAAGTAGCAAGAGGATGG + Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993082812 5:83322760-83322782 CACAAAAAGCTGGAAGAGGAAGG + Intronic
993880860 5:93359427-93359449 CAACATAAACAGGAAAAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
999254266 5:150201114-150201136 CAGCATGAGCAGGATGAGGTAGG - Exonic
1000129015 5:158276849-158276871 CACTATAAGCAGTAAGAAAAGGG + Intergenic
1001082344 5:168676551-168676573 TGGTAAAAGCAGGAAGGGGAGGG + Intronic
1002043153 5:176528726-176528748 CAGTGCCAGCAGGAAAAGGAGGG + Exonic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003186852 6:3839541-3839563 CACTATAAGCAGGAACAGAATGG - Intergenic
1004911492 6:20289567-20289589 CATTGTAAGCTGGAAGAGTACGG + Intergenic
1004987107 6:21095048-21095070 CAGTATACGCAATAAGTGGATGG + Intronic
1005080886 6:21955320-21955342 CAGTATGTGAAGGAAGAGGAAGG + Intergenic
1005203894 6:23378942-23378964 GAGTATAAGGAGGAAGGTGAGGG + Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006520627 6:34568997-34569019 TAGTGGAAGCAGGAACAGGACGG + Intergenic
1006633830 6:35448289-35448311 GAGTAGAAGGACGAAGAGGAGGG + Intergenic
1007085029 6:39137528-39137550 AAGCATAAGTAGGAAGAGCAGGG - Intergenic
1007208096 6:40169173-40169195 AAGTTTAAGGAGGAAGAGGATGG - Intergenic
1007290548 6:40782909-40782931 GAGGATCAGCAGGGAGAGGAGGG - Intergenic
1007477637 6:42129566-42129588 CAGTAACTGGAGGAAGAGGAAGG - Intronic
1008680435 6:53866187-53866209 GATTATAAGAAGGGAGAGGAAGG - Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1011368599 6:86608014-86608036 CAATAAAAGCAGGGAAAGGATGG - Intergenic
1011496602 6:87942935-87942957 CAGTATTAGACGGAAGAGAAGGG + Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1012272211 6:97227396-97227418 CAAAACAAGAAGGAAGAGGAGGG - Intronic
1013972687 6:116039805-116039827 GGGTGTAAGAAGGAAGAGGATGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1015206909 6:130650527-130650549 CAAAATAAGTAGCAAGAGGAAGG + Intergenic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1017150300 6:151273317-151273339 CAGTATCAGCAATAACAGGAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017898561 6:158701853-158701875 CACTAGAAGCAGGAAGAGGGAGG - Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018050224 6:160002503-160002525 GAGTAGGAGGAGGAAGAGGAGGG + Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1020917555 7:14215189-14215211 CAGAATAAACAGGAAGAATATGG + Intronic
1022150365 7:27597238-27597260 CACTATAAGCACTAAAAGGAAGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023409972 7:39880506-39880528 CATTAAAGGAAGGAAGAGGAGGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1025997319 7:66536213-66536235 CAGCATGAGCAGGAAGGGGCAGG + Intergenic
1026159053 7:67852801-67852823 CAGGAAAAGAAGGAAGAAGAGGG + Intergenic
1027942649 7:84704583-84704605 CACTAGAAGCTGGAAGAGGCAGG - Intergenic
1028041135 7:86056495-86056517 CCTTATAAGCAGGAAGAGATTGG - Intergenic
1028651548 7:93155792-93155814 TAGTAAAAGCAAGAAGAGAAAGG + Intergenic
1029191441 7:98774991-98775013 CACTAGAAGCTGGAAGAGGCAGG + Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1029575606 7:101401489-101401511 GACTAGAAGAAGGAAGAGGAGGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1031915697 7:127560853-127560875 CATAAGAAGCAGGAAGAAGAAGG + Intergenic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032456435 7:132076522-132076544 CAGCATTCACAGGAAGAGGAAGG - Intergenic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1034199103 7:149270612-149270634 CAGTTTAAGCAGGAAAATCATGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035901396 8:3461580-3461602 CTCCATCAGCAGGAAGAGGAAGG + Intronic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1038016127 8:23516732-23516754 CAATATCAGCAGGAAGGGGGTGG - Intergenic
1038654365 8:29435790-29435812 CATTTTCAGCAGGAAGAAGAAGG + Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1040684674 8:49857348-49857370 GAGTGGAGGCAGGAAGAGGAAGG + Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042801931 8:72728367-72728389 CAGGATTAACAGGAATAGGATGG - Intronic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046645766 8:116783795-116783817 CAGCATGAGCAGGCAGAAGAGGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047035007 8:120927968-120927990 AAGGATCAGCAGGAAGAGCATGG + Intergenic
1047035462 8:120933624-120933646 TAGGATAAGAAGGAAGAAGAGGG + Intergenic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1048260847 8:132943873-132943895 CAGTTTAAGGAGCAAGAGAAGGG - Intronic
1048627445 8:136200770-136200792 CAGTTTATGCAGGAAGAGACAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049891816 9:76503-76525 AAGTATAAGCATGAATAGAAAGG - Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1050893804 9:10859033-10859055 AAATACAAGCAGGAAGAAGATGG + Intergenic
1051573946 9:18593552-18593574 CAGTATAAGCAGTACTAAGAGGG - Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1052020363 9:23518718-23518740 GACTAATAGCAGGAAGAGGAAGG + Intergenic
1052763088 9:32612599-32612621 GATTATAAGCAGGAAGTGGGGGG - Intergenic
1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG + Intergenic
1053392824 9:37747960-37747982 CAGCAAAAGCAGGAACAGAAAGG + Intronic
1053733240 9:41077594-41077616 AAGTATAAGCATGAATAGAAAGG - Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056435423 9:86571103-86571125 CAGAAAAAGCAGGCAGAAGAAGG + Intergenic
1056483206 9:87027853-87027875 GAGTAAAGGCAAGAAGAGGAGGG + Intergenic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061961791 9:133992427-133992449 GAGTAGGAGGAGGAAGAGGAGGG - Intronic
1062289103 9:135786662-135786684 CAGTAGAGGCAGGCAGAGGGTGG - Intronic
1062404208 9:136387116-136387138 GAAAATAAGCAGGAAAAGGAGGG + Intronic
1185499165 X:584408-584430 AAGTAGAAGCAGGAAGAGTGGGG + Intergenic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186071482 X:5826014-5826036 GAGTAGGAGGAGGAAGAGGAGGG + Intergenic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1187966264 X:24615322-24615344 CAGTTTAAGCAGTAATAAGATGG - Intronic
1188012888 X:25076067-25076089 AAGGATAATCAGGAAGAGAATGG - Intergenic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188765957 X:34090806-34090828 CAGTGTAAGTAGGAAGTGAAGGG + Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1191103890 X:56760343-56760365 CAGCAAAAGGAGGGAGAGGAAGG - Intergenic
1191641673 X:63433857-63433879 CAGTATAAGCTGGACAATGATGG - Intergenic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1193478945 X:82002935-82002957 GAGGATAAGCAGGAAGAAGAAGG - Intergenic
1193584137 X:83299983-83300005 CAGTAGAAGGAGGAAAAGTACGG - Intergenic
1194196082 X:90894367-90894389 CAGAATAAGCAAGAAGCTGAGGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194437080 X:93879988-93880010 CAGTATAAGCAAGCAGAGAGTGG + Intergenic
1195215980 X:102702933-102702955 CCGTAGAAGCAGGAAGAGAGTGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195947286 X:110228781-110228803 GCGTATAAGCAAGATGAGGAGGG - Intronic
1195999684 X:110768554-110768576 CAGAAAAAGCAGGTAGAAGAAGG + Intronic
1196089524 X:111725095-111725117 AAGTAAAAGCAGGTACAGGAAGG - Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG + Intergenic
1198147231 X:133869494-133869516 AACTATAAGCATGATGAGGAAGG + Intronic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1202092411 Y:21208120-21208142 CAGTAACATCAGGAAAAGGAAGG + Intergenic